Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Douglas, D.A.
Right arrow Articles by Murphy, B.D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Douglas, D.A.
Right arrow Articles by Murphy, B.D.
Agricola
Right arrow Articles by Douglas, D.A.
Right arrow Articles by Murphy, B.D.
Biology of Reproduction 59, 571-578 (1998)
©Copyright 1998 Society for the Study of Reproduction, Inc.

Luteotropic Hormone Receptors in the Ovary of the Mink (Mustela vison) during Delayed Implantation and Early-Postimplantation Gestation

D.A. Douglasa,c, A. Houdec, J.H. Songc, R. Farookhib, P.W. Concannon and d, , and B.D. Murphyc

a Departments of Animal Science b and Physiology and Obstetrics and Gynecology, McGill University, Montreal, Quebec, Canada H3A 1A1 c Centre de recherche en reproduction animale, Faculte de médecine vétérinaire, Universitè de Montréal, St-Hyacinthe, Québec, Canada J2S 7C6 d Department of Physiology, Cornell University, Ithaca, New York 14853


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The reproductive cycle of the mink displays rigid seasonality and obligate embryonic diapause. After ovulation, the corpus luteum (CL) involutes, and it secretes basal progesterone until activated prior to implantation. To study changes in the relative abundance of luteal prolactin and LH receptor mRNA through gestation, ovaries and serum were collected from pregnant female mink at 2-day intervals (n = 3 per date) through embryonic diapause and CL activation (March 19–31) and at 5-day intervals through implantation and early-postimplantation gestation (March 31–April 15). To determine the effect of endogenous prolactin, mink received Alzet osmotic minipumps releasing 2 mg/day 2-bromo-{alpha}-ergocryptine (bromocriptine) or saline on March 19. Ovaries and serum were taken from 3 animals every 2 days until March 31. Prolactin receptor mRNA in ovaries was low during CL activation but increased 3-fold through embryo implantation. Its abundance correlated with prolactin binding to ovarian membranes and with circulating prolactin. Bromocriptine suppressed endogenous prolactin levels and prevented the increase in prolactin receptor mRNA. There was a transient peak in LH receptor mRNA in the ovaries at March 19–23, which declined to basal levels by March 25 and remained constant through midgestation. Bromocriptine prevented the preimplantation peak in LH receptor mRNA and reduced its abundance below pretreatment levels. The results suggest that prolactin up-regulates its receptor and maintains the LH receptor in the mink CL. The pattern of LH receptor mRNA argues for a role for LH in CL reactivation and termination of embryonic diapause in mink.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The mink has a brief and well-defined reproductive season in the Northern Hemisphere, during which mating takes place in March. Gestation is characterized by a variable period of obligate embryonic diapause that terminates with implantation, usually between March 31 and April 6 [13]. In the early part of this delay phase, the mink corpus luteum (CL) involutes and synthesizes low levels of progesterone [4, 5]. In late March, increasing photoperiod [6] activates the mink CL, and progesterone output is increased several-fold to a peak some 2 wk prior to parturition [7, 8]. Progesterone levels then decline slowly through the end of gestation [4].

The mink requires an intact hypophysis for luteal activation and implantation [9] as well as for luteal maintenance after implantation [10]. Pituitary prolactin is the principal luteotropic hormone in the mink and is essential for the reactivation of the CL, termination of embryonic diapause, and normal CL function after implantation [1113]. The role of LH in mink luteal function has not been clearly defined. Investigations in vivo suggest that LH may not be essential, as prolactin alone will activate the CL and terminate embryonic diapause in hypophysectomized mink [13]. Nevertheless, passive immunization against GnRH interferes with postimplantation luteal function, suggesting that LH may play a role in the maintenance of the CL [14]. Further evidence for a role of LH is derived from in vitro studies of mink luteal cells, which indicate that LH and its second messenger, cAMP, increase steroidogenesis and steroidogenic enzyme gene expression both in involuted luteal cells of diapause and in those derived from postimplantation gestation [15].

Prolactin and LH bind to hormone-specific cell surface receptors and activate second messenger systems in mammalian tissues. The prolactin receptor is a member of the GH/prolactin/cytokine receptor family [16]. Multiple forms of the receptor have been identified that differ in the length of their cytoplasmic domain [17, 18]. The LH receptor is a member of the G protein-coupled hormone receptor family. The deduced amino acid sequence indicates a single polypeptide chain, and hydropathy plots indicate a large extracellular domain, a transmembrane domain that weaves through the cell membrane seven times, and a short cytoplasmic domain [19]. Given the uniqueness of the mink CL, its period of involution, its dependency on prolactin, and the absence of solid information about the role of LH in this species, it was of interest to investigate expression of prolactin and LH receptors. A second goal was to determine whether reduction in endogenous prolactin could affect the abundance of mRNA for either receptor.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Experimental Design and Tissue Collection

Adult female mink of the Standard Dark variety were purchased from and maintained on a commercial mink ranch (Morrow Fourrures, St Paul d'Abbotsford, PQ, Canada). All procedures followed the regulations of the Canadian Council of Animal Care, and the protocol was approved by the Comité de déontologie, Faculté de médecine vétérinaire, Université de Montréal. Animals were subject to commercial husbandry, including provision of water ad libitum and of a daily ration compatible with successful reproduction. Female mink were mated twice, at 7- to 9-day intervals, according to standard husbandry practice. Successful matings were confirmed by the presence of motile sperm in vaginal smears.

