Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Davis, A. J.
Right arrow Articles by Johnson, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davis, A. J.
Right arrow Articles by Johnson, P. A.
Agricola
Right arrow Articles by Davis, A. J.
Right arrow Articles by Johnson, P. A.
Biology of Reproduction 59, 271-277 (1998)
©Copyright 1998 Society for the Study of Reproduction, Inc.

Expression Pattern of Messenger Ribonucleic Acid for Follistatin and the Inhibin/Activin Subunits during Follicular and Testicular Development in Gallus domesticus1

Adam J. Davisa, , and Patricia A. Johnson2,a

a Department of Animal Science, Cornell University, Ithaca, New York 14853


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The expression of mRNA for follistatin and the inhibin/activin subunits was investigated in the follicles of laying hens and the testes of immature and mature roosters. Total RNA was isolated from immature and mature testes and from individual granulosa layers of the F1 through F5 follicles, from a pool of the F6-F8 follicles, from the small yellow follicles, and from the combined granulosa and theca layers of the large white follicles. Northern blot analysis was performed, and a follistatin mRNA transcript of approximately 2.4 kilobases (kb) was detected in immature testes and in the following follicles: F5, the pool of F6-F8, and small yellow and large white follicles. The greatest expression of follistatin occurred in the small yellow follicles, and in this tissue two minor transcripts of approximately 1.7 and 3.7 kb were also detected. The inhibin {alpha} subunit was expressed in both testes samples and in all of the follicles except the large white follicles. Expression of the {alpha} subunit was greatest in the F5 follicle, and expression decreased with follicle maturity. As previously reported, the inhibin/activin ßA subunit was found in the greatest abundance in the F1 follicle, with lesser amounts detected in the other hierarchical follicles and immature testes. In contrast to the ßA subunit, the inhibin/activin ßB subunit was not detected in the four largest hierarchical follicles but was expressed in greatest abundance in the pool of F6-F8 and small yellow follicles. This represents the first report, to our knowledge, of the detection of follistatin mRNA in the hen ovary and rooster testes. The restriction of follistatin mRNA expression to the small follicles suggests that follistatin, by regulating activin and/or inhibin availability, may play a critical role in early follicular development.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Inhibin and activin are two closely related glycoprotein hormones that are characterized on the basis of their ability to modulate FSH secretion from the pituitary. Inhibin is a dimeric protein composed of an {alpha} and ß subunit. Depending upon which of the two distinct but similar ß subunits (ßA and ßB) is combined with the {alpha} subunit, inhibin exists as either inhibin-A ({alpha}A) or inhibin-B ({alpha}B). Activin, on the other hand, is composed of homodimers or heterodimers of the ß subunits, resulting in activin-A (ßAA), activin-B (ßBB), or activin-AB (ßAB). Since their discovery, inhibin and activin have been shown to have diverse functions that affect a wide range of reproductive and nonreproductive cell types, as recently reviewed by several authors [14].

Follistatin is structurally unrelated to the inhibin/activin subunits. It is a monomeric glycosylated protein present in several isoforms due both to alternative splicing and to differences in glycosylation. Follistatin is a soluble-binding protein, capable of binding activin and, with less affinity, inhibin [5, 6]. The biological significance of follistatin binding is not completely understood. As reviewed by Michel et al. [7], many of the biological actions of activin seem to be neutralized by the binding of activin with follistatin; however, binding of activin by follistatin may not neutralize all biological activities of activin [8]. Changes in the bioactivity of inhibin once bound to follistatin have not been characterized.

The hen ovary is an ideal model for studying the role of the inhibin/activin family of proteins in follicular development, since the large yolk-filled preovulatory follicles on the hen ovary are arranged in a hierarchy according to size and since the development of these follicles is tightly regulated, with an interval of 24–26 h between each ovulation. The largest follicle, which will be ovulated on the subsequent day, is designated as the F1 follicle, and the second largest follicle, which will be ovulated 24–26 h after the F1 follicle, is the F2 follicle, and so on. The preovulatory follicles mature from a pool of several small yellow follicles ranging in approximate size from 5 to 12 mm in diameter. These develop from a very large pool of non-yellow yolk-containing large and small white follicles of less than 5-mm diameter.

Initial studies with the domestic chicken demonstrated the existence of bioactive inhibin in testes preparations [9] and ovarian granulosa cells [10, 11]. Later the granulosa layer of the hen preovulatory follicles was shown to be the primary expression site for the mRNA of the inhibin {alpha} subunit and of the inhibin/activin ßA subunit [12]. The expression of the mRNA for the {alpha} subunit and the ßA subunit has been examined in the granulosa layer of the five largest (F1-F5) preovulatory follicles of the hen [13]. Chen and Johnson [13] reported that the expression of the {alpha} subunit was reduced with follicular development, whereas the expression of the ßA subunit was greatly enhanced in the F1 follicle. Expression of the mRNA for the {alpha} and ßA subunit, however, has not previously been examined in the F6-F8, small yellow, or large white follicles.

There is a paucity of research with chicken follistatin, especially in adult birds. Follistatin was first cloned from chick embryos by Connolly and his colleagues [14]. They reported the predicted amino acid sequence of follistatin and examined its expression pattern in early developing chick embryos. Graham and Lumsden [15] cloned and reported the cDNA coding sequence and predicted amino acid sequence for chick follistatin and examined its expression in developing chick embryo hindbrain. The expression and regulation of follistatin in the somites of avian embryos has also been reported [16].

