Expression and Enzymic Activity of Ecto 5'-Nucleotidase in the Human Male Genital Tract¹

^a Department of Anatomy and Cell Biology, Philipps-Universität, D–35033 Marburg, Germany ^b Dipartimento di Biologia Cellulare e Molecolare, Università degli studi di Perugia, I–06126 Perugia, Italy

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Human 5'-nucleotidase (5'-NT, EC 3.1.3.5) is an enzyme that hydrolyzes nucleotides such as AMP or IMP (inosine 5'-monophosphate) into inorganic phosphate and the respective nucleoside. It has been suggested that the enzyme acts as a scavenger of injured cell or membrane components or as a supplier of adenosine. We have purified to homogeneity human 5'-NT, a 69-kDa glycoprotein containing a glycosylphosphatidylinositol anchor, present in human seminal fluid. With use of a polyclonal rabbit antiserum against the protein, a strong immunoreaction was detected in prostatic epithelium, exceeding that in placental syncytiotrophoblast and amnion cells. A slightly less intense immunoreaction was present in some cells of seminal vesicle epithelium and in vesicular intraluminal secretion. In the epididymis, only the apical cell portion and particularly the stereocilia of the epididymal principal cells, as well as clusters of small nonciliated cells in the efferent ductules, were immunoreactive. In the testis, no immunoreactive cells at all were detected, and likewise no clear-cut signal was observed in testicular and epididymal spermatozoa. The immunohistochemical results were coincident with Western blots prepared from homogenates of the respective tissues. Reverse transcription-polymerase chain reaction studies were performed with primers derived from the sequence of human placental ecto 5'-NT. Using human placenta as a reference tissue, positive results were obtained in the epididymis, seminal vesicle, and prostate, but not in the testis. On Northern blots, we determined the size of the mRNA at 2.4 kilobases. The relatively strong expression of 5'-NT in the human male accessory sex glands points to a potential regulatory role of the enzyme during posttesticular modification of the sperm surface.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Posttesticular sperm maturation and capacitation are still incompletely understood issues of reproductive biology, although considerable progress has been made in elucidating the interaction between spermatozoa and secretions of the male accessory sex glands (for review, see [1–3]).

Human 5'-nucleotidase (5'-NT) is a widely distributed enzyme in pro- and eukaryotic organisms [4]. One of its functions is purine salvage [5], i.e., supply of cells with nucleosides during the synthesis of nucleotides. Cell membranes are usually impermeable for 5'-mononucleotides. The latter are hence hydrolyzed by the ecto-form of the enzyme, resident on the outer surface of the plasma membrane, producing inorganic phosphate and nucleosides, e.g., adenosine. Adenosine can easily be taken up by the cells through adenosine channels. It can be involved in ATP generation and thereby provide the energy required to elicit specific cell functions such as movement, relaxation, or contraction. The enzyme therefore is capable of allowing cells a great variety of tissue- or organ-specific actions, including regulation of coronary, cerebral, and muscular blood flow [6].

We have shown the presence of relatively high amounts of 5'-NT both in bovine seminal vesicles and on ampullary spermatozoa [7]. The enzyme localized in the acrosomal portion of ejaculated bovine sperm, however, was already present on testicular and epididymal spermatozoa, although less concentrated. It was identified as a glycosylphosphatidylinositol (GPI)-anchored ecto-form of the 5'-NT. An antibody directed against highly purified bovine seminal 5'-NT [7] showed cross-reactivity with human spermatozoa (unpublished results) and prompted us to study the distribution of this enzyme in the human male genital tract. The enzyme was isolated from human seminal plasma, and a complete biochemical characterization of the molecule was performed [8]. It consists of a single polypeptide chain of about 69 kDa and contains a GPI anchor. In contrast to the bovine enzyme, the human enzyme is not inhibited by dithiothreitol. It has been suggested, for instance, that the high amount of 5'-NT present in the human placenta modulates placental blood flow and energy supply for the fetus [9]. If the ultimate function of the enzyme is to secure energy supply to cells, its presence in the male genital system would allow further insight into the regulation of sperm functions.

We have raised a polyclonal rabbit antiserum against human seminal 5'-NT that was used for immunohistochemical localization studies. Also, the reverse transcription-polymerase chain reaction (RT-PCR) technique was performed to identify the sites of biosynthesis of this enzyme in the genital tract. Immunohistochemical and RT-PCR findings were then correlated with determinations of enzyme activities in the respective tissues. We show that a certain amount of the enzyme is present in the epididymis, but not in the testis, whereas the bulk of the enzyme present in seminal fluid is derived from the seminal vesicles and especially the prostate.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Purification of the Antigen

A detailed description of the purification procedure has been previously published [8]. Briefly, the enzyme was isolated from ammonium precipitate fractions of centrifuged human seminal plasma, which were submitted to gel chromatography using a combination of gel exclusion (S-300 HR) and affinity chromatography (Concanavalin A-Sepharose, 5'-AMP-Sepharose [Pharmacia, Freiburg, Germany]) columns. The highly purified protein fraction was obtained after elution of the 5'-AMP-affinity chromatography column with 5'-AMP-containing buffer. This fraction exhibited on SDS-PAGE only one molecular form of the enzyme with an apparent molecular mass of 69 kDa.

Antisera Production in Rabbits

The purified protein was excised from SDS gels, and equal amounts (50 µg) were mixed with Gerbu adjuvant 100 (Gerbu Biotechnik, Gaiberg, Germany). The mixture was injected altogether four times intradermally into the back skin of two young female New Zealand rabbits. Booster injections were given 4, 5, and 6 wk after the first injection. Every 2 wk during the immunization period, blood samples were taken from the rabbits through the ear vein to check the IgG fraction. Two weeks after the last booster injection, the rabbits were killed and exsanguinated, and the blood serum was deep frozen in 1-ml aliquots.

Western Blotting

Protein extracts were prepared from small tissue fragments of organ specimens (prostate, seminal vesicle, testis, epididymis) removed from prostate cancer patients (courtesy of Prof. Riedmiller, Department of Urology, Marburg, Germany), minced with a razor blade, and homogenized on ice in an Ultra-Turrax (Janke & Kunkel KG, Staufen, Germany) using a lysis buffer containing a proteinase inhibitor (5.0 mM Hepes, 0.1 mM CaCl₂, 0.5 mM NaN₃, 10 µM proteinase inhibitor FOY-305 (Sanol Schwarz, Monheim, Germany), and 2.0% 3-[(3-cholamidopropyl)-dimethylam-monio]-1-propane-sulfonate, pH 7.4). After determination of the protein content using the Bio-Rad (München, Germany) assay [10], aliquots (20 µg each) of the tissue samples and marker proteins were separated by PAGE, blotted on nitrocellulose membranes, and processed for immunodetection [11]. Membranes were incubated with the 5'-NT antiserum (1:100) for 1 h; control incubations were performed by omission of the 5'-NT antiserum. Detection of immunoreactive bands was performed by using peroxidase-conjugated swine anti-rabbit IgG (1:200; Dako, Hamburg, Germany) for 1 h. Visualization was carried out with the peroxidase reaction using 3,3'-diaminobenzidine (DAB; Sigma, Deisenhofen, Germany) as a chromogen and H₂O₂ as substrate (15 mg DAB/100 ml 50 mM sodium acetate buffer, pH 6.0, containing 0.03% H₂O₂ [12]).

Enzyme Activity Determinations

The method of Ipata [13], which is based on the hydrolysis of 5'-AMP into adenosine and inorganic phosphate, was used. Adenosine is then deaminated into inosine by incubation with adenosine deaminase (ADA). As inosine, in contrast to adenosine, has no absorbance of light at a wavelength of 265 nm, the decrease in the optical density (OD) over the reaction time is a measure of total enzyme activity. Decrease of OD at 265 nm by a factor of 1000 equals the hydrolysis of 123 µmol/L of 5'-AMP. To eliminate phosphatase activity present in the samples, 1 mM ADP[, ß-CH₂], an inhibitor of 5'-NT, was added. The resting nonspecific activity was measured as indicated above and subtracted from the total enzyme activity. The net enzyme activity equals the amount of 5'-NT enzymic activity [8]. Tissue homogenates were calibrated to a protein content of 5 µg/µl and incubated in 890 µl Tris-HCl buffer (50 mM, pH 7.5) containing 20 µl ADA (0.04 µg/µl), 70 µl 5'-AMP (1.0 µg/µl), and 20 µl of the sample to be analyzed. The mixture was read for 3 min at room temperature in a Beckman (München, Germany) spectrophotometer; decrease of OD at 265 nm was automatically recorded. All determinations were performed in triplicate.

Immunohistochemistry

Tissue samples of male and female genital organs (derived from surgery or forensic autopsies), fixed either in Bouin's solution or in 4% formaldehyde and embedded in paraffin, were taken from the files of the Department of Anatomy and cut at 5-µm thickness. Sections were mounted on chromalum (Merck, Darmstadt, Germany) -gelatin-coated glass slides, deparaffinized, and rehydrated. After preincubation with 3% normal swine serum in PBS and inhibition of endogenous peroxidase (incubation in 2% H₂O₂ in methanol), sections were incubated in a moist chamber overnight at 4°C with the anti 5'-NT antiserum (1:200). Antibody binding was detected by incubation with swine anti-rabbit IgG (diluted 1:200, 1 h) followed by a peroxidase-antiperoxidase complex-conjugated anti-rabbit IgG (1:200) for 20 min. Thereafter, the slides were incubated with a solution of 15 mg DAB dissolved in 100 ml PBS containing 0.03% H₂O₂ for 10 min at room temperature (PAP method [14]). No counterstaining of nuclei was performed, and sections were dehydrated and mounted in a synthetic resin. In addition, semithin cryosections of human snap-frozen prostate (usually benign prostatic hyperplasia) and placenta were cut at 1-µm thickness on a Reichert Jung (Nussloch, Germany) ultramicrotome with cryo-equipment using a diamond knife and were processed for indirect immunofluorescence. The secondary antibody was a CY3-labeled anti-rabbit IgG (diluted 1:50–1:100). Sections were photographed in a Zeiss Axiomat (Carl Zeiss, Oberkochen, Germany) photomicroscope equipped with epifluorescence. Control incubations comprised 1) replacement of the primary antibody by either an irrelevant antibody (anti-proline-rich protein from rat) or PBS and 2) a dilution series of the primary antibody up to 1:5000. All controls performed indicated the specificity of the immunoreactions shown.

RT-PCR

Isolation of RNA from human tissue Human placental tissue was obtained from a healthy woman immediately after childbirth (courtesy of Prof. Schulz, Department of Obstetrics and Gynecology, Marburg, Germany). RNA extraction from human placenta was performed with Trizol (Gibco BRL, Eggenstein, Germany) according to the manufacturer's protocol. Poly(A)⁺ RNA enrichment was performed with the mRNA Purification kit (Pharmacia, Freiburg, Germany) according to the manufacturer's recommendations.

Northern Blot

Total RNA (20 µg) or poly(A)⁺ RNA (3 µg) was separated on an agarose gel (1.0%) with formaldehyde. Northern downward blotting was performed with 10-times-concentrated saline sodium citrate (SSC; single-strength SSC is 0.15 M sodium chloride and 0.015 M sodium citrate) for 3 h onto positively charged nylon membranes (Boehringer Mannheim, Mannheim, Germany) according to a previously described procedure [15]. RNA was fixed by UV cross-linking with Fluo-Link (MWG Biotech, Ebersberg, Germany), followed by brief washes with double-strength SSC, and stored at -20°C until use.

RT

The total RNA was submitted to cDNA synthesis according to a method previously described [16]. Oligo(dT)_12–18 (Gibco) was used as a primer. RT was carried out in a total volume of 20 µl with the final concentrations for the reaction mixture as follows: 4 µl 5-strength RT buffer (Gibco) consisting of 0.25 M Tris-HCl (pH 8.3), 0.375 M KCl, and 15 mM MgCl₂; 1.0 µl 0.1 M dithiothreitol; 1.0 µl 10 mM of each deoxynucleotide (dATP, dCTP, dGTP, dTTP [Boehringer Mannheim]); 2.5 pmol oligo(dT)_12–18; 40 U RNase inhibitor (Boehringer Mannheim); and 200 U SuperScript Plus RNase H-reverse transcriptase (Gibco). Then 1.0 µg of total RNA was incubated in the reaction mixture described above for 1 h at 37°C.

Oligonucleotide Primers

Oligonucleotide primers were deduced from the sequence of human placental 5'-NT [17]. The primer pair 5a-HSNUK (5'-⁸³AGCTTACGATTTTGCACACC¹⁰²-3') and 5b-HSNUK (5'-³⁵⁸ATTCATGATTTCCAGTGCC³³⁹-3') resulted in a PCR fragment of 276 base pairs (bp). The second set of primers contained the sequences of primers 5a-HSNUK and 5b-HSNUK, respectively, and in addition the T7 RNA polymerase promoter sequence (Boehringer Mannheim) and an additional GG at their 5' ends. We chose the T7 promoter sequence from pGEM 3Z with the following sequence (the additional GG is given in quotation marks): 5'-`GG'TAATACGACTCACTATAG-3'. The following primers were used (the promoter sequences are underlined): 5a-HSNUKT7 5'-`GG'TAATACGACTCACTATAGAGCTTACGATTTTGCACACC-3' and 5b-HSNUKT7 5'-`GG'TAATACGACTCACTATAGATTCATGATTTCCCAGTGCC-3'.

PCR

The PCR amplification was carried out in a total volume of 50 µl with the final concentrations for the reaction mixture as follows: 2 µl of the first strand of the cDNA, 5 µl 10-strength PCR buffer (Boehringer Mannheim) consisting of 0.1 M Tris-HCl (pH 8.3), 15 mM MgCl₂, and 0.5 M KCl; 1.0 µl 10 mM of each deoxynucleotide (dATP, dCTP, dGTP, dTTP [Boehringer Mannheim]); 50 pmol primer 1 and 50 pmol primer 2. Before starting the PCR, the reaction mixture without Taq DNA polymerase was topped with 30 µl of mineral oil (Sigma, Heidelberg, Germany) and heated in the thermocycler (Dri-Block PHC-1; Techne Ltd., Duxford, Cambridge, England) to 95°C for 5 min ("hot start"). The temperature was decreased to 85°C for 5 min, and 2 U Taq DNA polymerase (Boehringer Mannheim) was added. The PCR amplification was carried out for 40 cycles with denaturation at 95°C for 1 min, annealing at 55°C for 1 min, and primer extension at 72°C for 2 min except for the last extension, which lasted 7 min.

The PCR products 1) were checked on an agarose gel (1.5%) for correctness of size and 2) were digested with HincII, which cuts the PCR products. Extractions of the PCR products from the agarose gel were performed using the Qiaex DNA Gel Extraction kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol.

Nonradioactive In Vitro Transcription and Hybridization

A 1.15-kilobase (kb) Pst I fragment of mouse cytoplasmic ß-actin [18] inserted in pBluescript (Stratagene, Heidelberg, Germany) was in vitro transcribed and labeled with digoxigenin (DIG) (see below). The antisense riboprobe was used for standardization of the RNA preparation. In vitro transcription of the PCR products for the generation of DIG-labeled antisense and sense riboprobes was performed with T7 RNA polymerase and the DIG RNA Labeling kit (SP6/T7; Boehringer Mannheim) as described previously [19]. Hybridization of the Northern blots was performed under continuous rotation in a hybridization oven (MWG Biotech). The membranes were prehybridized for 2 h at 65°C in 5-strength SSC, 50% formamide, 5% blocking reagent (Boehringer Mannheim), 0.1% N-lauroylsarcosine, and 0.02% SDS. Subsequently, the membranes were hybridized with fresh buffer and DIG-labeled antisense or sense riboprobes (100 ng/ml), respectively. Hybridization was continued overnight at 65°C. After hybridization, each membrane was washed twice for 15 min in a mixture of 0.1-strength SSC and 0.1% SDS at 65°C. After a brief washing of the membranes with buffer 1 (0.1 M maleic acid and 0.15 M NaCl [pH 7.5]) plus 0.5% SDS, the membranes were blocked with 2% blocking reagent in buffer 1 for 30 min. After incubation of anti-DIG Fab fragments conjugated to alkaline phosphatase, membranes were blocked for 30 min with buffer 1 supplemented with 2% blocking reagent. After two washes for 15 min with buffer 1 plus 0.5% SDS, the membranes were equilibrated for 5 min with assay buffer (0.1 M Tris-HCl, 0.1 M NaCl, and 0.05 M MgCl₂ [pH 9.5]). The membranes were incubated for 5 min with fresh assay buffer and the chemiluminescence substrate CSPD (diluted 1:100; Tropix, Heidelberg, Germany). Membranes were sealed in two transparencies and exposed to Fuji RX New films (Siemens AG, Frankfurt, Germany).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Enzyme Activity Determinations

Activity measurements indicated a very strong level of 5'-NT activity in preparations of prostate, relative to preparations from the placenta (about 10 times higher). In epididymis samples, the level was in the same range as in placenta (Fig. 1). No enzyme activity, however, was found in the testis.

View larger version (18K): [in this window] [in a new window]   FIG. 1. Enzyme activity of 5'-NT in placenta and male genital organs; activity is highest in prostate extracts. Each experiment was performed in triplicate; values are shown as mean ± SD.

Western Blotting

Separation and immunodetection of purified seminal 5'-NT resulted in one main band at a molecular mass of 69 kDa in prostate and seminal vesicle extracts. A similar immunoreaction was obtained with seminal fluid as well as with extracts from the prostate, seminal vesicle, epididymis, and testis (Fig. 2). The additional bands in the range of 45–60 kDa (Fig. 2, lanes 3–6) may be due to proteolytic cleavage. The tissue samples were obtained from patients undergoing surgery, and the possibility of an activation of proteases prior to the extract preparation could not be completely excluded.

View larger version (107K): [in this window] [in a new window]   FIG. 2. Western blotting of protein extracts from human male genital organs using the 5'-NT antiserum. In the first lane, 3 µg of purified human 5'-NT was applied as a positive control. A major band of 69 kDa corresponding to 5'-NT was detectable in seminal fluid (2), prostate (3), seminal vesicle (4), epididymis (5), and testis (6).

Immunohistochemistry and Immunofluorescence

In paraffin sections of the prostate, apical protrusions of secretory cells showed immunoreactivity for 5'-NT (Fig. 3a), whereas stromal smooth muscle cells and vascular endothelial cells contained some immunoreactive material only exceptionally (not shown). The immunoreactive material formed a thin rim at the apical plasma membrane of prostatic secretory cells in cryosections (Fig. 3a') processed for indirect immunofluorescence. In control sections (not shown), where the primary antibody had been omitted, no immunoreaction was seen; only few lipofuscin granules displaying autofluorescence were present. In paraffin sections of the epididymis, the principal cells lining the epididymal duct showed immunoreactivity of their apical portion, particularly the stereocilia (Fig. 3b); this was less clearly visible in cryosections examined with indirect immunofluorescence (Fig. 3b'). Seminal vesicle epithelium showed low immunoreactivity, but a few cells were interspersed that were more intensely reactive, similar to what was observed in the intraluminal secretion (Fig. 3c). An interesting distribution of immunoreactivity was observed in the epithelium lining the efferent ductules. Usually the nonciliated cells were immunoreactive (Fig. 3d). No immunoreactivity was present in the testis (Fig. 3e). Placenta at term, serving as a tissue control, displayed a moderate immunoreaction of syncytiotrophoblast cells (Fig. 3f) and the amnion, while decidua cells showed only a weak immunoreaction (not shown).

View larger version (170K): [in this window] [in a new window]   FIG. 3. Immunohistochemical distribution of 5'-NT in the prostate (a, paraffin section, PAP method; a', cryosection, indirect immunofluorescence) is most pronounced in the apical plasma membrane of secretory cells surrounding the acinar lumen (Lu). In the epididymis (b), stereocilia (SC) of the epididymal duct surrounding the lumen (Lu) were immunoreactive in paraffin sections (b, N, nuclei; A, apical cell pole). In cryosections, autofluorescing intracellular granules were more prominent than the immunoreaction of the stereocilia (b'). In the seminal vesicle (c), individual cells were strongly immunoreactive, as was some intraluminal material (Lu). In the epithelium of the efferent ductules (d), only nonciliated cells showed strong immunoreactivity (empty arrows). No immunoreactivity was present in testicular interstitial tissue (it) or in seminiferous tubules (e [sf]). A moderate reaction was present in the apical portion of the syncytiotrophoblast cells (t: tangential section through syncytiotrophoblast) in the human placenta (f). The stroma (s) of the villi was free of immunoreactivity. a, b) Magnification x1280; a',b') x2100; c–e) x800; and f) x500 (reproduced at 72%).

RT-PCR and Northern Analysis

The size of the PCR product obtained from the primer combination 5a-HSNUK and 5b-HSNUK of the human placental 5'-NT was verified on an agarose gel (Fig. 4, lane 1) and revealed the correct size of 276 bp. In addition, the PCR product was digested with HincII; the resulting fragments of 202 bp and 74 bp are shown in Figure 4 (lane 2). In tissue preparations, the mRNA of 5'-NT was expressed in the placenta, prostate, seminal vesicle, epididymis, and testis (Fig. 5).

View larger version (81K): [in this window] [in a new window]   FIG. 4. Gel electrophoresis of PCR products of human ecto 5'-NT. The PCR product of the primer combination 5a-HSNUK and 5b-HSNUK of human placental 5'-NT showed the correct size of 276 bp (lane 1). In addition, the PCR product was digested with HincII, which cuts the product at position 156/157 bp of the coding sequence. The resulting fragments of 202 bp and 74 bp are shown in lane 2. The marker (M, 123-bp DNA ladder) is shown in the right lane.

View larger version (25K): [in this window] [in a new window]   FIG. 5. RT-PCR analysis of 5'-NT in human genital organs. Primer: human ecto 5'-NT. The numbers represent the following tissues and cells: 1, placenta; 2, testis; 3, epididymis; 4, seminal vesicle; 5, prostate.

The PCR products obtained with the primer combination 5a-HSNUKT7 and 5b-HSNUKT7 were transcribed in vitro and labeled with DIG. Antisense and sense riboprobes were used in Northern blot analysis of poly(A)⁺ RNA of human placental tissue. Hybridization of the antisense riboprobe revealed a single signal for the human placental 5'-NT at 2.4 kb (Fig. 6, lane A). Overexposure of chemiluminescence detection showed a weak cross-hybridization at 1.4 kb (Fig. 6, lane C). This transcription unit could belong to a gene homologous to human 5'-NT.

View larger version (35K): [in this window] [in a new window]   FIG. 6. Northern blot analysis of human placental tissue with DIG-labeled antisense and sense riboprobes of 5'-NT. The hybridization signals were detected with CSPD. A specific signal at 2.4 kb became visible as soon as after 30 min of exposure (lane A). An overexposure of up to 3 h showed weak cross-hybridization at 1.4 kb (lane C). This transcription unit could belong to a gene homologous to the 5'-NT. Hybridization with the sense riboprobe revealed no signal (lanes B and D). Hybridization with the antisense riboprobe of cytoplasmic ß-actin is shown for only one poly(A)+ RNA preparation (lane E).

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Distribution of 5'-NT in Male Genital Organs

In this study we have shown for the first time the presence of 5'-NT in the human male genital tract. Combining determinations of enzyme activities, Western blotting of organ and tissue extracts, immunohistochemistry for cellular localization, and RT-PCR for identification of the sites of transcription, we found the enzyme at a relatively high concentration as well as enzymic activity in the epithelium of the human prostate, and somewhat less in the seminal vesicles and epididymis. This is important with respect to the occurrence of 5'-NT in prostasomes as described by Fabiani and Ronquist [20], who suggested the prostate as the sole source of 5'-NT.

Divergent results were obtained in the testis, where no immunoreactive cells were found. In Western blots prepared from testis, however, a relatively weak immunoreactive band at 69 kDa was observed. In addition, RT-PCR of testicular RNA indicated the presence of a signal in the testis. In contrast, no enzyme activity could be measured; however, this may be explained by inhibition of enzymic activity of 5'-NT in the testis. The essential result with respect to germ cells is that no 5'-NT is expressed on testicular spermatozoa. This is in clear-cut contradistinction to the situation in the bull, where the spermatogenic cells, starting from elongate spermatids, constantly contain ecto 5'-NT immunoreactivity [7].

In the epididymis, immunoreactivity for 5'-NT was prominent in the apical cell portion and particularly the stereocilia of the epididymal principal cells; in paraffin sections, the immunoreaction of the stereocilia was a little stronger than in cryosections. Correspondingly, enzyme activity and the Western blotting results pointed to the presence of considerable amounts of 5'-NT in the epididymal duct. Also, the nonciliated cells of the efferent ductules displayed strong immunoreactivity. A slightly less intense immunoreactivity was also present in some cells of the seminal vesicle epithelium and in intraluminal secretion. Much higher levels of enzyme activity and immunoreactivity were found in the prostate, indicating that an ecto-form of the enzyme is present throughout the entire posttesticular pathway containing secretory activity, culminating in the prostate. In immunofluorescence studies of semithin cryosections of the prostate, the apical (plasmalemmal) portion of the epithelium showed strong immunofluorescence. The immunolocalization of the enzyme in the prostate and epididymis varied to some extent in intensity, depending on the method used (paraffin vs. cryosections), but the distribution pattern was essentially identical.

Possible Functional Significance

Interesting hypotheses on the functional significance of the enzyme have been proposed, e.g., for the placental enzyme [6] and various blood cells, such as inhibition of platelet aggregation [21, 22], suppression of reactive oxygen species in polymorphonuclear leukocytes [23, 24], and activation of macrophages [25] and lymphocytes ([26]; for review, see [4]). These functions that occur during interaction of blood cells with the surrounding blood fluid are interesting with regard to the potential interaction of spermatozoa swimming in seminal fluids. Posttesticular maturation processes are known to occur in spermatozoa during their transit through the channel system of the male genital tract. Thereby they come into close contact with both the stereocilia of the epididymal principal cells and the secretions of the accessory sex glands. A number of exchange processes have been postulated between the seminal secretions and the sperm surface during this passage. Such an interaction of the sperm surface could also occur with either the soluble or the ecto-form of 5'-NT, as has previously been suggested for bovine spermatozoa [7].

In this context, the presence of 5'-NT in the so-called prostasomes is interesting. Ronquist and collaborators (for review, see [27]) have isolated particulate, membrane-bound structures from human semen that contain a number of different enzymes, such as peptidases, phospholipase A, ATPase, and 5'-NT, which were suggested to be derived from prostatic secretory cells and hence were named prostasomes. In a recent study using antibodies against prostasomes, we have shown that not only the prostate, but also the epididymis and seminal vesicles, and perhaps the spermatozoa themselves, contribute to the formation of these complex structures. We have therefore proposed naming these particles "seminosomes" rather than "prostasomes" [28, 29]. Such seminal particles have been reported to enhance sperm motility [20, 30] and to inhibit the immune response against seminal fluid [31]. The substance(s) responsible for these activities has not yet been identified. Fabiani and Ronquist [20] have demonstrated that 5'-NT is present in these prostasomes. As this enzyme liberates adenosine, which is responsible for a variety of physiological actions, it is one of the most interesting candidates for the interaction between spermatozoa and seminal fluid.

The interaction of spermatozoa with anchor proteins in the epididymis, which requires an as yet completely unknown mechanism, has recently been discussed by Kirchhoff and Hale [32]. These authors have pointed to the close structural relationships between rat liver, human placental, and lymphocytic 5'-NTs, the latter of which are known as CD73 [32]. Representing a GPI-anchored membrane antigen, 5'-NT may potentially interact with the sperm surface. Such a transfer of exogenous GPI-linked molecules to plasma membranes has recently been described by Ilangumaran et al. [33]. This mechanism has been suggested to be operative in blood cells, which thereby bind a number of complement restriction factors (CD55, CD59), signal-transducing molecules (CD58, CD16B, mouse CD24), or microbial virulence factors (VSG, LAM; for details see [33]). 5'-NT derived from epididymis, seminal vesicles, and prostate could be integrated into the sperm membrane and would thus act as a sperm-coating protein eliciting specific, but yet unknown, functions.

In conclusion, our studies have shown that 5'-NT is expressed and distributed along the posttesticular pathway of the spermatozoa in the epididymis, seminal vesicle, and prostate. It is likely that the protein belongs to a class of membrane-bound GPI-anchored enzymes that interact with the surface of spermatozoa during their transit through the male genital system, thereby eliciting specific, but not yet identified, effects in spermatozoa.

	ACKNOWLEDGMENTS

 
The expert technical assistance of Mr. Dirk Littauer, Mr. Michael Dreher, Mrs. Anne Henkeler, and Mrs. Wega Gutschank is gratefully acknowledged.

	FOOTNOTES

 
¹ Supported by grant no. 01KY9508/7, Bundesministerium für Bildung, Wissenschaft und Forschung, Schwerpunkt Fertilitätsstörungen.

² Correspondence: Lutz Konrad, Department of Anatomy and Cell Biology, Robert-Koch-Str. 6, D–35033 Marburg, Germany. FAX: 49–6421–28–5783; konrad{at}mailer.uni-marburg.de

Accepted: March 9, 1998.

Received: August 12, 1997.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Kirchhoff C, Ivell R. Molekulare Aspekte der Spermienreifung im Nebenhoden. Fertilitat 1995; 11:167–174.
2. Aumüller G, Seitz J. Protein secretion and secretory processes in male accessory sex glands. Int Rev Cytol 1990; 121:127–231.[Medline]
3. Lilja H, Oldbring J, Rannevik G, Laurell CB. Seminal vesicle-secreted proteins and their reactions during gelation and liquefaction of human semen. J Clin Invest 1987; 2:281–285.
4. Zimmermann H. 5'-Nucleotidase: molecular structure and functional aspects. Biochem J 1992; 285:345–365.
5. Thompson LF. Inosine 5'-nucleotidase vs inosine and hypoxanthine as substrates for purine salvage in human lymphoid cells. Proc Soc Exp Biol Med 1985; 179:432–436.[CrossRef][Medline]
6. Sundermann FW Jr. The clinical biochemistry of 5'-nucleotidase. Ann Clin Lab Sci 1990; 20:123–139.[Abstract]
7. Schiemann PJ, Aliante M, Wennemuth G, Fini C, Aumüller G. Distribution of endogenous and exogenous 5'-nucleotidase on bovine spermatozoa. Histochemistry 1994; 101:253–263.[CrossRef][Medline]
8. Fini C, Coli M, Floridi A. Purification of 5'-nucleotidase from human seminal plasma. Biochim Biophys Acta 1991; 1075:20–27.[Medline]
9. Matsubara S, Tamada T, Kurahashi K, Saito KT. Ultracytochemical localization of adenosine nucleotidase activities in the human term placenta, with special reference to 5'-nucleotidase. Acta Histochem Cytochem 1987; 20:409–419.
10. Bradford M. A rapid and sensitive method for the quantification of microgram quantifies of protein utilizing the principle of protein-dye binding. Anal Biochem 1976; 72:248–254.[CrossRef][Medline]
11. Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA 1979; 76:4350–4354.[Abstract/Free Full Text]
12. Graham RC, Karnovsky MJ. The early stages of absorption of injected horseradish peroxidase in the proximal tubule of mouse kidney: ultrastructural cytochemistry by a new technique. J Histochem Cytochem 1966; 14:291–302.[Abstract]
13. Ipata PL. A coupled optical enzyme assay for 5'-nucleotidase. Anal Biochem 1967; 20:30–36.[CrossRef][Medline]
14. Sternberger LA, Hardy PH, Cuculis JJ, Meyer HG. The unlabelled antibody enzyme method of immunohistochemistry. J Histochem Cytochem 1970; 18:315–333.[Abstract]
15. Koetsier PA, Schorr J, Doerfler W. A rapid optimized protocol for downward alkaline Southern blotting of DNA. Biotechniques 1993; 15:260–262.[Medline]
16. Lee CC, Caskey CT. cDNA cloning using degenerate primers. In: Innis M, Gelfand DH, Sninsky JJ, White TJ (eds.), PCR Protocols—A Guide to Methods and Applications. San Diego: Academic Press; 1990: 46–53.
17. Misumi Y, Ogata S, Hirose S, Ikehara Y. Primary structure of rat liver 5'-nucleotidase deduced from the cDNA. Presence of the COOH-terminal hydrophobic domain for possible post-translational modification by glycophospholipid. J Biol Chem 1990; 265:2178–2183.[Abstract/Free Full Text]
18. Alonso S, Minty A, Bourlet Y, Buckingham M. Comparison of three actin-coding sequences in the mouse; evolutionary relationships between the actin genes of warm-blooded vertebrates. J Mol Evol 1986; 23:11–22.[CrossRef][Medline]
19. Höltke H-J, Kessler C. Non-radioactive labeling of RNA transcripts in vitro with the hapten digoxigenin (DIG); hybridization and ELISA-based detection. Nucleic Acids Res 1990; 19:5843–5851.[Abstract/Free Full Text]
20. Fabiani R, Ronquist G. Association of some hydrolytic enzymes with the prostasome membrane and their differential responses to detergent and PIPLC treatment. Prostate 1995; 27:95–101.[Medline]
21. Agarwal KC. Adenosine and platelet function. In: Stefanovich V, Okayuz-Baklouti I (eds.), Role of Adenosine in Cerebral Metabolism and Blood Flow. Utrecht: VNU Science Press; 1987: 107–124.
22. Kitakaze M, Hori M, Sato H, Takashima S, Inoue M, Kitabatake A, Amada T. Endogenous adenosine inhibits platelet aggregation during myocardial ischemia in dogs. Circ Res 1991; 69:1402–1408.[Abstract/Free Full Text]
23. Cronstein BN, Levin RI, Belanoff J, Weissmann G, Hirschhorn R. Adenosine: an endogenous inhibitor of neutrophil-mediated injury to endothelial cells. J Clin Invest 1987; 78:760–770.[CrossRef]
24. Ward PA, Cunningham TW, McCulloch KK, Johnson KJ. Regulatory effects of adenosine and adenine nucleotides on oxygen radical responses of neutrophils. Lab Invest 1988; 58:438–447.[Medline]
25. Bautista AP, Solomon JB. Macrophage activation measured by changes in 5' nucleotidase and alkaline phosphodiesterase I activities after infection of newborn and juvenile guinea pigs with Mycobacterium microti. J Leukocyte Biol 1984; 35:416–426.
26. Thompson LF, Ruedi JM, Low MG. Purification of 5'-nucleotidase from human placenta after release from plasma membranes by phosphatidylinositol-specific phospholipase C. Biochem Biophys Res Commun 1987; 145:118–125.[CrossRef][Medline]
27. Ronquist G, Brody I. The prostasome: its secretion and function in man. Biochim Biophys Acta 1985; 822:203–218.[Medline]
28. Renneberg H, Konrad L, Dammshäuser I, Seitz J, Aumüller G. Immunohistochemistry of prostasomes from human semen. Prostate 1997; 30:98–106.[CrossRef][Medline]
29. Aumüller G, Renneberg H, Schiemann P-J, Wilhelm B, Seitz J, Konrad L, Wennemuth G. The role of apocrine released proteins in the post-testicular regulation of human sperm function. In: Ivell R, Holstein A-F (eds.), The Fate of the Male Germ Cell. New York: Plenum Press; 1997:193–219.
30. Fabiani R, Johannson L, Lundkvist Ö, Ronquist G. Prolongation and improvement of prostasome promotive effect on sperm forward motility. Eur J Obstet Gynecol Reprod Biol 1995; 58:191–198.[CrossRef][Medline]
31. Skibinski G, Kelly RW, James K. Expression of a common secretory granule-specific protein as a marker for the extracellular organelles (prostasomes) in human semen. Fertil Steril 1994; 61:755–759.[Medline]
32. Kirchhoff C, Hale G. Cell-to-cell transfer of glycosylphosphatidylinositol-anchored membrane proteins during sperm maturation. Mol Hum Reprod 1996; 2:177–184.[Abstract/Free Full Text]
33. Ilangumaran S, Robinson PJ, Hoessli DC. Transfer of exogenous glycosylphosphatidylinositol (GPI)-linked molecules to plasma membranes. Trends Cell Biol 1996; 6:163–167.[CrossRef][Medline]