Sampling of ovaries was carried out in a group of untreated pregnant animals (n = 30) and in animals randomly assigned to two treatment groups (n = 21 each). The first group was implanted during the period of embryonic diapause (March 19) with Alzet osmotic minipumps (Alza Corp., Palo Alto, CA) that released 2 mg/day 2-bromo-{alpha}-ergocryptine (bromocriptine; Sigma Chemical Co., St. Louis, MO) for 13 days. The second group (control) received pumps that contained saline on March 19. A terminal blood sample was taken by cardiac puncture under ketamine-promazine (Rogar STB, Montreal, PQ, Canada) anesthesia, and animals were killed with a single injection of T-61 euthanasia solution (Hoechst Canada, Regina, SK, Canada). The ovaries were collected from 3 untreated pregnant animals every 2 days between March 19 and 31 and every 5 days thereafter until April 15, and also from 3 each of the bromocriptine- and saline-treated mink on alternate days from March 19 to 31. No differences were observed between untreated and saline-treated animals, so these groups were combined for statistical analysis and presentation. In animals treated with bromocriptine, the CL were reduced to a size that rendered their dissection impossible. Analysis of whole ovaries was therefore effected in all animals. One ovary from each animal was placed in 4 M guanidine isothiocyanate (Sigma) buffer containing 0.12 M of 2ß-mercaptoethanol for total RNA isolation, while the other was snap frozen and stored at -70°C for receptor binding assay.

In the subsequent year, large follicles (0.8–1.0 mm) and CL were dissected from the stroma of the ovaries of untreated pregnant mink at three phases of gestation: diapause (March 21; 10 animals; follicles and CL), luteal activation (March 25; 10 animals; CL only, no large follicles present), and postimplantation (April 10; 10 animals, CL only).

RNA Isolation

The purification of total RNA by CsCl (Gibco/BRL, Burlington, ON, Canada) gradient ultracentrifugation followed the procedure previously described [15]. After the final washing, the pellet was dissolved in diethyl pyrocarbonate (Sigma)-treated distilled water and stored at -70°C. Nucleic acid concentrations were determined by spectrophotometry at 260 nM.

Cloning, Sequencing, and Northern Analysis

Oligonucleotide primers for reverse transcription (RT) and polymerase chain reaction (PCR) amplification were generated on a GeneAssembler (Pharmacia, Baie D'Urfé, PQ, Canada). Primers for the mink prolactin receptor gene were based on conserved regions of the rat [18], mouse [17], rabbit [20], and bovine [21] prolactin receptor genes (sense primer Prlr-A: AGGAAACATTCACCTGCTGGTG; antisense primer Prlr-1: TGCATCCTCCCACCAGTTCC). Primers for the mink LH receptor gene were based on conserved regions of the rat [22], porcine [23], and human [24] LH receptor genes. The sense primers were LHr-A: GAATTCTTCCTTAGGGTCTTGATTTGG and LHr-B: GGAGAATTCATTTGCCTCCCCATGGATGTGGAA; the antisense primers were LHr-1: GGTGTCTAGATGCAGAAGCTTGCAAAGGAGAGATT and dT: GACTCGAGTCGACATCGA. The LH receptor was amplified in two separate reactions that resulted in overlapping fragments, one that employed primers A and 1, the other with primers B and dT. The latter fragment, composed of 600 nucleotides (nt), was employed as the probe in subsequent Northern hybridizations.

Total ovarian and testicular RNA (5 µg) were reverse transcribed by combination with 1 µl of 25 mM antisense primer, 2 µl 10-strength RT buffer (0.5 M Tris, 0.7 M KCl, 0.1 MgCl2, 0.04 dithiothreitol), 0.5 µl RNAsin (Pharmacia), 1 µl nucleotide mixture (25 µM each of dATP, dCTP, dGTP, dTTP), and 0.5 µl murine Moloney leukemia virus reverse transcriptase (Pharmacia) and incubation for 30 min at 42°C, 30 min at 45°C, and 30 min at 47°C. PCR reactions contained 10 µl 10-strength PCR buffer (0.5 M Tris, pH 9, 15 mM MgCl2, 0.2 M NH2SO4), 25 pmol of each of the sense and antisense primers, 1 µl of 20 µM of each nucleotide (dNTP; Pharmacia), 0.5 µl of cDNA pool, and 1 µl (5 units) Taq polymerase (Pharmacia). PCR reactions were performed in a thermocycler for 40 cycles.

PCR products were size fractionated by electrophoresis on 1% agarose gels. Amplified cDNA bands of the predicted sizes were excised, purified using a Sephaglas Bandprep kit (Pharmacia), and ligated into the pGEM-T (Promega, Nepean, ON, Canada) plasmid vector using T4 DNA ligase (Promega). The ligation products were used to transform the J105 strain of Escherichia coli by the RbCl method [25]. Plasmids containing the proper inserts were sequenced by the double-stranded dideoxy chain termination method [25] using T7 polymerase (T7 Sequencing kit: Pharmacia). To guard against misincorporation of nucleotides by Taq polymerase during PCR amplification, three independent clones were sequenced for each gene fragment and the consensus sequence was taken.

Northern blot analysis was performed on samples of 15 µg total RNA as previously described [15]. The homologous mink prolactin and LH receptor probes were labeled by random primer extension (Boehringer-Mannheim, Indianapolis, IN) with [32P]dCTP (DuPont, Mississauga, ON, Canada) to a specific activity of between 1.5 and 3.0 x 106 dpm/µg. Membranes were hybridized overnight at 65°C followed by two washes at the same temperature. All membranes were rehybridized with a ribosomal 28S probe [26].

Autoradiographic images were scanned and analyzed using Collage (FotoDyne, New Berlin, WI) software. The predominant 2.4-kilobase (kb) band of the LH receptor was scanned. There was no indication of differential expression of the three major prolactin receptor transcripts. Therefore the sum of the density of the three bands was determined. The ratio between the cDNA of interest and ribosomal 28S was calculated, and these arbitrary units were expressed as a percentage of a pooled ovarian control that was included on all Northern blots.