The present work expands upon this previously published work by examining the expression of the mRNA for the {alpha} and ßA subunits in the large preovulatory follicles as well as the small yellow follicles, large white follicles, and immature and mature testes. In addition, the mRNA expression patterns of chicken inhibin/activin ßB subunit and of follistatin are examined in these tissues for the first time. Furthermore, using reverse transcription-polymerase chain reaction (RT-PCR), the presence of mRNA encoding for follistatin was determined in a variety of adult chicken tissues.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals

The testicular tissue used in the three experiments was collected from immature (5 wk old) and mature (over 1 yr of age) single-comb White Leghorn roosters of the Cornell K-strain. Roosters were housed in age-specific groups in raised wire cages. Ovarian tissue for the three experiments was obtained from 30- to 50-wk-old single-comb White Leghorn hens of the Babcock B300-strain. The hens were individually caged, with egg records maintained at 3-h intervals during the daylight. All experimental animals had free access to water and practical diets in rooms with controlled temperature and a lighting schedule of 14L:10D (lights-on at 0600 h). Animal procedures were approved by the Institutional Animal Care and Use Committee of Cornell University.

Tissue Collection

Gonadal expression. After cervical dislocation, testes were quickly collected from roosters, placed in tubes containing ice-cold guanidine isothiocyanate solution, and then frozen in liquid nitrogen. The hens were killed by cervical dislocation at mid laying sequence between 0900 and 1400 h. The complete ovary was removed from each bird and placed into ice-cold Krebs-Ringer bicarbonate buffer (pH 7.4). The granulosa layer was separated from the theca layers [17] in all of the hierarchical follicles and small yellow follicles (5–12 mm), but in the large white follicles (2–5 mm), separation of the theca and granulosa layers was not possible because of their small size. Isolated granulosa tissue was immediately frozen in ice-cold guanidine isothiocyanate solution. Testes and the small white follicles were homogenized with an Ultra-Turrax T25 (Janke and Kumkel KG, Staufen, Germany) tissue disrupter.

Follistatin tissue distribution. Various reproductive and nonreproductive tissues were collected from hens of the same description as above except that they were 45–60 wk of age. Whole adrenal, pituitary, thyroid, and sections of breast muscle, leg muscle, heart, isthmus, magnum, shell gland, infundibulum, brain, lung, liver, spleen, and kidney were collected. Bone marrow from the leg bone, intestine (5 cm before cecal junction), the most recent postovulatory follicle, and theca and granulosa from all individual follicles were also collected. Tissues were removed as quickly as possible and placed into ice-cold guanidine isothiocyanate solution. Tissues were homogenized as described above.

RNA Extraction

Total RNA was extracted from a pool of homogenized testes obtained from 3 immature roosters and from a pool of testes from 2 mature roosters. All of the granulosa obtained from 3 birds for each individual F1-F5 follicle and from pools of the F6-F8 follicles, from all of the small yellow follicles, and from the combined granulosa and theca layers of the large white follicles were used for total RNA extraction. This extraction procedure was repeated two more times to give three total replicates (n = 3) for the gonadal expression study. Total RNA was also extracted from all of the tissues for the follistatin mRNA tissue distribution study. RNA was extracted using the guanidine isothiocyanate/phenol-chloroform method as described by Chomczynski and Sacchi [18]. The RNA concentration was estimated by reading the absorbance at 260 nm in a DU-65 Spectrophometer (Beckman, Fullerton, CA), while the integrity of the RNA was assessed by intact 27S and 18S bands on a mini-agarose gel. RNA samples were stored at -70°C.

RT-PCR

Reverse transcription was performed by adding 2.5 µg of total RNA to 405 ng of random hexamers (Pharmacia Biotech, Piscataway, NJ) and sterile double-distilled H2O in a final volume of 31 µl. The sample was heated at 94°C for 5 min and then immediately frozen at -70°C for 20 min. After the sample was thawed on ice, RT-PCR buffer (final concentration 50 mM KCl, 20 mM Tris-HCl [pH 8.3], and 2.5 mM MgCl2), dNTPs (final concentration of each 1 mM), 20 units of RNase inhibitor (Promega, Madison, WI), and 35 units of avian myeloblastosis virus reverse transcriptase (Promega) were added to the sample. The sample, with a final total volume of 50 µl, was incubated in a 42°C water bath for 2 h and then frozen at -70°C for future use.

For PCR, 10 µl of the RT reaction was added to 40 µl of a 50 mM KCl, 20 mM Tris-HCl (pH 8.3), and 2.5 mM MgCl2 solution containing 75 ng of each forward and reverse primer. Control PCR reactions were the same except that they contained no cDNA and had a 1 mM concentration of dNTPs. The PCR reaction was started with one cycle consisting of 94°C for 5 min, 55°C for 1 min, and 72°C for 10 min. Taq polymerase (Fisher Biotech, Pittsburgh, PA) was added after the 5-min 94°C incubation of this first cycle. The first cycle was followed by 33 cycles consisting of 30-sec intervals of 94°C followed by 55°C followed by 72°C. The final cycle consisted of 94°C for 1 min, 55°C for 1 min, and 72°C for 10 min. The PCR reactions were done in a Barnstead Thermolyne Amplitron II thermocycler (Dubuque, IA).

PCR Primers

All PCR primers were made by the Oligo/Peptide/Sequencing/AminoAcid Analysis Facility at Cornell University. The primers for our control cDNA, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were based on the published sequence of chicken GAPDH [19]. The forward primer sequence was 5' GACGTGCAGCAGGAACACTA 3', while the sequence of the reverse primer was 5' CCTCTGTCATCTCTCCACAGC 3'. These primers predict a product of 625 base pairs (bp) corresponding to bases 27–652 of the published sequence of Panabieres et al. [19]. The sequence of the primers for inhibin/activin ßB subunit were 5' TACTGTGAAGGGAGCTGCCCG 3' and 5' GTACAGCATTGACATTGTGC 3' for the forward and reverse primer, respectively, and were based on the partial sequence reported by Mitrani et al. [20]. These primers predict a PCR product of 162 bp, which corresponds to bases 13–174 of the reported Mitrani et al. sequence. Primers for follistatin were designed on the basis of the published sequence of chick follistatin [15]. The sequence of the forward primer was 5' CATCCCGTGCAAAGAAAC 3', and the sequence of the reverse primer was 5' CTCGTAGGCTAATCCAATG 3'. These primers predict a PCR product of 445 bp, which corresponds to bases 260–705 of the published sequence [15]. To produce sufficient quantities of cDNA for labeling for future Northern and Southern analyses, a PCR product for GAPDH and for inhibin/activin ßB subunit was cloned into the pCRII vector using the TA cloning kit (Invitrogen, San Diego, CA). The predicted sequence and orientation of each of these PCR products within its vector were confirmed by automated sequence analysis completed by the above-mentioned facility at Cornell University.

Northern Analysis for Follicle Expression Study

Forty micrograms of total RNA for each sample was run on a 1.5% agarose/formaldehyde gel and then transferred and UV cross-linked to GeneScreen Plus nylon membrane (NEN, Boston, MA), using a PosiBlot pressure blotter and UV Stratalinker 2400, respectively (Stratagene, LaJolla, CA). Northern analysis for the ßB subunit of inhibin/activin was done with a preparation of the 162-bp RT-PCR-generated piece of the ßB subunit digested from the pCRII vector. A preparation of a 223-bp RT-PCR-generated cDNA piece of chicken follistatin (generously provided by Dr. Rae Nishi, Oregon Health Sciences University, Portland, OR), digested from the pCRII vector, was used for the Northern analysis of follistatin. Both of these follistatin and ßB pieces had been successfully used as probes to screen our granulosa cell chicken cDNA library for full-length cDNA clones (data not shown). Full-length chicken cDNA clones were used as probes in the Northern analysis of the inhibin {alpha} subunit and the inhibin/activin ßA subunit [12, 21]. The procedures used in the preparation and labeling of the cDNA probes was as described previously [13]. Each of the Northern blots from the three replicates was hybridized separately with different 32P-labeled preparations of the ßB subunit, follistatin, and ßA and {alpha} subunit probes. The blots were stripped of the previously hybridized probe before being hybridized with the subsequent probe. To verify and correct for equality of RNA loading and transfer, the final hybridization of the blots was done with the RT-PCR-generated partial clone of chicken GAPDH described earlier. After each hybridization, the membranes were subjected to a stringent wash and exposed to x-ray film as described previously [12]. The films were developed using a Konica QX-70 Medical Film Processor (Wayne, NJ). The prevention of film burnout, and thus the loss of the ability to accurately quantitate the density of the sample giving the strongest signal, determined the duration of the film exposure. Therefore, the follistatin and ßA and ßB subunit films were exposed for 24 h, the {alpha} subunit films for 10–15 h, and the GAPDH films for 2–4 h. Autoradiograph signals on the films were scanned with a COHU High Performance CCD camera connected to an IS-1000 digital imaging system (Alpha Innotech Corporation, San Leandro, CA), and the intensity of the signals was calculated using ImageQuant (Version 3.3; Molecular Dynamics, Sunnyvale, CA) densitometry software. For an individual hybridization of each blot, the intensity of the sample was expressed relative to the strongest signal, which was rated as 1.

In order to determine the kilobase (kb) size of the major follistatin mRNA transcript detected and to investigate the potential presence of minor transcripts of follistatin mRNA, 40 µg of total RNA derived from small yellow follicles was run adjacent to a 0.24–9.5-kb RNA ladder (Gibco BRL, Gaithersburg, MD) on an agarose/formaldehyde gel. The procedure for the Northern analysis of this gel was as described above; however, since prevention of film burnout was not a concern, the film was exposed for 48 h so that minor transcripts could be detected.

Southern Analysis of Follistatin RT-PCR Products

Twenty microliters of the 50 µl PCR reaction for each of the follistatin and GAPDH samples was run on a 1.5% agarose gel in single-strength Tris-acetate-EDTA buffer and then transferred and UV cross-linked to GeneScreen Plus nylon membrane as described previously for the Northern analysis. Although the 445-bp follistatin and 625-bp GAPDH PCR products were visible by ethidium bromide staining, the nylon membranes were subjected to Southern hybridizations using the 32P-labeled probes described previously for the Northern hybridizations to ensure that the PCR control samples had no product present. Films were exposed for 90 sec.

Statistics

ANOVA was performed using the General Linear Model Procedure of Minitab (Release 8.2, State College, PA) with replicate and tissue as factors. Single degree of freedom tests were used to determine significant differences between samples. Differences were considered significant when p values were < 0.05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Gonadal Expression

The expression of the inhibin {alpha} subunit, follistatin, the inhibin/activin ßA and ßB subunits, and GAPDH for one of the three replicate experiments is shown in Figure 1. Results from the three experiments were very consistent.



View larger version (112K):
[in this window]
[in a new window]
 
FIG. 1. Autoradiograms from one of the three replicates of the Northern analysis of the inhibin/activin subunits and follistatin. Abbreviations: FS, follistatin; F, follicle (the subscripted number represents the hierarchical follicle order); SY, small yellow follicles; LW, large white follicles; TI, immature testes; and TM, mature testes.

Gonadal Expression of Follistatin

In the Northern analysis of total RNA derived from the granulosa of small yellow follicles, the follistatin cDNA probe hybridized to a major band of follistatin mRNA at approximately 2.4 kb and two minor bands at approximately 1.7 kb and 3.7 kb (Fig. 2). The minor follistatin mRNA transcripts were not detected in the Northern analyses of the follicle expression study (Fig. 1) since the film was exposed for less time for accurate quantification of the major transcript. After quantification by densitometry and correction for RNA loading with GAPDH, the mean ± SEM (n = 3; Fig. 3A) relative intensity of the 2.4-kb follistatin mRNA for the F5 follicle, the pool of F6-F8 follicles, the large white follicle, and immature testes was 0.03 ± 0.02, 0.11 ± 0.03, 0.23 ± 0.01, and 0.01 ± 0.01, respectively, in comparison to a mean relative intensity for the small yellow follicles of 1.00. All of the relative density values were significantly different (p < 0.05) from one another except those for the F5 follicle and immature testes.



View larger version (40K):
[in this window]
[in a new window]
 
FIG. 2. Autoradiogram from a Northern analysis of follistatin with total RNA from small yellow follicles. A 0.24- to 9.5-kb RNA ladder was run in the lane adjacent to the small yellow follicle sample, and the kilobase sizes of the RNA bands of the ladder are shown with arrows.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 3. Expression pattern of mRNA for A) follistatin, B) inhibin {alpha} subunit, C) inhibin/activin ßA-subunit, and D) inhibin/activin ßB subunit (all corrected with GAPDH). Values with different letters are significantly different from one another (p < 0.05). F, follicle (the number represents the hierarchical follicle order); SY, small yellow follicles; LW, large white follicles; TI, immature testes; and TM, mature testes.

Expression of the Inhibin {alpha} Subunit

The chicken inhibin {alpha} subunit cDNA probe hybridized to a major 1.7-kb {alpha} subunit mRNA band in the granulosa samples from yellow yolk-containing follicles and to a few minor mRNA bands, most notably a 2.4-kb band in the samples of F1 through to the pool of F6-F8. No inhibin {alpha} subunit mRNA was detected in the large white follicle sample. The mean ± SEM (Fig. 3B) relative intensity of the 1.7-kb {alpha} subunit mRNA for the F1, F2, F3, and F4 follicles, the F6-F8 pool, small yellow follicles, and immature and mature testes was 0.32 ± 0.11, 0.37 ± 0.13, 0.42 ± 0.14, 0.59 ± 0.14, 0.76 ± 0.09, 0.18 ± 0.14, 0.06 ± 0.05, and 0.02 ± 0.02, respectively, in comparison to a mean relative intensity for the F5 follicle of 1.00. The F5 granulosa had significantly greater expression of the mRNA for the inhibin {alpha} subunit than the other follicles.

Expression of the Inhibin/Activin ßA Subunit

An mRNA band of approximately 8.4 kb was detected by the chicken ßA subunit cDNA probe in all of the mature follicles, while none was detected in the less developed small yellow or large white follicles. After quantification by densitometry and correction for RNA loading with GAPDH, the mean ± SEM (Fig. 3C) relative intensity of the 8.4-kb ßA subunit mRNA for the F2, F3, F4, and F5 follicles, the pool of F6-F8 follicles, and immature testes was 0.40 ± 0.14, 0.34 ± 0.13, 0.35 ± 0.16, 0.38 ± 0.09, 0.38 ± 0.19, and 0.07 ± 0.02, respectively, in comparison to a mean relative intensity for the F1 follicle of 1.00. The expression of the inhibin/activin ßA subunit mRNA was greater in the F1 follicle than in the other follicles.

Expression of the Inhibin/Activin ßB Subunit

The chicken inhibin/activin ßB subunit cDNA probe hybridized to an mRNA transcript of approximately 4.1 kb in the F5 follicle sample, the F6-F8 pool, the small yellow follicles, and both the immature and mature testes (Fig. 1). When compared to a mean relative intensity of 1.00 for the small yellow follicles, the mean ± SEM (Fig. 3D) relative intensity of the ßB subunit mRNA transcript was 0.27 ± 0.13, 0.80 ± 0.07, 0.36 ± 0.16, and 0.02 ± 0.01 for the F5 follicle, the pool of F6-F8 follicles, immature testes, and mature testes, respectively. The expression of the mRNA for the inhibin/activin ßB subunit was less in the mature testes in comparison to the immature testes.

Follistatin mRNA Tissue Distribution

The results of the Southern analyses on the follistatin and GAPDH PCR products from various chicken tissues are shown in Figure 4. Control PCR reactions showed no product, and the quality of the cDNA produced by the reverse transcriptase reaction for all of the samples was good as determined by the GAPDH PCR reactions and subsequent Southern analysis. A follistatin PCR product was detected in all of the samples examined.



View larger version (63K):
[in this window]
[in a new window]
 
FIG. 4. Autoradiograms from the Southern analysis of the RT-PCR follistatin and GAPDH products. Con, control PCR reaction; F, follicle (the number represents the hierarchical follicle order); G, granulosa; T, theca; SYG, small yellow granulosa; LWF, large white follicles; Ist, isthmus; Mag, magnum; ShG, shell gland; Inf, infundibulum; SYT, small yellow theca; POF, postovulatory follicle; Brn, brain; Pit, pituitary; Thy, thyroid; BnM, bone marrow; BrM, breast muscle; LgM, leg muscle; Hrt, heart; Int, intestine; Lng, lung; Pcs, pancreas; Liv, liver; Spl, spleen; Kid, kidney; Adr, adrenal gland; ImT, immature testes; MtT, mature testes; FS, follistatin.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The present study is the first to report the expression of follistatin mRNA in the hen ovary and in rooster testes. Additionally, this is the first analysis of the relative expression of the inhibin/activin ßB subunit in any of the preovulatory follicles of the hen. Finally, this is the first report to characterize the expression of the mRNA for the inhibin {alpha} and ßA subunits in the nonhierarchical follicles.

By Northern analysis, a major follistatin mRNA transcript at approximately 2.4 kb and two minor follistatin mRNA transcripts at 3.7 kb and 1.7 kb were detected in a sample of total RNA derived from the granulosa of small yellow follicles. The presence of the minor bands appears to be correlated with the abundance of the major band, since the minor bands were not detected unless the major band was abundant, as it is in the granulosa of small yellow follicles. Multiple transcripts have also been reported in other species. A major transcript of 2.5 kb and a minor transcript of 1.5 kb have been reported from Northern analysis of human granulosa-luteal cells [22], porcine follicles [23], and rat decidua tissue [24]. Similarly, the reported bovine transcripts are 2.8 kb (major) and 1.8 kb (minor) [25], while in sheep [26], two major transcripts of 2.7 and 1.5 kb and a minor transcript of 0.5 kb have been detected by Northern analysis.

Two different follistatin precursor proteins have been identified in several species, consisting of either 344 or 317 amino acids. These two precursor proteins are translated from two different follistatin mRNA transcripts that have resulted from alternative splicing. The smaller precursor protein is a carboxy-truncated form of the larger precursor protein. The three partial follistatin clones isolated from our cDNA library, constructed from mRNA isolated from chicken ovarian granulosa cells from the F1-F5 follicles, all coded for the larger precursor protein (unpublished results). The full-length clone isolated by Connolly et al. [14] and Graham and Lumsden [15] from a chick embryo and chick cDNA library, respectively, and used in their in situ hybridizations, also coded for the larger protein. The fact that none of the isolated chicken clones coded for the shorter precursor protein may not be surprising if the chicken is similar to the rat. Michel et al. [27] estimated in the rat that 95% or more of the follistatin mRNA coded for the larger protein.

On the basis of RT-PCR, all of the chicken tissues examined in the current study contained mRNA for follistatin. In other species, follistatin mRNA has also been found to be widely distributed as reviewed by DePaolo et al. [1] and Michel et al. [7]. It should be noted that the detection of follistatin mRNA within specific tissues does not necessarily indicate the biosynthesis or secretion of the encoded protein. The broad distribution of follistatin mRNA may indicate that follistatin may have tissue-specific functions other than regulating activin availability. The view that follistatin has broader functions unrelated to activin is supported by the fact that the effects on mice of a follistatin gene knockout are more widespread than those of an activin knockout [28].

In the current study, the expression of follistatin, as detected by Northern analysis, was greater in the smaller immature follicles as compared to the larger preovulatory follicles. This result is in contrast to a previous study [25] with bovine follicles in which the expression of follistatin increased as follicles developed in size from small antral to preovulatory follicles. Li et al. [23] also concluded in pigs that follistatin expression increased with follicular size during pubertal development and possibly during the luteal phase of the estrous cycle. During the follicular phase, however, Li et al. reported that follistatin expression decreased as follicles developed from early (low estradiol) to advanced follicles (after estrus), and that follicle size was less relevant to follistatin mRNA expression during this phase.

The expression pattern of the mRNA for the follistatin and inhibin/activin ßB subunit was quite similar in the granulosa cell samples. Follistatin and inhibin/activin ßB subunit mRNA were both detected in follicles as they matured from small yellow to F5 follicles. Follistatin mRNA was also detected in the large white follicle sample consisting of both theca and granulosa cells. Expression of the inhibin/activin ßB subunit was also detected in the large white follicles by Northern analysis if the Northern blot films were exposed for 48 h rather than the 24 h necessary for accurate quantitation of the expression of this subunit in the other samples (Fig. 3D). We would note that it is difficult to make comparisons of the relative abundance of all of the inhibin/activin subunits and follistatin transcripts in the large white follicles because the RNA source was not pure granulosa layer as it was for the other sized follicles.

Previously in this laboratory [13], the expression of the mRNA for the inhibin {alpha} subunit and the inhibin/activin ßA subunit was examined in the granulosa cells of the F1 through F5 preovulatory hen follicles. The present study expanded upon the original study to include granulosa from a pool of F6-F8 and from the small yellow follicles. In both studies, the expression of the inhibin {alpha} subunit was maximal in the F5 follicle, and expression of the {alpha} subunit decreased with further follicle maturity, while expression of the inhibin/activin ßA subunit was greatly enhanced in the F1 follicle and was consistently expressed in the F2 through F5 follicles as previously reported. By including follicles less mature than the F5 follicle in the present study, we show that the expression of the inhibin {alpha} subunit is maximal in the F5 follicle, with decreased expression in less mature follicles. Besides being expressed in the F1 through F5 follicles, the mRNA for the inhibin/activin ßA subunit was detected only in the pool of the F6-F8 follicles. Thus, the only overlap of mRNA expression determined by Northern analysis for the inhibin/activin ßA and ßB subunits is in the F5 follicle and the pool of F6-F8 follicles.

On the basis of our finding of the greatest expression of the mRNA for the inhibin/activin ßA subunit, and the abundant expression of the inhibin {alpha} subunit in the F1 follicle, we suggest that the F1 follicle may be producing more inhibin-A than the other large preovulatory follicles. This conclusion is supported by a previous study in which a greater amount of bioactive inhibin was found in the granulosa layer of the F1 follicle than in the F3 follicle [10]. Additionally, we note the relative scarcity of the mRNA for the inhibin/activin ßA subunit and the relative abundance of the mRNA for the inhibin/activin ßB subunit in the small yellow follicles. This is associated with a lower level of the mRNA for the inhibin {alpha} subunit in the small yellow follicles when compared to the hierarchical follicles. These findings suggest that activin-B is being expressed and plays an important role in early follicular development.

While the mRNA expression data suggest that activin-B may be produced by these small follicles, they also suggest that abundant follistatin may be produced in these small follicles relative to the very large preovulatory follicles. Thus, follistatin may be tightly regulating the biological actions of activin-B, or activin-B may have bioactivities in these follicles that are not neutralized by follistatin binding. It is important to keep in mind that the follistatin mRNA expression in the granulosa cells of the small yellow follicles, and its detection in large white follicles, was based on pools of these sized follicles collected from three hens for each of the three replicate experiments. In these sized follicle pools, a majority of the follicles will never be selected into the preovulatory hierarchy [29]. Thus, it is possible that the follicles that are eventually selected express less follistatin allowing for greater bioactivity of activin. Such differences, however, would have been masked in our present experiments through pooling of all of the follicles.

The testes from immature roosters expressed the mRNA for follistatin and all of the inhibin/activin subunits. In mature rooster testes, significantly less inhibin/activin ßB subunit mRNA was detected than in immature testes. Inhibin {alpha} subunit mRNA was detected in mature roosters, but the mRNA for follistatin and the inhibin/activin ßA subunit were not detected. These findings seem to be consistent with the report on rats in which the mRNA levels of all the inhibin and activin subunits in the testes declined with age [30], and with the conclusion that inhibin-B rather than inhibin-A seems to be the major form of inhibin secreted by the testes [3134].

In summary, the mRNA for the inhibin {alpha} subunit, the inhibin/activin ßA and ßB subunits, and follistatin were all detected by Northern analysis in the granulosa of hen preovulatory follicles and rooster testes. The expression of the mRNA for the inhibin and activin subunits and follistatin varied significantly based on follicle and testes maturity. Follistatin mRNA was highly expressed in the granulosa cells of the small yellow follicles, which suggests that follistatin, possibly by regulating activin availability, may play an important role in early follicular development. The mRNA for the inhibin/activin ßA subunit was expressed in the greatest amount in the F1 follicle, while the mRNA for the inhibin/activin ßB subunit was expressed in the greatest amount in the small yellow developing follicles. These findings may suggest that the ßA subunit either as inhibin-A or as activin-A may be critical for ovulatory events, while the inhibin/activin ßB subunit may play an important role during early follicular development. Finally, future research will focus on determining what proteins are made from the inhibin/activin subunit mRNA in each follicle and on ascertaining whether increased expression of the mRNA for the inhibin/activin subunits and follistatin are correlated with increased protein expression.


    FOOTNOTES
 
1 Supported by USDA #94–37203–0791 and #97–35203–4979. Back

2 Correspondence: Patricia Johnson, 202 Morrison Hall, Department of Animal Science, Cornell University, Ithaca NY 14853. FAX: (607) 255–9829; paj1{at}cornell.edu Back

Accepted: March 16, 1998.

Received: December 11, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. DePaolo LV, Bicsak TA, Erickson GF, Shimasaki S, Ling N. Follistatin and activin: a intrinsic regulatory system within diverse tissues. Proc Soc Exp Biol Med 1991; 198:500–512.[CrossRef][Medline]
  2. Mathews LS. Activin receptors and cellular signaling by the receptor serine kinase family. Endocr Rev 1994; 15:310–325.[Abstract/Free Full Text]
  3. Halverson LM, DeCherney AH. Inhibin, activin, and follistatin in reproductive medicine. Fertil Steril 1996; 65:459–469.[Medline]
  4. Mather JP, Moore A, Li R-H. Activins, inhibins, and follistatins: further thoughts on a growing family of regulators. Proc Soc Exp Biol Med 1997; 215:209–222.[CrossRef][Medline]
  5. Shimonaka M, Inouye S, Shimasaki S, Ling N. Follistatin binds to both activin and inhibin through the common beta-subunit. Endocrinology 1991; 128:3313–3315.[Abstract/Free Full Text]
  6. Krummen LA, Woodruff TK, DeGuzman G, Cox ET, Baly DL, Mann E, Garg S, Wong W-L, Cossum P, Mather JP. Identification and characterization of binding proteins for inhibin and activin in human serum and follicular fluids. Endocrinology 1993; 132:431–443.[Abstract/Free Full Text]
  7. Michel U, Farnworth P, Findlay JK. Follistatins: more than follicle-stimulating hormone suppressing proteins. Mol Cell Endocrinol 1993; 91:1–11.[CrossRef][Medline]
  8. Mather JP, Roberts PE, Krummen LA. Follistatin modulates activin activity in a cell and tissue specific manner. Endocrinology 1993; 132:2732–2734.[Abstract/Free Full Text]
  9. Bandivdekar AH, Vijayalakshmi S, Moodbidri SB, Sheth AR. Low-molecular—weight inhibin from sheep, human, rat and chicken testes. J Androl 1982; 3:140–143.[Abstract]
  10. Akashiba H, Taya K, Sasamoto S, Goto H, Kamiyoshi M, Tanaka K. Secretion of inhibin by chicken granulosa cells in vitro. Poult Sci 1988; 67:1625–1631.[Medline]
  11. Tsonis CG, Sharp PJ, McNeilly AS. Inhibin bioactivity and pituitary cell mitogenic activity from cultured chicken ovarian granulosa and thecal/stromal cells. J Endocrinol 1988; 116:293–299.[Abstract/Free Full Text]
  12. Chen C-C, Johnson PA. Molecular cloning of inhibin/activin ßA-subunit complementary deoxyribonucleic acid and expression of inhibin/activin {alpha} and ßA subunit in the domestic hen. Biol Reprod 1996; 54:429–435.[Abstract]
  13. Chen C-C, Johnson PA. Expression of inhibin {alpha} and inhibin/activin ßA subunits in the granulosa layer of the large preovulatory follicles of the hen. Biol Reprod 1996; 55:450–454.[Abstract]
  14. Connolly DJ, Patel K, Seleiro EAP, Wilkinson DG, Cooke J. Cloning, sequencing and expressional analysis of the chick homologue of follistatin. Dev Genet 1995; 17:65–77.[CrossRef][Medline]
  15. Graham A, Lumsden A. Interactions between rhombomeres modulate Krox-20 and follistatin expression in the chick embryo hindbrain. Development 1996; 122:473–480.[Abstract]
  16. Amthor H, Connolly D, Patel K, Brand-Saberi B, Wilkinson DG, Cooke J, Christ B. The expression and regulation of follistatin and a follistatin-like gene during avian somite compartmentalization and myogenesis. Dev Biol 1996; 178:343–362.[CrossRef][Medline]
  17. Huang ES-R, Nalbandov AV. Steroidogenesis of chicken granulosa and theca cells: in vitro incubation system. Biol Reprod 1979; 20:442–453.[Abstract]
  18. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidium thiocyanate. Anal Biochem 1987; 162:156–159.[Medline]
  19. Panabieres F, Piechaczyk M, Rainer B, Dani C, Fort P, Riaad S, Marty L, Imbach JL, Jeanteur P, Blanchard J-MM. Complete nucleotide sequence of the messenger RNA coding for chicken muscle glyceraldehyde-3-phosphate dehydrogenase. Biochem Biophys Res Commun 1984; 118:767–773.[CrossRef][Medline]
  20. Mitrani E, Ziv T, Thomsen G, Shimoni Y, Melton DA, Bril A. Activin can induce the formation of axial structures and is expressed in the hypoblast of the chick. Cell 1990; 63:495–501.[CrossRef][Medline]
  21. Wang S-Y, Johnson PA. Complementary deoxyribonucleic acid cloning and sequence analysis of the {alpha} subunit of inhibin from chicken ovarian granulosa cells. Biol Reprod 1993; 49:453–458.[Abstract]
  22. Tuuri T, Ritvos O. Regulation of the activin-binding protein follistatin in culture human luteinizing granulosa cells: characterization of the effects of follicle stimulating hormone, prostaglandin E2, and different growth factors. Biol Reprod 1995; 53:1508–1516.[Abstract]
  23. Li MD, DePaolo LV, Ford JJ. Expression of follistatin and Inhibin/activin subunit genes in porcine follicles. Biol Reprod 1997; 57:112–118.[Abstract]
  24. Kaiser M, Gibori G, Mayo KE. The rat follistatin gene is highly expressed in decidual tissue. Endocrinology 1990; 126:2768–2770.[Abstract/Free Full Text]
  25. Shukovski L, Zhang ZW, Michel U, Findlay JK. Expression of mRNA for follicle-stimulating hormone suppressing protein in ovarian tissues of cows. J Reprod Fertil 1992; 95:861–867.[Abstract/Free Full Text]
  26. Tisdall DJ, Hill DF, Petersen GB, Fleming JS. Ovine follistatin: characterization of cDNA and expression in sheep ovary during the luteal phase of the oestrous cycle. J Mol Endocrinol 1992; 8:259–264.[Abstract/Free Full Text]
  27. Michel U, Albiston A, Findlay JK. Rat follistatin: gonadal and extragonadal expression and evidence for alternative splicing. Biochem Biophys Res Commun 1990; 173:401–407.[CrossRef][Medline]
  28. Matzuk MM, Lu N, Vogel H, Sellheyer K, Roop DR, Bradley A. Multiple defects and perinatal death in mice deficient in follistatin. Nature 1995: 374:360–363.
  29. Johnson AL. The avian ovarian hierarchy: a balance between follicle differentiation and atresia. Poult Avian Biol Rev 1996; 7:99–110.
  30. Meunier H, Rivier C, Evans RM, Vale W. Gonadal and extragonadal expression of inhibin {alpha}, ßA, and ßB subunits in various tissues predicts diverse functions. Proc Natl Acad Sci USA 1988; 85:247–251.[Abstract/Free Full Text]
  31. Rivier C, Cajander S, Vaughan J, Hsueh AJ, Vale W. Age-dependent changes in physiological action, content, and immunostaining of inhibin in male rats. Endocrinology 1988; 123:120–126.[Abstract/Free Full Text]
  32. Shaha C, Morris PL, Chen C-LC, Vale W, Bardin CW. Immunostaininable inhibin subunits are in multiple types of testicular cells. Endocrinology 1989; 125:1941–1950.[Abstract/Free Full Text]
  33. Rabinovici J, Goldsmith PC, Roberts VJ, Vaughan J, Vale W, Jaffe RB. Localization and secretion of inhibin/activin subunits in the human and subhuman primate fetal gonads. J Clin Endocrinol & Metab 1991; 73:1141–1149.[Abstract/Free Full Text]
  34. Illingworth PJ, Groome NP, Byrd W, Rainey WE, McNeilly AS, Mather JP, Bremner WJ. Inhibin-B: a likely candidate for the physiologically important form of inhibin in men. J Clin Endocrinol & Metab 1996; E81:1321–1325.



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
P.A Johnson, T.R Kent, M.E Urick, and J.R Giles
Expression and Regulation of Anti-Mullerian Hormone in an Oviparous Species, the Hen
Biol Reprod, January 1, 2008; 78(1): 13 - 19.
[Abstract] [Full Text] [PDF]


Home page
Poult. Sci.Home page
T. P. Chendrimada, M. E. Freeman, and A. J. Davis
Dietary Nitrogen Intake Regulates Hepatic Malic Enzyme Messenger Ribonucleic Acid Expression
Poult. Sci., September 1, 2007; 86(9): 1980 - 1987.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
T. M Lovell, S. L Al-Musawi, R. T Gladwell, and P. G Knight
Gonadotrophins modulate hormone secretion and steady-state mRNA levels for activin receptors (type I, IIA, IIB) and inhibin co-receptor (betaglycan) in granulosa and theca cells from chicken prehierarchical and preovulatory follicles
Reproduction, June 1, 2007; 133(6): 1159 - 1168.
[Abstract] [Full Text] [PDF]


Home page
Poult. Sci.Home page
J. B. Hoffman, A. P. Benson, V. L. Christensen, B. D. Fairchild, and A. J. Davis
Follicular Development and Expression of the Messenger Ribonucleic Acid for the Inhibin/Activin Subunits in Two Genetic Lines of Turkey Hens that Differ in Total Egg Production
Poult. Sci., May 1, 2007; 86(5): 944 - 952.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
T M Lovell, P G Knight, and R T Gladwell
Variation in pituitary expression of mRNAs encoding the putative inhibin co-receptor (betaglycan) and type-I and type-II activin receptors during the chicken ovulatory cycle
J. Endocrinol., September 1, 2005; 186(3): 447 - 455.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
P.A. Johnson, M.J. Dickens, T.R. Kent, and J.R. Giles
Expression and Function of Growth Differentiation Factor-9 in an Oviparous Species, Gallus domesticus
Biol Reprod, May 1, 2005; 72(5): 1095 - 1100.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. A. Sweeney and P. A. Johnson
Messenger RNA and Protein Expression Analysis of Betaglycan in the Pituitary and Ovary of the Domestic Hen
Biol Reprod, January 1, 2005; 72(1): 172 - 178.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Y. Wang and W. Ge
Developmental Profiles of Activin {beta}A, {beta}B, and Follistatin Expression in the Zebrafish Ovary: Evidence for Their Differential Roles During Sexual Maturation and Ovulatory Cycle
Biol Reprod, December 1, 2004; 71(6): 2056 - 2064.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Y. Wang and W. Ge
Cloning of Epidermal Growth Factor (EGF) and EGF Receptor from the Zebrafish Ovary: Evidence for EGF as a Potential Paracrine Factor from the Oocyte to Regulate Activin/Follistatin System in the Follicle Cells
Biol Reprod, September 1, 2004; 71(3): 749 - 760.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Wang and W. Ge
Involvement of Cyclic Adenosine 3',5'-Monophosphate in the Differential Regulation of Activin {beta}A and {beta}B Expression by Gonadotropin in the Zebrafish Ovarian Follicle Cells
Endocrinology, February 1, 2003; 144(2): 491 - 499.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. J. Davis, C. F. Brooks, and P. A. Johnson
Activin A and Gonadotropin Regulation of Follicle-Stimulating Hormone and Luteinizing Hormone Receptor Messenger RNA in Avian Granulosa Cells
Biol Reprod, November 1, 2001; 65(5): 1352 - 1358.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
K. A. Adams and A. J. Davis
Dietary Protein Concentration Regulates the mRNA Expression of Chicken Hepatic Malic Enzyme
J. Nutr., September 1, 2001; 131(9): 2269 - 2274.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. J. Davis, C. F. Brooks, and P. A. Johnson
Follicle-Stimulating Hormone Regulation of Inhibin {{alpha}}- and {beta}B-Subunit and Follistatin Messenger Ribonucleic Acid in Cultured Avian Granulosa Cells
Biol Reprod, January 1, 2001; 64(1): 100 - 106.
[Abstract] [Full Text]


Home page
Biol. Reprod.Home page
T. M. Lovell, P. G. Knight, N. P. Groome, and R. T. Gladwell
Changes in Plasma Inhibin A Levels During Sexual Maturation in the Female Chicken and the Effects of Active Immunization Against Inhibin {{alpha}}-Subunit on Reproductive Hormone Profiles and Ovarian Function
Biol Reprod, January 1, 2001; 64(1): 188 - 196.
[Abstract] [Full Text]


Home page
Biol. Reprod.Home page
T. M. Lovell, P. G. Knight, N. P. Groome, and R. T. Gladwell
Measurement of Dimeric Inhibins and Effects of Active Immunization Against Inhibin {alpha}-Subunit on Plasma Hormones and Testis Morphology in the Developing Cockerel
Biol Reprod, July 1, 2000; 63(1): 213 - 221.
[Abstract] [Full Text]


Home page
Biol. Reprod.Home page
D. J. Hecht, A. J. Davis, C. F. Brooks, and P. A. Johnson
Molecular Cloning and Expression Analysis of the Complementary Deoxyribonucleic Acid for Chicken Inhibin/Activin {beta}B Subunit
Biol Reprod, May 1, 2000; 62(5): 1128 - 1134.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Davis, A. J.
Right arrow Articles by Johnson, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davis, A. J.
Right arrow Articles by Johnson, P. A.
Agricola
Right arrow Articles by Davis, A. J.
Right arrow Articles by Johnson, P. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS