Calcyclin in the Mouse Decidua: Expression and Effects on Placental Lactogen Secretion¹

^a Department of Biology, University of California, Santa Cruz, California 95064

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Placental lactogens are protein hormones produced by the placentas of many mammals. These hormones have diverse reproductive functions and are structurally similar to the pituitary hormones growth hormone and prolactin. Isolated decidual cells were previously shown to release a protein that stimulates mouse placental lactogen (mPL)-II release from mouse trophoblast cells in culture. Partial amino acid sequence data suggested that this protein shared sequence identity with mouse calcyclin. In the present study the sequence identity of this protein was determined by sequencing reverse transcription-polymerase chain reaction (RT-PCR) products. The sequence matched that of mouse calcyclin. The distribution of calcyclin message was determined in the conceptus by in situ hybridization, and a gestational profile of calcyclin mRNA was determined by Northern blot analysis. Calcyclin was localized primarily to cells that exhibited a uterine natural killer cell morphology within the decidua and to glycogen cells of the labyrinth and junctional zone. Although calcyclin was detectable by RT-PCR in midterm placentas, isolated trophoblast cells in culture did not contain detectable quantities of calcyclin by RT-PCR. Calcyclin stimulated secretion of mPL-II from isolated trophoblast cells in vitro but did not affect mPL-I secretion.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The establishment and maintenance of pregnancy in eutherians requires changes in the maternal environment from the nonpregnant state and the generation of a transient set of tissues known collectively as the placenta (for review see [1]). In rodents the hormone-primed uterine endometrial stroma undergoes extensive remodeling in response to blastocyst implantation, generating a tissue known as the decidua. The decidua encapsulates the blastocyst and provides an environment through which the trophoblast cells invade, proliferate, and differentiate. The progressive interactions of these two tissues results in the establishment of a highly ordered structure that protects and supports the growth and development of the fetus.

The trophoblast is composed of a heterologous population of cells with many different functions. The giant cells invade the decidua most deeply and demarcate the boundary between blastocyst and maternally derived tissues. These cells are also involved in the biosynthesis of protein and steroid hormones. Giant cells secrete large amounts of placental lactogens I and II (mPL-I and mPL-II), which are prolactin-like hormones that have been shown to regulate many aspects of the maternal environment in an endocrine fashion [2]. Mechanisms for the control of release and resulting maternal serum concentrations of these hormones include genetic background [3], maternal metabolic state, and a number of cytokines [4–6]. Most of the factors that affect placental lactogen secretion seem to act in a tropic manner; and a releasing factor for the placental lactogens, reminiscent of those of the pituitary/hypothalamic axis, has not been identified.

The decidua, in addition to many functions in support of placentation, can also act in the paracrine regulation of trophoblast function [7]. For this reason, control of mPL-II release through paracrine regulation was explored by the coculture of decidual and trophoblast explants (unpublished results), resulting in the isolation of a soluble factor that increased mPL-II release.

The decidual factor was purified and partially characterized [8]. The protein stimulated mPL-II release from isolated trophoblast cells in a dose-dependent manner. Cultured decidual cells released this protein factor into culture media. The highest concentrations of the protein were in the decidua, with lower but still detectable levels in lung, trophoblast, and stomach, as determined by Western blot analysis [8]. A partial amino acid sequence was obtained, and it indicated that the factor had a high sequence identity with a previously reported protein called calcyclin.

The present study was undertaken to clone and sequence the reverse transcription-polymerase chain reaction (RT-PCR) product of the factor. The ontogeny and tissue distribution of mRNA was determined by Northern blot analysis and in situ hybridization, respectively. Finally, isolated trophoblast cells that secrete both mPL-I and mPL-II were treated with calcyclin to determine whether there is specificity to the stimulation of placental lactogen secretion by calcyclin.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Animals and Tissue Collection

Swiss Webster mice (Simonsen Laboratories, Gilroy, CA) were killed by cervical dislocation under halothane anesthesia. All animal use was approved by the Chancellor's Animal Use Committee of the University of California.

For RT-PCR, whole conceptuses were removed and decidua were separated under a dissecting microscope. Decidua from 6–10 Day 10 pregnant mice (vaginal plug = Day 0 of pregnancy) were pooled, and decidual cells were isolated as previously reported [8]. Total decidual cell preparations, as well as whole maternal kidney, liver, and placenta, were frozen on dry ice and stored at -80°C.

For histology, mice were killed as outlined above on Days 8, 10, 12, 14, and 16 of pregnancy. Animals were perfused through the left ventricle with 4% (w:v) paraformaldehyde (Sigma Chemical Company, St. Louis, MO) in PBS. Immediately after perfusion, the uterus was removed and each conceptus was separated. The amniotic fluid was removed with a syringe and replaced with 4% paraformaldehyde, and the tissue was placed in 4% paraformaldehyde at 4°C overnight. Fixed tissue was dehydrated through an ethanol gradient to 100% ethanol, cleared in toluene, embedded in paraffin, and stored at 4°C until sectioned.

RT-PCR

Frozen tissue or isolated decidual cells were ground with mortar and pestle in liquid nitrogen. Total cellular RNA was extracted, and mRNA was isolated using the Poly-A tract mRNA isolation kit (Promega, Madison, WI) following the manufacturer's instructions. First strand cDNA was synthesized with Superscript reverse transcriptase (Gibco BRL, Gaithersburg, MD). PCR primers (Open Technologies, Alameda, CA) that would anneal to the 5' (CAGTGATCAGTCATGGCATGCC) and 3' (ACGGTCCCATTTTATTTCAGAGCT) ends of the open reading frame of previously reported calcyclin cDNA [9] were added to 0.1 µg of cDNA, buffer, and dNTPs (10 pM) in a 50-µl reaction volume. The reaction was overlaid with 50 µl of mineral oil (Sigma) and heated for 1 min at 94°C, and 1 µl of Vent (exo-) Polymerase (New England Biolabs, Beverly, MA) was added to the reaction. The reaction was carried out for 25 cycles, with 45-sec denaturation at 94°C, 45 sec of annealing at 60°C, and 35 sec of extension at 72°C.

The PCR products were separated on a 3% Metaphor agarose gel (FMC BioProducts, Rockland, ME). One band was visible that corresponded to the expected 293-base pair (bp) product. This band was purified from the gel by the diethylaminoethyl (DEAE) membrane technique [10] and cloned into the pCR-Script SK+ vector (Stratagene, La Jolla, CA). Escherichia coli were transformed, insert positive clones were amplified, and plasmid DNA was extracted by miniprep [11]. Sequencing was performed by the dideoxy chain termination method using the T7 or T3 primer with the Sequenase sequencing kit (U.S. Biochemicals Corporation, Cleveland, OH) according to the manufacturer's instructions.

As positive PCR controls, liver cDNA was used as a template for the amplification of the growth hormone receptor (GHR), and cDNA synthesized from the placental cell culture was used as a template for mPL-II amplification. Successful amplification of products indicated that the negative results for the amplification of the calcyclin in these two tissues were valid. GHR PCR primers were used that would amplify a 233-bp fragment (5': CCTCAACTGGACTTTACT, 3': ATCTCACCCGCACTTCAT). Conditions were 35 cycles of 45-sec denaturation at 94°C, 45 sec of annealing at 50°C, and 45 sec of extension at 72°C. Mouse PL-II PCR primers were used that would amplify a 557-bp product (5': ATCGATTACCCACTGAAAGC, 3': TAGAAAGGCACCAAAGAAGG). Conditions were 25 cycles of 45-sec denaturation at 94°C, 45 sec of annealing at 54°C, and 35 sec of extension at 72°C. Buffer volumes and concentrations used were as described above.

Northern Blots

RNA used in the Northern blots was extracted as described above from whole placentas (trophoblast and decidua) obtained on Days 8, 10, 12, 14, 16, and 18 of pregnancy. RNA from all of the placentas of one animal (6–12 placentas) were pooled for each sample. Five different pools of placentas were analyzed for each day of pregnancy.

Northern blotting was performed as described by Brown and Mackey [12]. Approximately 10 µg of RNA in loading buffer (20 mM 3-[N-morpholino]propanesulfonic acid, 5 mM NaOAc, 0.1 mM EDTA) was loaded on a 1% agarose/formaldehyde gel, and the gels were run at 50 V for 5 h. The RNA was blotted to Magna nylon membrane (MSI, Westboro, MA) overnight and fixed to the membrane at 80°C for 1 h. The membrane was prehybridized in 5-strength SSC (single-strength SSC = 0.15 M NaCl, 0.15 M Na₃C₆H₅O₇, pH 7.0), 5-strength Denhardt's, 50% formamide, 1% SDS, 100 µg/ml salmon sperm DNA at 40°C for 4 h. [³²P]>ATP was used to generate ß-actin and calcyclin probe from cDNA by the random priming method [13]. Probe was added to prehybridization buffer, hybridized at 40°C overnight, and washed the next day in decreasing (1- to 0.2-strength) concentrations of SSC at 60°C. Membranes were probed first for calcyclin and were then stripped by boiling in 0.2% SDS and probed for ß-actin. Film was exposed overnight at -20°C within the linear range of exposure, and densitometry values were obtained by scanning with an IS-1000 Digital Imaging System (Alpha Innotech Corporation, San Leandro, CA). Calcyclin values were normalized to ß-actin values to account for differences in loading and transfer efficiency.

Histology

Tissue was embedded in paraffin blocks, sectioned at 6 µm, and mounted on TESPA (Sigma)-coated slides and dewaxed. Digoxygenin (DIG)-coupled UTP-labeled riboprobe was prepared from the cloned calcyclin RT-PCR product using the Genius kit (Boehringer-Mannheim Corporation, Indianapolis, IN). Plasmid was linearized with the restriction enzymes Not I (probe) or BamHI (antiprobe) and transcribed with T7 or T3 RNA polymerase (Promega), respectively. Tissue was cleared in xylene and rehydrated through ethanol concentrations to diethyl pyrocarbonate-treated water. Sections were washed in PBS and then postfixed in fresh 4% paraformaldehyde in PBS for 30 min. Sections were washed in PBS and dehydrated through an ethanol gradient to 100% ethanol and then air dried.

Tissue sections were incubated in prehybridization buffer (50% formamide, 3 mM NaCl, 10 mM Tris, 1 mM EDTA, 10% dextran sulfate, 1% blocking reagent, 150 µg/ml tRNA, 1 mg/ml total yeast RNA) at 45°C in a humid chamber for 6 h. Probe and antiprobe were heated to 80°C for 10 min, snap-cooled on ice, and then added to prehybridization buffer to a concentration of 2 µg/ml. Tissue sections were overlaid with probe or antiprobe in prehybridization buffer or with prehybridization buffer only, covered with baked coverslips, sealed with rubber cement, and incubated in a humid chamber at 45°C overnight. After hybridization, coverslips were removed and the sections were washed in double-strength SSPE (20-strength = 3 M NaCl, 200 mM NaH₂PO₄·H₂O, 25 mM Na₂-EDTA) for 5 min at room temperature. The sections were then washed twice in 0.2-strength SSPE at 50°C for 1 h each wash. After the second wash, the sections were allowed to cool to room temperature and washed in PBS for 5 min, blocking buffer (100 mM Tris, 150 mM NaCl, 2% blocking reagent) for 45 min, and BSA buffer (100 mM Tris, 150 mM NaCl, 1% BSA, 0.3% Triton X-100) for 45 min. Alkaline phosphatase-coupled antibody to DIG (Boehringer-Mannheim), diluted 1:500 in blocking buffer, was added to the sections, and they were incubated overnight in a humid chamber at room temperature. The sections were then washed 3 times in BSA buffer for 2 min each, 30 min in blocking buffer, and 10 min in buffer 3 (100 mM Tris, 100 mM NaCl, 50 mM MgCl₂, pH 9.5). The colorimetric reagents nitro-blue-tetrazolium chloride and X-phosphatase (Boehringer-Mannheim) in buffer 3 were added to the sections, and they were incubated in the dark until the desired color intensity was reached. The color reaction was stopped by incubating in buffer 4 (10 mM Tris, 1 mM EDTA, pH 8.0) for 10 min. Tissue was dehydrated through an ethanol gradient, cleared in xylene, and air dried. Sections were mounted in Permount (Sigma) and coverslipped. No staining was detected in slides incubated with antibody alone or in slides incubated with antiprobe at probe concentrations. At probe and antiprobe concentrations greater than 3000 ng/ml, nonspecific staining that was primarily nuclear became evident. Slides not postfixed with 4% paraformaldehyde also showed nonspecific staining due, most likely, to endogenous alkaline phosphatase activity. The specificity of the probe for the histology was demonstrated by hybridization of only a single calcyclin band in Northern blot analysis of decidual tissue.

Periodic acid-Schiff (PAS) staining of tissue sections for placental glycogen and the lytic protein granules of the uterine natural killer cells was performed using a staining kit (Sigma).

Calcyclin Purification

The calcyclin protein purification method was based on those of Filipek et al. [14] and Thordarson et al. [8]. Decidua from Day 12 of pregnancy was dissected free of the conceptus, collected on dry ice, and stored at -80°C until extracted. Tissue was diluted in 4 volumes of ice-cold extraction buffer (20 mM Tris, 80 mM NaCl, 2 mM EDTA, 2 mM EGTA, 1 mM PMSF, pH 8.0), homogenized with a Polytron (Brinkman Instruments, Westbury, NY) homogenizer on ice, and centrifuged at 50 000 x g for 1 h. The supernatant was collected and CaCl₂ was added to a calcium concentration of 2 mM. The supernatant was then loaded onto a Phenyl-Sepharose CL-4B (Pharmacia, Uppsala, Sweden) hydrophobic interaction column (2.5 x 30 cm) equilibrated with buffer (20 mM Tris, 80 mM NaCl, 2 mM CaCl, pH 8.0) at room temperature. The bulk of protein did not interact with the column and eluted within 10 h of loading. When the absorbance at 280 nm of the eluate returned to baseline, the column was washed with extraction buffer containing 4 mM EGTA. Calcyclin has been shown to require calcium to expose a hydrophobic domain [15, 16]. Chelation of calcium by EGTA interfered with the hydrophobic interaction and caused calcyclin to elute from the column. Fractions containing calcyclin were determined by RIA [8] and pooled. Buffer exchange for calcyclin fractions to 25 mM Tris, pH 8.0, was achieved by diafiltration on an Amicon (Millipore, Beverly, MA) YM-10 membrane. The concentrated fraction was loaded onto a Tris-equilibrated TSK-DEAE Toyopearl 650M (TosoHaas, Montgomery, PA) ion-exchange column (1.5 x 14 cm) at 4°C. Calcyclin was eluted with a linear gradient of 40–100 mM NaCl in 25 mM Tris, pH 8.0. The immunoreactive fractions were pooled and concentrated and buffer was exchanged to 50 mM NH₄HCO₃, pH 8.3, as above. Calcyclin was then loaded onto an equilibrated G50 Sephadex (Pharmacia and Upjohn, Kalamazoo, MI) sizing column (2.5 x 95 cm) at 4°C. Calcyclin eluted at an approximate Ve/Vo of 2. The yield from the extraction was 3.5 mg from 40 g of decidua.

Cell Culture and RIA

Trophoblast cells from Day 9 of pregnancy were isolated and cultured as described previously [8]. Briefly, trophoblast was dissected from decidua, dissociated in collagenase and DNase, and separated on a 40% Percoll gradient. Cells were plated at a density of 1.25 x 10⁵ cells/cm² in 96-well Primaria-coated plates (Sigma). Cells were then incubated for 24 h at 37°C, 5% CO² in medium NCTC-109 (Sigma) + 10% (v:v) fetal bovine serum and 2 days in NCTC-109 without fetal bovine serum, with a medium change every 24 h. On the third day of culture, cells were treated with vehicle or calcyclin and incubated for 1 h; the medium was collected and frozen at -80°C until assayed by RIA. RIAs for mPL-I [17] and mPL-II [18] were performed as previously reported. The experiments were each repeated 4 times using independent preparations of cells.

Statistical Analysis

Data are presented as means ± SEM. Northern blot analysis data and placental lactogen RIA data were examined by one-way ANOVA. Subsequent analysis was performed with Scheffe's F test. In all statistical tests a p value of less than 0.05 was considered significant.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
RT-PCR

Twelve clones containing PCR products from isolated decidual cell mRNAs were sequenced. Slight variation in sequence was detected (no more than 1 bp per clone in nonidentical sites), and the consensus sequence is shown in Figure 1. The sequence matches the previously reported sequence for murine calcyclin [9]. The predicted amino acid sequence also matches identically the amino acid sequence of the previously isolated decidual factor [8]. Figure 2 shows calcyclin PCR products from placenta and decidua.

View larger version (31K): [in this window] [in a new window]   FIG. 1. The RT-PCR sequence data are shown. Nucleotides corresponding to the PCR primers are underlined. The corresponding single-letter amino acids are shown. Those amino acids that match the previous protein sequence data for calcyclin are shown in bold.

View larger version (64K): [in this window] [in a new window]   FIG. 2. RT-PCR products were amplified and then separated on an agarose gel. Unless otherwise stated, primers used were for calcyclin. A) lambda marker, B) decidual cDNA, C) whole placental cDNA, D) cultured trophoblast cell cDNA (see text), E) cultured trophoblast cell cDNA (see text) with mPL-II primers, F) pregnant mouse liver cDNA, G) pregnant liver cDNA using GHR primers, H) H2O, I) H2O with mPL-II primers, J) H2O with GHR primers.

PCR products could not be amplified from the liver of pregnant mice or from isolated trophoblast cells in culture. Calcyclin message is not normally found in liver but has been found in rats during induced cirrhosis bilaris [19]. Although whole Day 9 trophoblast does contain detectable amounts of calcyclin by RT-PCR, the cell culture did not. This indicates that the purification and subsequent culture protocol selected against those trophoblast cells that contain calcyclin. The cDNAs from each pool were shown to be intact, as GHR could be amplified from liver cDNA and mPL-II could be amplified from cultured trophoblast cells.

Northern Blot Analysis

Total cellular RNA from placenta was probed for calcyclin message by Northern analysis. Only one band was detected on each day of pregnancy, even when blots were washed under low stringency conditions. There was a downward trend in steady-state levels of calcyclin mRNA from Day 8 through Day 14 (Fig. 3). Message levels rose slightly on Day 16 to high levels on Day 18 of pregnancy.

View larger version (59K): [in this window] [in a new window]   FIG. 3. Calcyclin mRNA in the placenta. A) Representative Northern blot. B) Points represent the mean and standard error of 5 separate experiments of calcyclin densitometry values normalized to ß actin values. Superscripts (a, b) represent values that are significantly different (p < 0.05).

Histology

Calcyclin mRNA was localized to uterine natural killer (uNK) cells of the decidua on each day of pregnancy examined. Uterine NK cells are identified by a unique phenotype and the presence of cytoplasmic granules containing lytic proteins that are stained in the PAS protocol [20]. Serial sections were either probed for calcyclin mRNA or stained with PAS to confirm the cell identity.

Calcyclin mRNA was also present in small pockets of what appear to be trophoblast glycogen cells of the placental labyrinth on Day 12 of pregnancy. On Days 14–16 of pregnancy, calcyclin-positive glycogen cells were present in the junctional zone (Fig. 4). These cells are characterized by glycogen storage and insulin-like growth factor-II immunoreactivity during the second half of pregnancy [21]. No calcyclin message could be detected in mPL-II-secreting trophoblast giant cells or in any other trophoblast cell type.

View larger version (143K): [in this window] [in a new window]   FIG. 4. Photomicrographs of placental section from Day 14 of gestation. Black arrowhead (A) at the metrial gland (mg) corresponds to same position in serial sections. Higher magnification showing digoxygenin (Dig) staining (B) and PAS staining (C) for uNK cells (white arrows). Trophoblast (t), decidua (d); A, C) PAS; B) DIG. A) Bar = 250 µm; B) bar (in C) = 20 µm; C) bar = 30 µm.

Cell Culture

Treatment of cultured trophoblast cells isolated on Day 11 of pregnancy with calcyclin resulted in a dose-dependent increase in the release of mPL-II within 60 min [8]. In the present study, trophoblast cells were isolated from Day 9 of pregnancy, a point at which this cell population is producing both mPL-I and mPL-II [4]. Treatment of these cells with calcyclin also resulted in a dose-dependent increase in mPL-II release (1.5–2 times maximal) within the first 60 min of culture (Fig. 5A). There was no significant effect on the release of mPL-I (Fig. 5B) from the same population of cells that released mPL-II. Previous studies have shown that both mPL-I and mPL-II levels can be manipulated in this culture system [22]. These data indicate that calcyclin is a specific secretogogue for mPL-II.

View larger version (46K): [in this window] [in a new window]   FIG. 5. Calcyclin stimulation of secretion of mPL-II (A) or mPL-I (B) from cultured trophoblast cells isolated on Day 9 of gestation. The mPL-I and mPL-II concentrations were determined by RIA. Each bar represents the mean (+SEM) of four replicate wells, (*) significantly different (p < 0.05) from control values. One representative experiment is shown. The experiments were repeated 4 times with similar results.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
In a previous study, a protein factor released by decidual cells stimulated the release of mPL-II from cultured trophoblast cells [8]. In the present study, the amino acid sequence previously obtained was used to design primers that would amplify the decidual factor. Only one sequence was obtained from cDNAs of multiple RT-PCRs of several different decidual cell preparations. Furthermore, Northern blot analysis indicated that only one transcript was present in decidual tissue and that there were not multiple species of calcyclin or calcyclin-like molecules. These results demonstrate that the factor responsible for mPL-II release in vitro is in fact calcyclin.

Calcyclin is a member of the S-100 calcium-binding protein family [23]. It is a small homodimeric protein that changes conformation upon calcium binding [15, 24]. This was also seen in the previous study [8] by a change in migration of the protein on SDS-PAGE gels after treatment with EGTA. A specific function for calcyclin has not previously been demonstrated although it has been implicated in cell cycle progression, cell differentiation, cytoskeletal interactions, cancerous states, signal transduction [25], exocytosis [26], and the paracrine regulation of trophoblast by decidua ([8], present study).

Uterine NK cells were the primary site of the calcyclin message detected by in situ hybridization in the mesometrial decidua. Calcyclin message is expressed in uNK cells throughout pregnancy. The downward trend determined by Northern blot analysis followed the ontogeny of the uNKs, through mid to late gestation. In a previous study, Waterhouse and colleagues found calcyclin message expressed in the antimesometrial decidua during the first few days after implantation but did not identify the cell type [27]. This is the first report describing the presence of calcyclin message in cells of the NK lineage, though it has previously been found in other bone marrow-derived cells [28, 29].

Uterine NK cells have been implicated in trophoblast function previously. They are bone marrow-derived lymphocytes that migrate into the nonpregnant uterine endometrial stroma, and are found randomly distributed [30]. By the fifth to sixth day of pregnancy, uNK cells appear in increasing numbers in the developing decidua basalis, opposite sites of implantation in an area known as the mesometrial triangle or metrial gland [20, 31]. By midpregnancy uNK cells have disappeared between implantation sites, have increased in number and size, and contain large PAS-positive cytoplasmic granules, and it is at this point that calcyclin message can easily be detected. As the trophoblast invades the decidua and differentiates into the mature chorioallantoic placenta, the uNK cells decrease in number. Those that remain align along the basal aspect of the placenta and are shed during parturition [32]. The uNK cells seem to be important in viviparity and have homologues in many other species [30].

In the mouse, uNK cells have been shown to produce the cytokines interleukin-1 (IL-1), colony-stimulating factor-1 (CSF-1), and leukemia inhibitory factor (LIF) [20], all important in the maintenance of pregnancy. IL-1 is important in reproduction [33] and has been implicated in the control of mPL-II secretion [22]. CSF-1 and LIF are essential in blastocyst growth and development [34] and implantation [35], respectively, supporting the proposal that uNK cells are involved in trophoblast function. Guimond and colleagues [36, 37] studied the importance of the uNK cell in normal mouse reproduction through the use of a transgenic mouse line (TgE26) that is deficient in both T cells and NK cells. Few or no uNK cells could be found in these mice, resulting in limited trophoblast development and very few surviving pups. These studies elegantly underscore the importance of this cell type in normal mouse reproduction.

In a previous study, isolated trophoblast cells from Day 11 pregnant mice were cultured, and a dose-dependent release of mPL-II in response to addition of calcyclin to the medium was demonstrated. In the present study, we have isolated cells from an earlier day of pregnancy (Day 9) and shown that these cells are also competent to respond to calcyclin. In response to calcyclin, trophoblast cells increase the amount of mPL-II released into the medium almost two-fold (at 450 pM calcyclin). The release of mPL-I, however, was not affected. This is an interesting result, as in other experiments on this day of pregnancy, factors usually had reciprocal effects on the secretion of the two placental lactogens [5, 22]. Both in vitro and in vivo trophoblast giant cells produce first mPL-I only, then both mPL-I and mPL-II, and finally mPL-II only as they progress through the steps of terminal differentiation [4, 38]. The results of this study indicate that calcyclin is a specific secretogogue of mPL-II. It is difficult to determine whether this result reflects a specific stimulation of the mPL-II secretory pathway or differential effects on subsets of cells at different stages of differentiation.

Due to the lack of a signal sequence and binding to intracellular targets, S-100 proteins are generally thought to have intracellular functions [23]. The report of secreted calcyclin's having extracellular functions is novel but not unique within the family. S-100ß is the family member most homologous to calcyclin and is secreted as a disulfide-bonded homodimer [39] by folliculo-stellate cells of the anterior pituitary [40]. In culture these cells release S-100ß that can stimulate the release of prolactin from both a prolactin-secreting cell line [41] and dispersed anterior pituitary cells [42]. This stimulation may well reflect an in vivo paracrine relationship, as folliculo-stellate cells are in close proximity to lactotropes [42]. Of interest here is the parallel in the paracrine relationships between members of the same gene families: calcyclin and S-100ß with placental lactogen-II and prolactin [43].

The mechanisms through which calcyclin, and also S-100ß, act have not been identified. In the brain, an S100ß-specific binding site on the membranes of cultured neurons has been identified and implicated in the stimulation of a biological response [23]. Such a binding site for calcyclin has not yet been identified. These data warrant further studies to elucidate the mechanism through which calcyclin exerts its effects on the trophoblast.

In conclusion, we have demonstrated the presence of calcyclin mRNA in the placenta and decidua. The sites of production of the message have been confirmed and a gestational profile of message has been completed. Furthermore, isolated trophoblast cells in culture do not contain detectable quantities of calcyclin. In response to the treatment with calcyclin, isolated trophoblast cells release mPL-II but not mPL-I.

	ACKNOWLEDGMENTS

 
The authors would like to thank Dr. A.C. Enders, Dr. M.J. Soares, and Dr. J.S. Hunt for their assistance with the interpretation of the in situ data; Dr. B.A. Croy for assistance with the protocol for PAS staining; Dr. David Denhardt for use of a calcyclin-containing plasmid used in initial experiments; the Dr. C. Daniel lab (UCSC) and Dr. L. Ogren for help with preparation of this manuscript.

	FOOTNOTES

 
¹ This work was supported by NIH grants HD 14966 and GM 08132 (F.T.). R.L.F. is a Boehmer Scholarship recipient.

² Correspondence. FAX: (408) 459–3560; prolactin{at}aol.com

³ Current address: Department of Cell Biology, Baylor College of Medicine, Houston, TX 77030.

Accepted: April 14, 1998.

Received: January 28, 1998.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Cross J, Werb Z, Fisher S. Implantation and the placenta: key pieces of the development puzzle. Science 1994; 266:1508–1518.[Abstract/Free Full Text]
2. Ogren L, Talamantes F. The placenta as an endocrine organ: polypeptides. In: Knobil E, Neill J (eds.), The Physiology of Reproduction, Second Edition. New York: Lippincot Ltd; 1994: 1500–1521.
3. Soares M, Talamantes F. Genetic and litter size effects on serum placental lactogen in the mouse. Biol Reprod 1983; 29:165–171.[Abstract]
4. Yamaguchi M, Ogren L, Endo H, Thorarson G, Bigsby R, Talamantes F. Production of mouse placental lactogen-I and placental lactogen-II by the same giant cell. Endocrinology 1992; 131:1595–1601.[Abstract]
5. Yamaguchi M, Ogren L, Endo H, Thordarson G, Kinsinger R, Talamantes F. Epidermal growth factor stimulates placental lactogen I but inhibits mouse placental lactogen II secretion in vitro. Proc Natl Acad Sci USA 1992; 89:11396–11400.[Abstract/Free Full Text]
6. Yamaguchi M, Sawada K, Miyake A. Lipopolysaccharides selectively inhibit mouse placental lactogen-II secretion through stimulation of interleukin-1 alpha (IL-1 alpha) and IL-6 production. J Endocrinol Invest 1996; 19:415–421.[Medline]
7. Soares M, Faria T, Roby K, Deb S. Pregnancy and the prolactin family of hormones: coordination of anterior pituitary, uterine and placental expression. Endocr Rev 1991; 12:402–423.[Medline]
8. Thordarson G, Southard J, Talamantes F. Purification and characterization of mouse decidual calcyclin: a novel stimulator of mouse placental lactogen-II secretion. Endocrinology 1991; 129:1257–1265.[Abstract]
9. Timmons P, Chan C, Rigby P, Poirier F. The gene encoding the calcium binding protein calcyclin is expressed at sites of exocytosis in the mouse. J Cell Sci 1993; 104:187–196.[Abstract]
10. Dretzen G, Bellard M, Sassone-Corsi P, Chambon P. A reliable method for the recovery of DNA fragments from agarose and acrylamide gels. Anal Biochem 1981; 112:295–301.[CrossRef][Medline]
11. Engebrecht J, Brent R, Kaderbhai M. Minipreps of Plasmid DNA. In: Ausubel F, Brent R, Kingstone R, Moore D, Seidmen J, Smith J, Struhl K (eds.), Current Protocols in Molecular Biology. Boston, MA: John Wiley and Sons Inc.; 1997: 1.6.10–1.6–12.
12. Brown T, Mackey K. Analysis of RNA by Northern and slot blot hybridization. In: Ausubel F, Brent R, Kingstone R, Moore D, Seidmen J, Smith J, Struhl K (eds.), Current Protocols in Molecular Biology. Boston, MA: John Wiley and Sons Inc.; 1997: 4.9.1–4.9.10.
13. Tabor S, Struhl K, Scharf S, Gelfand D. Labeling of DNA by random oligonucleotide-primed synthesis. In: Ausubel F, Brent R, Kingstone R, Moore D, Seidmen J, Smith J, Struhl K (eds.), Current Protocols in Molecular Biology. Boston, MA: John Wiley and Sons Inc.; 1997: 3.5.9–3.5.10.
14. Filipek A, Zasada A, Wojda U, Dabrowska R. Characterization of chicken gizzard calcyclin and examination of its interaction with caldesmon. Comp Biochem Physiol 1996; 113B:745–752.
15. Potts B, Carlson G, Okazaki K, Hidaka H, Chazin W. 1H NMR assignments of apo calcyclin and comparative structural analysis with calbindin D9k and s100ß. Protein Sci 1996; 5:2162–2174.[Abstract]
16. Filipek A, Heizmann C, Kuznicki J. Calcyclin as a calcium and zinc binding protein. FEBS Lett 1990; 264:263–266.[CrossRef][Medline]
17. Ogren L, Southard J, Colosi P, Linzer D, Talamantes F. Mouse placental lactogen-I: RIA and gestational profile in maternal serum. Endocrinology 1989; 125:2253–2257.[Abstract]
18. Soares M, Colosi P, Talamantes F. The development and characterization of a homologous radioimmunoassay for mouse placental lactogen. Endocrinology 1982; 110:668–670.[Abstract]
19. Kordowska J, Apel A, Brand I, Kuznicki J. Distribution and level of calcyclin in normal rat tissues in experimentally induced liver cirrhosis biliaris. Acta Histochem Cytochem 1994; 27:205–218.
20. Whitelaw P, Croy B. Granulated lymphocytes of pregnancy. Placenta 1996; 17:533–543.[CrossRef][Medline]
21. Redline R, Chernicky C, Tan H, Ilan I. Differential expression of insulin-like growth factor-II in specific regions of the late (post day 9.5) murine placenta. Mol Reprod Dev 1993; 36:121–129.[CrossRef][Medline]
22. Yamaguchi M, Taga T, Kishimoto T, Miyake A. Cytokines that use gp130 as a signal transducer stimulate mouse placental lactogen-I but inhibit mPL-II production in vitro. Biol Reprod 1995; 53:399–406.[Abstract]
23. Donato R. Perspectives in S-100 protein biology. Cell Calcium 1991; 12:713–726.[CrossRef][Medline]
24. Kuznicki J, Filipek A. Purification and properties of a novel Ca2+-binding protein (10.5 kd) from Ehrlich-ascites-tumor cells. Biochem J 1987; 247:663–667.[Medline]
25. Murphy L, Murphy L, Tsuyuki D, Duckworth M, Shiu R. Cloning and characterization of a cDNA encoding a highly conserved, putative calcium binding protein, identified by an anti-prolactin receptor antiserum. J Biol Chem 1988; 263:2397–2401.[Abstract/Free Full Text]
26. Okazaki K, Niki I, Iino S, Kobayashi S, Hidaka H. A role of calcyclin, a Ca2+-binding protein on the Ca2+-dependent insulin release from the pancreatic ß cell. J Biol Chem 1994; 269:6149–6152.[Abstract/Free Full Text]
27. Waterhouse P, Parhar R, Guo X, Lala P, Denhardt D. Regulated temporal and spatial expression of the calcium-binding proteins calcyclin and OPN (osteopontin) in mouse tissues during pregnancy. Mol Reprod Dev 1992; 32:4–13.
28. Faria T, Ogren L, Talamantes F, Linzer D, Soares M. Localization of placental lactogen-I in trophoblast giant cells of the mouse placenta. Biol Reprod 1991; 44:327–331.[Abstract]
29. Tomida Y, Terasawa M, Kobayashi R, Hidaka H. Calcyclin and calvasculin exist in human platelets. Biochem Biophys Res Commun 1992; 189:1310–1316.[CrossRef][Medline]
30. Bulmer D, Peel S, Stewart I. The metrial gland. Cell Differ 1987; 20:77–86.[Medline]
31. Peel S. Granulated metrial gland cells. Adv Anat Embryol Cell Biol 1989; 115:1–112.[Medline]
32. Croy B, Luross J, Guimond M, Hunt J. Uterine natural killer cells: insights into lineage relationships and functions from studies of pregnancies in mutant and transgenic mice. Nat Immun 1996; 15:22–33.[Medline]
33. Labow M, Shuster D, Zetterstrom M, Nunes P, Terry R, Cullinan EB, Bartfai T, Solorzano C, Moldawer LL, Chizzonite R, McIntyre KW. Absence of IL-1 signaling and reduced inflammatory response in IL-1 type receptor-deficient mice. J Immunol 1997; 159:2452–2461.[Abstract/Free Full Text]
34. Pollard J. Role of colony-stimulating factor-1 in reproduction and development. Mol Reprod Dev 1997; 46:54–60.[CrossRef][Medline]
35. Stewart C, Cullinan S. Preimplantation development of the mammalian embryo and its regulation by growth factors. Dev Genet 1997; 21:91–101.[CrossRef][Medline]
36. Guimond M, Wang B, Fujita J, Terhorst CA, Croy B. Pregnancy-associated uterine granulated metrial gland cells in mutant and transgenic mice. Am J Reprod Immunol 1996; 35:501–509.
37. Guimond M, Luross J, Wang B, Terhorst C, Danial S, Croy B. Absence of natural killer cells during murine pregnancy is associated with reproductive compromise in TgE26 Mice. Biol Reprod 1997; 56:169–179.[Abstract]
38. Carney EW, Prideaux V, Lye S, Rossant J. Progressive expression of trophoblast specific genes during formation of mouse trophoblast giant cells in vitro. Mol Reprod Dev 1993; 34:357–368.[CrossRef][Medline]
39. Okazaki K, Obata N, Inoue S, Hidaka H. S100ß is a target protein of neurocalcin sigma, an abundant isoform in glial cells. Biochem J 1995; 306:551–556.
40. Soji T, Sirasawa N, Kurono C, Yashiro T, Herbert D. Immunohistochemical study of the post-natal development of the folliculo-stellate cells in the rat anterior pituitary gland. Tissue Cell 1994; 26:1–8.[CrossRef][Medline]
41. Ishikawa H, Nogami H, Shirasawa N. Novel clonal strains from adult rat anterior pituitary producing S-100 protein. Nature 1983; 303:711–713.[CrossRef][Medline]
42. Lloyd R, Mailloux J. Analysis of S-100 protein positive folliculo-stellate cells in rat pituitary tissues. Am J Pathol 1988; 133:338–346.[Abstract]
43. Jackson-Grusby L, Pravtcheva D, Ruddle F, Linzer D. Chromosomal mapping of the prolactin/growth hormone gene family in the mouse. Endocrinology 1988; 122:2462–2466.[Abstract]