Prolactin Binding Assay

The determination of prolactin binding followed a protocol previously employed [27]. Ovine prolactin (NIDDK-oPRL-I-2; Rockville, MD) was radiolabeled with 125I (Amersham, Oakville, ON, Canada) by the lactoperoxidase method [28] to a specific activity of approximately 20 µCi/µg. The active fraction (proportion of the labeled ligand that bound to receptors) was 25%, assessed using a preparation of rat liver membranes. Ovarian samples were homogenized in 250 µl of PBS and centrifuged at 3000 rpm at 4°C for 20 min. The pellet was resuspended in 500 µl of ice-cold PBS. All binding determinations were performed in polypropylene tubes (Simport, Beloeil, PQ, Canada) coated with 10% BSA (Sigma). The assay was carried out in duplicate, and each sample had a nonspecific binding tube containing 1 µg unlabeled ovine prolactin. Sample (150 µl), assay buffer, and labeled prolactin (10 µl, 1.0 x 105 cpm) were incubated overnight at room temperature. The samples were pelleted and washed twice with PBS plus BSA and counted on a gamma spectrometer. Protein concentrations [29] were used to standardize the results.

Hormone Assays

Mink serum progesterone concentrations were determined by liquid-phase RIA after extraction in 10 volumes of hexane (BDH; Darmstadt, Germany). Extraction recoveries ranged between 95% and 98%. Antiserum, provided by Dr. A.K. Goff (University of Montreal, St-Hyacinthe, QC, Canada) [30], had been previously validated for mink serum [15]. Progesterone-11{alpha}-glucuronide-[125I]iodotyramine (Amersham) was used as radioactive trace, and goat anti-rabbit IgG (Prince Laboratories, Toronto, ON, Canada) was used as the precipitating second antibody. The sensitivity of the assay was 10 pg/ml. All samples were evaluated in a single assay in which the intraassay coefficient of variation, determined between duplicates, was less than 10%. Mink serum prolactin concentrations were determined in a double-antibody RIA employing canine antiserum against prolactin, previously validated for the mink [31]. The sensitivity of the assay was 30 pg/ml, and the intraassay coefficient of variation, calculated between duplicates, averaged 9.5%.

Statistical Analysis

Mean ± SEM values were calculated for each of the parameters measured. Two-way ANOVA was used to determine differences in serum prolactin and progesterone levels, in the abundance of prolactin and LH receptor mRNA over the experimental period, and between the bromocriptine and control groups. In the presence of significant F values, individual differences between means were established by Dunnett's test. Correlations between prolactin receptor mRNA, prolactin binding to ovarian membranes, and serum prolactin were calculated. A value of p < 0.05 was considered significant.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mink Prolactin and LH Receptor cDNA

A 675-nt fragment of the mink prolactin receptor cDNA, corresponding to nucleotides 120–895 of the rat, human, murine, rabbit, and bovine sequences, was amplified, cloned, and sequenced (GenBank Accession #AF029294). The fragment included most of the putative extracellular and all of the transmembrane domains. It contained five cysteine residues conserved among all known prolactin receptor sequences and two potential N-linked glycosylation sites. Northern analysis revealed that this probe hybridized with three principal transcripts, which were 3.4, 4.4, and 10.5 kb in size. A tissue distribution blot showed that the probe hybridized strongly with transcripts in the mink ovary and testes and weakly with the uterus, adrenal, kidney, and liver. Within the ovary, the probe bound to RNA from CL, large preovulatory follicles, and the ovarian stroma. A 1056-nt fragment of the mink LH receptor gene, corresponding to nucleotides 1065–2115 of the rat, porcine, and human LH receptor genes, was cloned and sequenced (GenBank Accession #AF029295). This fragment included the seven putative transmembrane-spanning domains and all of the cytoplasmic portion of the gene. The mink LH receptor probe hybridized strongly with a transcript 2.4 kb in size only in the ovary and testis. Development of autoradiograms for periods of 2 or more weeks indicated the presence of two minor bands, one at > 6 kb and the other at 0.8 kb. Within the ovary, the probe bound to RNA from preovulatory follicles, CL, and the ovarian stroma, which contains small healthy and atretic follicles.

Peripheral Prolactin and Progesterone during Gestation

Mean serum progesterone levels were lowest in the control group on March 19, with the first appreciable change indicative of activation of the CL present on March 27 (Fig. 1A, p < 0.05). Mean levels remained elevated through the end of the sampling period (April 15, Fig. 1A, p < 0.01), confirming the activation of the CL of diapause in late March. Treatment of pregnant animals with bromocriptine caused a definable reduction in progesterone concentrations within 4 days of insertion of the pumps (p < 0.05). Bromocriptine treatment prevented activation of the CL as indicated by a decline in progesterone levels, first noted 4 days after insertion of the pumps (p < 0.01), that did not recover to pretreatment levels over the remainder of the experiment (Fig. 1A). Serum prolactin levels in the control group, composed of saline-treated and untreated mink, increased gradually through gestation from 14.15 ± 3.9 ng/ml during diapause (March 19) to 54.08 ± 7.6 ng/ml during postimplantation gestation (April 15, Fig. 1B). Delivery of 2 mg of bromocriptine per day by minipump reduced prolactin levels to below pretreatment values within 2 days of insertion of the pumps, and prolactin remained below control levels through the duration of the treatment (March 31, Fig. 1B, p < 0.05). Embryo implantation, as indicated by the occurrence of uterine swellings, was observed as early as March 31 in a few control animals. Most control animals that were killed on April 5, and all from April 10 and 15, had uterine swellings containing embryos. Calculated dates of implantation in the control group ranged from March 31 to April 8. Although blastocysts were present in bromocriptine-treated mink at each of the collection dates, none were expanded or showed any indication of resumption of development.



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 1. A) Mean ± SEM of mink serum progesterone levels from embryonic diapause through early-postimplantation gestation in untreated animals (control) or those bearing Alzet minipumps releasing 2 mg/day bromocriptine. B) Mean ± SEM of mink prolactin concentrations in the same samples. A and B, n = 3 animals per sampling date.

Abundance of Prolactin and LH Receptor Transcripts and Prolactin Binding during Gestation

The abundance of transcripts that hybridized with the mink prolactin receptor probe did not differ in ovaries collected between March 19 and March 29, in spite of the activation of the CL through this period. Thereafter, the prolactin receptor mRNA levels increased 3-fold between March 29 and April 15 (Fig. 2, A and B, p < 0.05). These findings were confirmed in samples of CL dissected from the ovaries during diapause and postimplantation, showing that there was no apparent increase through the time of luteal activation as defined by progesterone levels in excess of 15 ng/ml, but a substantial 5-fold increase thereafter (Fig. 3). Suppression of endogenous prolactin levels with bromocriptine prevented the increase in the abundance of ovarian prolactin receptor mRNA (Fig. 2, A and C, p < 0.05). Radiolabeled prolactin binding to homogenates of whole ovaries followed the pattern of expression of prolactin receptor mRNA (Fig. 4), and no statistically detectable differences were present between March 19 and 29. Binding increased between March 29 and April 15 (p < 0.05). Prolactin receptor mRNA abundance and prolactin binding to ovarian homogenates were correlated (r = 0.51, p < 0.01), and both were correlated to serum prolactin levels (r = 0.45 and r = 0.48, respectively, p < 0.02). The abundance of LH receptor mRNA in whole ovaries was greater on March 21 and 23 relative to March 19 and 27 (Fig. 5, A and B, p < 0.05). The LH hybridization signal was less in whole ovaries after luteal activation and during postimplantation gestation. In whole ovaries, bromocriptine treatment not only prevented the apparent peak in LH receptor mRNA present during diapause in ovaries from control animals but also reduced the abundance of LH receptor mRNA to well below the level in pretreated controls (p < 0.05, Fig. 5, B and C). The mean transcript abundance was less in bromocriptine-treated mink within 2 days of the initiation of treatment and remained low thereafter (p < 0.01). There was no apparent difference in LH receptor message abundance from pools of CL taken at diapause (March 21) and activation (March 25), while there was a decline to 30% of diapause levels in CL from postimplantation gestation (Fig. 3).



View larger version (54K):
[in this window]
[in a new window]
 
FIG. 2. A) Mean ± SEM of prolactin receptor mRNA abundance in ovarian tissue collected from pregnant mink at 3-day intervals (n = 3 per sampling date) between March 19 and March 31 and every 5 days thereafter until April 15. B) The upper panel is a representative control Northern blot hybridized with the mink prolactin receptor probe, and the lower panel is the same control Northern blot rehybridized with a ribosomal 28S probe. C) The upper panel displays representative Northern blot of bromocriptine-treated animals. The blot was hybridized with the mink prolactin receptor probe, while the lower panel is the same blot rehybridized with a human ribosomal 28S probe.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 3. Relative abundance of prolactin and LH receptor transcripts in pools of CL from 10 or more ovaries taken from mink in embryonic diapause (March 21), at the approximate time of luteal activation (March 25), and at the postimplantation (April 9) stage of gestation. Results are expressed as the dimensionless ratio of the density of the sum of the three major bands of the prolactin receptor mRNA and the single band of the LH receptor mRNA divided by the corresponding densitometric value for the 28S ribosomal RNA.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 4. Mean ± SEM of 125I-labeled prolactin binding to homogenates of ovaries from pregnant mink collected between March 19 and April 15 (n = 3 per sampling date). Results are expressed as mean ± SEM cpm bound per mg protein.



View larger version (55K):
[in this window]
[in a new window]
 
FIG. 5. A) Mean ± SEM of LH receptor mRNA abundance in ovarian tissue collected from pregnant mink every 3 days between March 19 and March 31 and every 5 days thereafter until April 15 (n = 3 animals per sampling date). B) A representative control Northern blot hybridized with the mink LH receptor probe and rehybridized with the human 28S probe. C) A blot of RNA from the ovaries of bromocriptine-treated animals.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A significant portion of the extracellular and all of the transmembrane domain of the mink prolactin receptor gene was cloned and sequenced. It had sequence homologies of 78%, 79%, 81%, 84%, and 86% with the rat [18], mouse [17], human [32], bovine [21], and rabbit [20] prolactin receptor gene sequences, respectively. It also displayed 53–54% homology with the rat [33], human [34], and rabbit [34] growth hormone receptor gene from the same GH/prolactin/cytokine receptor superfamily [16]. In the portion of the extracellular domain cloned, the four cysteine residues, as well as one in the transmembrane domain, are conserved in all prolactin receptor sequences known to date. In keeping with the glycosylation of the prolactin receptor [16], two potential N-linked glycosylation sites are present in the extracellular domain of the mink prolactin receptor gene fragment cloned. A recent study has demonstrated that short and long forms of the prolactin receptor are present in the rat CL through pregnancy and that the long form predominates at all stages of gestation [35]. Differences between the forms are due to alterations in the cytoplasmic region of the gene [17, 18], which was not amplified in the present study.

Northern analysis revealed that the mink prolactin receptor probe hybridized with multiple transcripts of 3.4, 4.4, and 10.5 kb. This pattern compares to rat long form with three transcripts of 2.5, 3.0, and 5.5 kb [18]; the rabbit with three major transcripts of 2.7, 3.4, and 10.5 kb and one minor transcript of 6.2 kb [36]; and the human with transcripts of 2.5, 3.0, and 7.3 kb [32]. Tissue distribution analysis revealed a strong prolactin receptor hybridization signal in mink ovary and testes, and longer exposure of the blot indicated a signal in the uterus, adrenal, kidney, and liver [37]. The wide tissue distribution of prolactin receptor mRNA is not unexpected, since prolactin has a spectrum of biological activity [16]. The binding of the prolactin receptor probe to follicles and stroma as well as to CL in the mink ovary agrees with findings in the mouse and rat [38]. In this study, there was a correlation between [125I]prolactin binding to ovarian membranes and the abundance of prolactin receptor mRNA, suggesting that the mRNA abundance values are indicative of expression of the receptor protein. The prolactin receptor in the mink ovary is of physiological significance because of the important luteotropic role of this hormone in this species [1013]. The current experiment demonstrates that the abundance of prolactin receptor mRNA and receptor binding in the whole ovary and CL were low during the delay phase of gestation and did not increase during the early stages of CL reactivation. However, prolactin levels were correlated with prolactin receptor expression and were of sufficient magnitude to reactivate the CL, as indicated by the increase in progesterone secretion on March 27 and by the termination of embryonic diapause. The abundance both of prolactin receptor mRNA and of the number of prolactin binding sites in the ovary increased substantially after March 29, and highest levels were during implantation and early-postimplantation gestation, the time when progesterone production is maximal. This is in accordance with findings in the ovary of the pregnant mouse, where the long form of the prolactin receptor is most abundant during the luteal phase [38]. The present result differs from findings in the rat, where the level of ovarian expression of both short and long forms of prolactin receptor mRNA was constant through most of gestation, declining only as parturition approached [35].

Treatment of animals with bromocriptine did not affect basal levels of prolactin receptor mRNA in whole ovaries; however, it prevented the preimplantation increase in serum prolactin and prolactin receptor mRNA and thus abrogated the activation of the mink CL. This effect is consistent with findings from earlier studies showing that transient bromocriptine treatment resulted in low progesterone levels and extended embryonic diapause [11]. The effects of disruption of prolactin secretion and its receptor are in keeping with the results of transgenic deletion of the prolactin receptor in the mouse, which has multiple negative consequences on reproduction, including luteal defects and complete failure of embryo implantation [39]. The current investigation reveals that prolactin receptor mRNA and receptor binding are coupled and associated with serum prolactin levels, not only during normal gestation, but also in animals treated with dopamine agonists to block prolactin secretion. These correlations provide evidence in support of the conclusion that prolactin up-regulates its own receptor in the mink ovary, as has been shown in a variety of tissues and species [4043]. This is consistent with recent findings in which administration of prolactin to hypophysectomized rats, and incubation of luteinized rat granulosa cells in vitro with prolactin, increased the abundance of the prolactin receptor mRNA [35].

The putative transmembrane and cytoplasmic regions of the mink LH receptor cDNA were cloned and sequenced. This portion of the receptor gene had sequence homology of 84%, 85%, 90%, and 91% with the murine [44], rat [22], porcine [23], and human [24] LH receptor gene sequences and 64–65% with the rat [45], human [46], ovine [47], and bovine [48] FSH receptor cDNA. Of 22 potential phosphorylation sites (serine, threonine, tyrosine residues) in the intracellular region of rat LH receptor [19], 19 were conserved in the deduced amino acid sequence of the mink LH receptor. The number and location of potential phosphorylation sites in the first and second intracellular loops were the same in the mink and rat. However, in the third intracellular loop, one of the three potential phosphorylation sites in the rat was shifted from a threonine to a methionine in the mink. Hipkin et al. [49] reported that serine residues at amino acid positions 635, 639, 649, and 652 of the LH/CG receptor were phosphorylated in cells treated with hCG and phorbol 12-myristate-13-acetate. In the mink, however, only two of these serine residues were conserved (639 and 652). A further six potential phosphorylation sites were present in the cytoplasmic tail of the mink LH receptor. Segaloff and Ascoli [19] reported that cysteine residues are conserved among the species studied and that 11 of these are found in the transmembrane and cytoplasmic regions of the receptor. All 11 of these cysteine residues were conserved in the deduced amino acid sequence of the mink LH receptor, including two cysteine residues at amino acid positions 621 and 622 of the rat LH receptor, which are believed to be palmitoylated [50].

In Northern analysis, a single mink LH receptor mRNA transcript predominated over two much-weaker bands in mink ovary and testis [37]. This is in contrast with findings in other species including the rat [5153], mouse [52], human [24], pig [23], and sheep [54], where there are multiple transcripts of varying number, size, and relative abundance. No LH receptor message was detected in the brain or the uterus [37], as reported in other species [55, 56]. The predominant transcript identified in the mink CL, 2.4 kb, is large enough to encode the entire LH receptor protein, expected to have an open reading frame of approximately 2 kb [19].

The abundance of LH receptor mRNA in the ovary varied significantly across the preimplantation and early-postimplantation stages of mink gestation, in a manner strikingly different from the pattern for prolactin receptor. A transient peak in LH receptor mRNA was present in whole ovaries during the critical period of CL reactivation and directly preceded the preimplantation increase in progesterone production. This provides indirect evidence for a role for LH in the activation of the mink CL. Although no large follicles were found in the ovary after March 21, it remains possible that the peak in LH receptor mRNA is related to a nonluteal ovarian compartment, as LH receptor message did not differ between pooled CL taken on March 21 and March 25, through the critical period of activation. LH involvement in luteal activation is in contrast to observations in previous studies in which prolactin alone induced luteal activation in hypophysectomized mink, indicated by increases in peripheral progesterone concentrations and by successful embryo implantation [13]. Nonetheless, prolactin treatment alone was not capable of maintaining progesterone production and gestation in that study, indicating that one or more other factors are necessary. Determination of whether LH is one of these factors awaits further experimentation.

In the current study, treatment of animals with bromocriptine prevented the transient LH receptor mRNA peak between March 19 and 25 and reduced LH receptor mRNA levels below those of the pretreatment controls. This suggests a role for prolactin in regulation and maintenance of LH receptors. This hypothesis is indirectly supported by a number of studies showing that prolactin and/or placental lactogens increase LH receptor binding sites [57, 58] and LH receptor mRNA [59, 60] in the CL of other species. If present, the stimulatory effect of prolactin on mink LH receptors is transient, as it is not present during later gestation when prolactin levels are elevated and LH receptor mRNA remains constant.

Insufficient tissue was available for concurrent studies of LH binding. Nonetheless, other studies have shown that LH receptor mRNA abundance is highly correlated with LH binding to human [61, 62] and ovine [63] ovarian tissues. The early peak in mink LH receptor mRNA is consistent with increases in the LH receptor in the feline CL associated with luteinization [64]. Thereafter, similarities with known patterns of LH receptor or receptor mRNA are less evident. In general, LH receptor and/or its message increase with increased progesterone synthesis [27, 65], while they remain constant during the midluteal phase in the mink.

In conclusion, fragments of the mink prolactin receptor and LH receptor genes were cloned and sequenced. The abundance of mRNA for both receptors varied significantly over the course of CL activation and early-postimplantation gestation. The pattern of expression for both of these genes was greatly influenced by reduction in endogenous prolactin levels, indicating that prolactin regulates its own receptor as well as influencing the LH receptor in the mink CL.


    ACKNOWLEDGMENTS
 
We thank M. Dobias for technical assistance, Dr. A.K. Goff for progesterone antiserum, Dr. G.A. Schultz for the 28 S probe, and Dr. A.F. Parlow for canine prolactin antiserum.


    FOOTNOTES
 
1 Correspondence: B.D. Murphy, CRRA, Faculté de Médecine vétérinaire, 3200 rue Sicotte, CP 5000, St-Hyacinthe, PQ, Canada J2S 7C6. FAX: (450) 778–8103; murphyb{at}medvet.umontreal.ca Back

Accepted: April 20, 1998.

Received: February 10, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hanson A. The physiology of reproduction in mink (Mustela vison Schreb.) with special reference to delayed implantation. Acta Zool 1947; 28:1–136.
  2. Enders RK. Reproduction in the mink (Mustela vison). Proc Am Philos Soc 1952; 96:691–755.
  3. Mead RA. Embryonic diapause in vertebrates. J Exp Zool 1993; 266:629–641.[CrossRef][Medline]
  4. Møoller OM. The progesterone concentrations in the peripheral plasma of the mink (Mustela vison) during pregnancy. J Endocrinol 1973; 56:121–132.[Abstract/Free Full Text]
  5. Douglas DA, Pierson RA, Murphy BD. Ovarian follicular development in mink (Mustela vison). J Reprod Fertil 1994; 100:583–590.[Abstract/Free Full Text]
  6. Murphy BD, James DA. The effects of light and sympathetic innervation to the head on nidation in mink. J Exp Zool 1974; 187:267–276.[CrossRef][Medline]
  7. Allais C, Martinet L. Relationship between daylight ratio, plasma progesterone levels and timing of nidation in mink (Mustela vison). J Reprod Fertil 1978; 54:133–136.[Abstract/Free Full Text]
  8. Pilbeam T, Concannon PW, Travis HF. The annual reproductive cycle of the mink (Mustela vison). J Anim Sci 1979; 48:578–584.
  9. Murphy BD, Moger WH. Progestins in mink gestation: the effects of hypophysectomy. Endocr Res Commun 1977; 4:45–60.[Medline]
  10. Murphy BD, Humphrey WD, Shepstone SL. Luteal function in mink: the effects of hypophysectomy after the preimplantation rise in progesterone. Anim Reprod Sci 1980; 3:225–232.[CrossRef]
  11. Papke RL, Concannon PW, Travis HF, Hansel W. Control of luteal function and implantation in the mink by prolactin. J Anim Sci 1980; 50:1102–1107.
  12. Martinet L, Allais C, Allain D. The role of prolactin and LH in luteal function and blastocyst growth in mink (Mustela vison). J Reprod Fertil 1981; 29:119–130.[CrossRef]
  13. Murphy BD, Concannon PW, Travis HF, Hansel W. Prolactin: the hypophyseal factor that terminates embryonic diapause in mink. Biol Reprod 1981; 25:487–491.[Abstract]
  14. Murphy BD, Rajkumar K, Gonzalez Reyna A, Silversides DW. Control of luteal function in the mink (Mustela vison). J Reprod Fertil 1993; 47:181–188.
  15. Douglas DA, Song JH, Moreau GM, Murphy BD. Differentiation of the corpus luteum of the mink (Mustela vison): mitogenic and steroidogenic potential of luteal cells from embryonic diapause and postimplantation gestation. Biol Reprod 1998; 58:1163–1169.[Abstract/Free Full Text]
  16. Kelly PA, Djiane J, Postel-Vinay MC, Edery M. The prolactin/growth hormone receptor family. Endocr Rev 1991; 12:235–251.[Abstract/Free Full Text]
  17. Davis J, Linzer D. Expression of multiple forms of the prolactin receptor in mouse liver. Mol Endocrinol 1989; 3:674–680.[Abstract/Free Full Text]
  18. Shirota M, Banville D, Ali S, Jolicoeur C, Boutin JM, Edery M, Djiane J, Kelly P. Expression of two forms of prolactin receptor in rat ovary and liver. Mol Endocrinol 1990; 4:1136–1143.[Abstract/Free Full Text]
  19. Segaloff DL, Ascoli M. The lutropin/choriogonadotropin receptor... 4 years later. Endocr Rev 1993; 14:324–348.[Abstract/Free Full Text]
  20. Endery M, Jolicoeur C, Levi-Meyrueis C, Dusanter-Fourt I, Petridou B, Boutin JM, Lesueur L, Kelly P, Djiane J. Identification and sequence analysis of a second form of prolactin receptor by molecular cloning of complementary DNA from mammary gland. Proc Natl Acad Sci USA 1989; 86:2112–2116.[Abstract/Free Full Text]
  21. Scott P, Kesseler M, Schuler L. Molecular cloning of the bovine prolactin receptor and distribution of prolactin and growth hormone receptor transcripts in fetal and utero-placental tissues. Mol Cell Endocrinol 1992; 89:47–58.[CrossRef][Medline]
  22. McFarland K, Sprengel R, Phillipps H, Kohler M, Rosemblit N, Nikolics K, Segaloff D, Seeburg P. Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family. Science 1989; 245:494–499.[Abstract/Free Full Text]
  23. Loosfelt H, Misrahi M, Atger M, Salesse R, Thi M, Jilivet A, Guiochon-Mantel A, Sarr S, Jallal B, Garnier J, Milgrom E. Cloning and sequencing of porcine LH-hCG receptor cDNA: variants lacking the transmembrane domain. Science 1989; 245:525–528.[Abstract/Free Full Text]
  24. Minegishi T, Nakamura K, Takakura Y, Miyamoto K, Hasegawa Y, Ibuki Y, Igarashi M. Cloning and sequencing of human LH/hCG receptor cDNA. Biochem Biophys Res Commun 1990; 172:1049–1054.[CrossRef][Medline]
  25. Sambrook J, Fritsch E, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.
  26. Gonzalez Il, Gorski JI, Campen TJ, Dorney DJ, Erickson JM, Sylvester JE, Schmickel PD. Variation among human 28S ribosomal RNA genes. Proc Natl Acad Sci USA 1985; 82:7666–7670.[Abstract/Free Full Text]
  27. Harris K, Murphy BD, Grinwich DL. Characteristics of luteal function in the superovulated pseudopregnant hamster. Biol Reprod 1981; 25:699–707.[Abstract]
  28. Thorell JL, Johansson BG. Enzymatic iodination of polypeptides to high specific activity. Biochim Biophys Acta 1971; 251:363–369.[Medline]
  29. Lowry O, Rosenbrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem 1951; 193:265–275.[Free Full Text]
  30. Lafrance M, Goff AK. Effect of pregnancy on oxytocin-induced release of prostaglandin F2{alpha} in heifers. Biol Reprod 1985; 33:1113–1119.[Abstract]
  31. Murphy BD, DiGregario GB, Douglas DA, Gonzalez-Reyna A. Interactions between melatonin and prolactin during gestation in mink (Mustela vison). J Reprod Fertil 1990; 89:423–429.[Abstract/Free Full Text]
  32. Boutin J-M, Edery M, Shirota M, Jolicoeur C, Lesueur L, Ali S, Djiane J, Kelly PA. Identification of a cDNA encoding a long form of prolactin receptor in human hepatoma and breast cancer cells. Mol Endocrinol 1989; 3:1455–1461.[Abstract/Free Full Text]
  33. Mathews LS, Enberg B, Norstedt G. Regulation of rat growth hormone receptor gene expression. J Biol Chem 1989; 264:9905–9910.[Abstract/Free Full Text]
  34. Leung D, Spencer SA, Cachianes G, Hammond RG, Collins C, Henzel WJ, Barnard R, Waters MJ, Wood WI. Growth hormone receptor and serum binding protein: purification, cloning and expression. Nature 1987; 330:537–543.[CrossRef][Medline]
  35. Telleria C, Parmer TG, Zhong L, Clarke DL, Albarracin CT, Duan WR, Linzer DIH, Gibori G. The different forms of the prolactin receptor in the rat corpus luteum: developmental expression and hormonal regulation in pregnancy. Endocrinology 1997; 138:4812–4820.[Abstract/Free Full Text]
  36. Dusanter-Fourt I, Gaye P, Belair L, Petridou B, Kelly PA, Djiane J. Prolactin receptor gene expression in the rabbit: identification, characterization and tissue distribution of several PRL receptor mRNA encoding a unique precursor. Mol Cell Endocrinol 1991; 77:181–192.[CrossRef][Medline]
  37. Douglas DA, Song JH, Houde A, Cooke GM, Murphy BD. The luteal and placental characteristics of carnivore gestation: expression of genes for luteotrophic receptors and steroidogenic enzymes. J Reprod Fertil Suppl 1997; 51:153–166.[Medline]
  38. Clarke DL, Linzer DIH. Changes in prolactin receptor expression during pregnancy in the mouse ovary. Endocrinology 1993; 133:224–232.[Abstract/Free Full Text]
  39. Ormandy CJ, Camus A, Barra J, Damotte D, Lucas B, Buteau H, Edery M, Brousse N, Babinet C, Binart N, Kelly PA. Null mutation of the prolactin receptor gene produces multiple reproductive defects in the mouse. Genes Dev 1997; 11:167–178.[Abstract/Free Full Text]
  40. Posner B, Kelly PA, Friesen HG. Prolactin receptors in rat liver: possible induction by prolactin. Science 1975; 188:57–59.[Abstract/Free Full Text]
  41. Djiane J, Durand P. Prolactin-progesterone antagonism in self regulation of prolactin receptors in the mammary gland. Nature 1977; 266:641–643.[CrossRef][Medline]
  42. Klemcke HG, Bartke A, Steger R, Hodges S, Hogan MP. Prolactin (PRL), follicle-stimulating hormone, and luteinizing hormone are regulators of testicular PRL receptors in golden hamsters. Endocrinology 1986; 188:773–782.
  43. Barash I, Cromlish W, Posner BI. Prolactin (PRL) receptor induction in cultured rat hepatocytes: dual regulation by PRL and growth hormone. Endocrinology 1988; 122:1151–1158.[Abstract/Free Full Text]
  44. Gudermann T, Birnbaumer M, Birnbaumer L. Evidence for dual coupling of the murine luteinizing hormone receptor to adenylyl cyclase and phosphoinositide breakdown and Ca+2 mobilization. Studies with the cloned murine luteinizing hormone receptor expressed in L cells. J Biol Chem 1992; 267:4479–4488.[Abstract/Free Full Text]
  45. Sprengel R, Braun T, Nikolics K, Segaloff D, Seeburg PH. The testicular receptor for follicle stimulating hormone: structure and functional expression of cloned cDNA. Mol Endocrinol 1990; 4:525–530.[Abstract/Free Full Text]
  46. Minegishi T, Nakamura K, Takakura Y, Ibuki Y, Igarashi M. Cloning and sequencing of human FSH receptor cDNA. Biochem Biophys Res Commun 1991; 175:1125–1130.[CrossRef][Medline]
  47. Yarney T, Sairam MR, Khan Ravindranath N, Payne S, Seidaah NG. Molecular cloning and expression of the ovine testicular follicle stimulating hormone receptor. Mol Cell Endocrinol 1993; 93:219–226.[CrossRef][Medline]
  48. Houde A, Lambert A, Saumande J, Silversides D, Lussier J. Structure of the bovine follicle-stimulating hormone receptor complementary DNA and expression in bovine tissues. Mol Reprod Dev 1994; 39:127–135.[CrossRef][Medline]
  49. Hipkin R, Wang Z, Ascoli M. Human chorionic gonadotropin (CG)- and phorbol ester-stimulated phosphorylation of the luteinizing hormone/CG receptor maps to serines 635, 639, 649, and 652 in the C-terminal cytoplasmic tail. Mol Endocrinol 1995; 9:151–158.[Abstract/Free Full Text]
  50. Zhu H, Wang H, Ascoli M. The luteotropin/choriogonadotropin receptor is palmitoylated at intracellular cysteine residues. Mol Endocrinol 1995; 9:141–150.[Abstract/Free Full Text]
  51. Hu Z-Z, Tsai-Morris CH, Buczko E, Dufau ML. Hormonal regulation of LH receptor mRNA and expression in the rat ovary. FEBS Lett 1990; 274:181–184.[CrossRef][Medline]
  52. Wang H, Ascoli M, Segaloff DL. Multiple luteinizing hormone/chorionic gonadotropin receptor messenger ribonucleic acid transcripts. Endocrinology 1991; 129:133–139.[Abstract/Free Full Text]
  53. LaPolt PS, Oikawa M, Jia XC, Dargan C, Hsueh AJ. Gonadotropin-induced up- and down-regulation of rat ovarian LH receptor message levels during follicular growth, ovulation and luteinization. Endocrinology 1990; 126:3277–3279.[Abstract/Free Full Text]
  54. Bacich DJ, Rohan RM, Norman RJ, Rodgers RJ. Characterization and relative abundance of alternatively spliced luteinizing hormone receptor messenger ribonucleic acid in the ovine ovary. Endocrinology 1994; 135:735–744.[Abstract]
  55. Lei ZM, Rao CV, Kornyei JL, Licht P, Hiatt ES. Novel expression of human chorionic gonadotropin/luteinizing hormone receptor gene in the brain. Endocrinology 1993; 132:2262–2270.[Abstract/Free Full Text]
  56. Bonnamy P-J, Benhain A, Leymarie P. Uterine luteinizing hormone/human chorionic gonadotropin-binding sites in the early pregnant rat uterus: evidence for total occupancy in the preimplantation period. Endocrinology 1993; 132:1240–1246.[Abstract/Free Full Text]
  57. Gibori G, Richards JS. Dissociation of two distinct luteotropic effects of prolactin: regulation of luteinizing hormone-receptor content and progesterone secretion during pregnancy. Endocrinology 1978; 102:767–774.[Abstract/Free Full Text]
  58. Jammes H, Schirar A, Djiane J. Differential patterns in luteal prolactin and LH receptors during pregnancy in sows and ewes. J Reprod Fertil 1985; 73:27–35.[Abstract/Free Full Text]
  59. Gafvels M, Bjurulf E, Selstam G. Prolactin stimulates the expression of luteinizing hormone/chorionic gonadotropin receptor messenger ribonucleic acid in the rat corpus luteum and rescues early pregnancy from bromocriptine-induced abortion. Biol Reprod 1992; 47:534–540.[Abstract]
  60. Bjurulf E, Selstam G, Olofsson JI. Increased LH receptor mRNA and extended corpus luteum function induced by prolactin and indomethacin treatment in vivo in hysterectomized pseudopregnant rats. J Reprod Fertil 1994; 102:139–145.[Abstract/Free Full Text]
  61. Duncan WC, McNeilly AS, Fraser HM, Illingworth PJ. Luteinizing hormone receptor in the human corpus luteum: lack of down-regulation during maternal recognition of pregnancy. Hum Reprod 1996; 11:2291–2297.[Abstract/Free Full Text]
  62. Nishimora K, Dunkel L, Hsueh AJ, Yamoto M, Nakano R. Expression of luteinizing hormone and chorionic gonadotropin receptor messenger ribonucleic acid in human corpora lutea during menstrual cycle and pregnancy. J Clin Endocrinol Metab 1995; 80:1444–1448.[Abstract]
  63. Smith G, Gentry PC, Roberts RM, Smith MF. Ontogeny and regulation of luteinizing hormone receptor messenger ribonucleic acid within the ovine corpus luteum. Biol Reprod 1996; 54:76–83.[Abstract]
  64. Swanson W, Roth TL, Brown JL, Wildt DE. Relationship of circulating steroid hormones luteal luteinizing hormone receptor progesterone, concentration and embryonic mortality in early embryogenesis in the cat. Biol Reprod 1995; 53:1022–1029.[Abstract]
  65. Smith GD, Sawyer HR, Mirando MA, Griswold MD, Sadhu A, Reeves JJ. Steady-state luteinizing hormone receptor messenger ribonucleic acid levels and endothelial cell composition in bovine normal and short-lived corpora lutea. Biol Reprod 1996; 55:902–909.[Abstract]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
M. Sato, T. Tsubota, T. Komatsu, G. Watanabe, K. Taya, T. Murase, I. Kita, and T. Kudo
Changes in Sex Steroids, Gonadotropins, Prolactin, and Inhibin in Pregnant and Nonpregnant Japanese Black Bears (Ursus thibetanus japonicus)
Biol Reprod, October 1, 2001; 65(4): 1006 - 1013.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
L.A. Howell-Skalla, D. Bunick, R.A. Nelson, and J.M. Bahr
Testicular Recrudescence in the Male Black Bear (Ursus americanus): Changes in Testicular Luteinizing Hormone-, Follicle-Stimulating Hormone-, and Prolactin-Receptor Ribonucleic Acid Abundance and Dependency on Prolactin
Biol Reprod, August 1, 2000; 63(2): 440 - 447.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Douglas, D.A.
Right arrow Articles by Murphy, B.D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Douglas, D.A.
Right arrow Articles by Murphy, B.D.
Agricola
Right arrow Articles by Douglas, D.A.
Right arrow Articles by Murphy, B.D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS