Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Butler, C. M.
Right arrow Articles by Renfree, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Butler, C. M.
Right arrow Articles by Renfree, M. B.
Agricola
Right arrow Articles by Butler, C. M.
Right arrow Articles by Renfree, M. B.
Biology of Reproduction 59, 725-732 (1998)
©Copyright 1998 Society for the Study of Reproduction, Inc.

Developmental Expression of the Androgen Receptor during Virilization of the Urogenital System of a Marsupial1

Christopher M. Butler2,a, Jenny L. Harry3,a, Janine E. Deakinb, Desmond W. Cooperb, , and Marilyn B. Renfreea

a Department of Zoology, University of Melbourne, Parkville, Victoria 3052, Australia b The Marsupial Collaborative Research Centre, School of Biological Sciences, Macquarie University, North Ryde, NSW 2019, Australia


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In the marsupial tammar wallaby, virilization begins approximately 3 wk after the onset of testosterone synthesis. In the eutherian mammal, in contrast, the onset of virilization of the male urogenital tract occurs shortly after the onset of androgen synthesis. Androgen action requires the presence of the androgen receptor to mediate a response in target tissues. We therefore investigated the developmental expression of the androgen receptor (AR) in both sexes of the tammar wallaby. AR gene transcript was detected in fetal gonad and brain as early as Day 19 of the 26.5-day gestation, 7 days earlier than the first rise in testicular testosterone (Days 0–5 postpartum [p.p.]). Immunoreactive AR was identified in the male urogenital sinus (UGS) 2 days before birth and in the female UGS and mammary glands by the day of birth. AR was present in the UGS, vagina, and prostate until Day 152 p.p., the oldest age examined. AR was identified in the gubernaculum testis at Day 2 p.p. and became more abundant by Day 32. In the phallus of both sexes, AR was identified by Day 4 p.p. and until Day 157, the oldest age examined. AR was not detected in the scrotum at any age from the day of birth to Day 157. Maturation of the phallus, wolffian duct, and epididymis was marked by appearance of epithelial immunostaining. AR was localized in the epithelium of the UGS in females by Day 50 p.p. but was not found in the epithelium of the male UGS up to Day 152 p.p., the oldest examined. AR were found in the mesenchyme of the UGS of male and female tammars 3–4 wk before virilization is first evident in the male at Day 25 p.p. We conclude that the presence of AR is not the initiating signal for virilization of the UGS in this marsupial male.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In mammals, the morphological events leading to the virilization of the male reproductive tract are controlled by the androgenic hormones testosterone (T) and dihydrotestosterone (DHT) [1]. T controls differentiation and growth of the wolffian duct derivatives (vas deferens, epididymides, and seminal vesicle), while its 5{alpha}-reduced metabolite DHT is responsible for prostate development and virilization of the external genitalia [2, 3].

T and DHT both act within cells via interaction with the same androgen receptor (AR) [2]. The AR is a member of the superfamily of ligand-binding transcription factors that includes receptors for steroid hormones, thyroid hormone, vitamin D, and retinoic acid [4]. DHT has a higher binding affinity and slower rate of dissociation from the AR than does T [5]. Thus, the androgenic effect is amplified by the conversion of T to DHT. The control of cellular differentiation by androgens is therefore dependent on the presence at target sites of hormone, AR, and, in some tissues, 5{alpha}-reductase.

In the marsupial tammar wallaby (Macropus eugenii), the scrotum, mammary primordia, gubernaculum, and processus vaginalis differentiate during early fetal life under the influence of a gene or genes on the X chromosome, well before the testis becomes functional [69]. The remaining sexually dimorphic structures, namely the vasa deferentia, epididymides, prostate, male urethra, and phallus, are all under androgenic control and differentiate postnatally after the formation of testis cords at Day 2 postpartum (p.p.) and the onset of testicular T production [10]. The development of the prostate can be prevented by treatment with the androgen receptor inhibitor, flutamide, or with finasteride, which inhibits DHT formation, during the period of virilization of the urogenital sinus [11, 12]. Prostate formation in females is stimulated by exogenous T [9, 12]. Castration of early pouch young inhibits the formation of the penis and prostate in males, and transplantation of testes to female pouch young induces formation of the penis and prostate [13].

Pre-Sertoli cells can be identified at the ultrastructural level 1 day before birth in the tammar. Testis cords are first seen at a light microscopic level 2 days after birth coinciding with measurable gonadal T [14]. Testicular T level rises to plateau at around Day 10 and remains high until Day 40, after which it gradually declines to basal levels by Day 70 [10]. T remains relatively low until puberty, which occurs between 19 and 25 mo of age in this species [15]. 5{alpha}-Reductase activity, as measured by DHT production in cultured tissues, is detectable at a high level in the urogenital sinus (UGS) and urogenital tubercle from at least Day 10 p.p. [10].

Virilization of the UGS of the tammar is androgen dependent and requires the presence of both DHT and active AR [11, 12]. Sensitivity to androgens is developed in the UGS in a relatively narrow window of time between Days 20 and 25 p.p. when the prostatic buds first appear [9, 11, 12, 16]. These epithelial buds, the first sign of virilization of the UGS, are not evident until 3 wk after initiation of T production, which occurs immediately after birth. In contrast, in eutherian mammals, virilization of the UGS and wolffian duct commences shortly after the initiation of T synthesis by the fetal testis [1]. In the rat, T production commences around gestational Day 15.5 and peaks at 18.5 days [17, 18]. Prostatic buds in the rat embryo first develop in the UGS around Day 19.5 and continue to mature postnatally [19]. Sexual dimorphism of the wolffian duct is evident by gestational Day 16 [20]. Similarly, virilization occurs within a few days of T production by the fetal testis in the rabbit [2123], sheep [24], guinea pig [25], and human [26]. In the rabbit, functional studies have shown that the fetal AR is active in the UGS from Day 18 of gestation, the time at which T synthesis begins in the fetal testis [27, 28].

The extensive delay between T and DHT production and virilization in the male tammar suggests that some other factor is responsible for initiation of virilization. We hypothesized that the sensitivity to androgens in the UGS could be controlled by the presence/absence of AR, which would be rate-limiting for the onset of virilization. We therefore investigated the ontogeny of the AR in the developing male tammar throughout the period of virilization. Since administration of superphysiological levels of T to female pouch young induces prostatic bud formation at the same rate as in control males of the same age [9, 12], we also assessed AR expression in the developing female.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals

Tammar wallabies of Kangaroo Island, South Australia, origin were kept in open grassy yards and provided with lucerne cubes, oats, fresh vegetables, and water ad libitum. Tammar wallabies are seasonal breeders and have a postpartum estrus that results in the presence of a diapausing blastocyst in the uterus while a pouch young is suckled. Removal of pouch young (RPY) causes reactivation of the quiescent blastocyst. Births occur on average 26.5 days later [29]. The aging of fetuses according to days after RPY instead of days of gestation reflects active gestation after the blastocyst stage, since in this species total gestation normally includes 11 mo of embryonic diapause. Adult female tammars were checked daily for births. In cases in which the day of birth was uncertain, the new pouch young were aged by head length [30].

Pouch young aged between 5 and 60 days were killed by decapitation; the gonads, phallus, and UGS were removed, embedded in Tissue-Tek OCT (Miles Laboratories, Melbourne, Victoria, Australia), and snap frozen in a dry ice/ethanol slurry. Fetuses and pouch young less than 5 days old were bisected at the level of the metanephric kidney, and the caudal half of the animal was embedded for immunohistochemical analysis. Adult animals and pouch young older than 60 days were killed by overdose of sodium pentobarbitone in sterile saline, and tissues were processed as above. Tissues for reverse transcription-polymerase chain reaction (RT-PCR) were snap frozen in liquid nitrogen. All samples were stored at -80°C until processed.

Tissue used in RT-PCR was obtained from brains of one male fetus at Day 22, of one fetus of each sex at Days 23, 24, 25, 26 RPY, and of one pouch young of each sex at the day of birth, Day 2, and Day 4 p.p.; and from the posterior half of two fetuses of each sex (Days 19, 20, 22 RPY), gonad and mesonephros (Days 23, 24 RPY), gonad only (Days 25, 26, RPY), and gonads from two pouch young of each sex at the day of birth, Day 2, and Day 4 p.p. UGS, developing gonads and associated ducts, scrotum, and phallus of fetuses from Day 25 RPY and pouch young from day of birth to Day 157 of pouch life were examined for the presence of AR protein. In all immunohistochemistry experiments, at least two males and two females of comparable age were used to represent each age except female Day 25 RPY fetus (n = 1). All experiments followed the National Health and Medical Research Council (1990) guidelines and were approved by Institutional Animal Ethics Committees.

Partial Cloning and Sequencing of Tammar AR

Primers for PCR (forward primer 5'CACATTGAAGGCTATGAGTG 3' and reverse primer 5'CCCATCCAGGAGTACTGAAT 3'; see Fig. 1) were based on a sequence spanning exons 4 and 5 of the AR from the brush-tailed possum (Trichosurus vulpecula) (GenBank accession number AF033557). This region is highly conserved across many species. Total RNA from tammar adult prostate and epididymis (1 µg) was reverse transcribed and the cDNA was used for PCR (see below). The PCR products were separated on a 2% agarose gel, purified (Wizard minipreps; Promega, Annadale, NSW, Australia), and cloned using the pGEMT vector system according to the manufacturer's instructions (Promega). The vector was digested with Apa I and Sac I, and the insert was sequenced using the AmpliCycle-PCR sequencing kit (Perkin Elmer, Sydney, NSW, Australia) according to the manufacturer's instructions. The PCR product from epididymis was sequenced directly after purification from the agarose gel.



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 1. a) Partial sequence of tammar AR gene spanning the intron/exon junction of exons 4 and 5 with putative amino acid sequence. Primer sequences are underlined. b) Putative amino acid sequence compared to the brushtail possum (Trichosurus vulpecula), human, and rat sequence for the same region. Differences are shaded. Numbering of rat and human sequence from Lubahn et al. [35].

RT-PCR

Total RNA was extracted from samples using the guanidinium thiocyanate method [31] and reverse transcribed using Mo-MuLV reverse transcriptase (Gibco-BRL, Melbourne, Victoria, Australia). Primers used in PCR are described above. Cycle conditions for amplification using AR primers were 94°C, 30 sec (94°C, 30 sec; 52°C, 1 min; 72°C, 1 min for 36 cycles) and 72°C, 2 min. Efficiency of the reverse transcription and PCRs was monitored by amplification of phosphoglycerate kinase (PGK) as described previously [32]. Tammar genomic DNA was used in all PCR experiments to identify bands generated by contamination with genomic DNA. Controls lacking template DNA or Taq polymerase were also run for each sample.

Immunohistochemistry

Three antibodies were used to immunolocalize AR in tammar tissue. Antibodies U402 (a kind gift of Professor J.D. Wilson, Dr. C.M. Wilson, and Dr. M.J. McPhaul; Department of Internal Medicine, University of Texas, South Western Medical Center, Dallas, TX) and PG21 (Signet Laboratories, Adelaide, South Australia) both recognize part of the transactivation region at the amino terminus of human AR [33, 34]. R489 (also a gift from Professor J. Wilson, Dr. C.M. Wilson, and Dr. M.J. McPhaul) recognizes part of the ligand-binding region at the carboxyl terminus of the human AR [33]. These antibodies cross-react with AR in a number of other mammalian species.

Tissue sections (10 µm) were cut on a Reichert-Jung 3CM3000 cryostat (Leica, Hawthorn East, Victoria, Australia), thaw mounted on Histogrip (Zymed Laboratories, Gymea, NSW, Australia)-coated microscope slides, and fixed for 5 min in 10% formalin in PBS, pH 7.4. Sections were washed briefly, postfixed in ice-cold methanol with 0.3% H2O2 for 5 min (to block endogenous peroxidases) and ice-cold acetone for 1 min, and washed in PBS (0.01 M, pH 7.4). The immunohistochemistry method of Husmann et al. [33] was followed using the Vectastain ABC kit (Vecta Laboratories, Camperdown, NSW, Australia) and diaminobenzidine (DAB) as chromogen for reaction with the U402 antibody, and a slightly modified protocol for PG21 and R489. All antibodies were diluted in blocking serum (1% wallaby serum, 3% normal goat serum in PBS, pH 7.4) and incubated overnight at 4°C before use. U402 antibody was used at a dilution of 1:400, and sections were incubated overnight at 4°C. Secondary antibody was used at 1:400 in blocking serum, and ABC complex was used at 1:400 in PBS.

The PG21 and R489 antibodies were used at 1:50 and 1:400 dilutions, respectively, and sections were incubated 48 h at 4°C. Sections were then washed in PBS and incubated with second antibody (1:400, 30 min). All washes after use of the secondary antibody were in Tris-buffered saline (TBS), pH 7.5, with 0.5% Tween 20 (ICN, Melbourne, Victoria, Australia). Sections were then incubated with ABC complex (1:400 in PBS, 30 min) and washed, and the signal was amplified by incubating sections with biotinylated tyramide (1:200 in amplification diluent; New England Nuclear [NEN], Sydney, New South Wales) or 0.1 M borate buffer, (pH 8.0 with 0.03% H2O2) for 10 min followed by streptavidin-horseradish peroxidase (1:4000 [TBS], pH 7.5, and 0.5% blocking compound, NEN) for 30 min. The sections were developed using DAB as used for U402. The amplification step allowed the primary antibody to be used at a lower concentration and improved staining intensity without increasing background.

All experiments included positive (adult prostate) and negative (spleen) control tissues. Alternate sections of each tissue were taken. One was treated with primary antibody, and in the other, either the primary antibody was omitted or antibody preabsorbed to the appropriate peptide was used as a control. Preabsorption of the antibody resulted in complete abolition of immunostaining in all cases.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
AR Gene Expression

The specificity of primers used in RT-PCR was established by comparing the sequence of the single bands produced in PCR, using total RNA from the prostate and epididymis of the adult tammar, to the known sequences of brushtail possum, human, and rat AR [35] (Fig. 1). The tammar partial sequence showed high homology to the brushtail possum, human, and rat sequences in this highly conserved region of the AR (Fig. 1b). The sequences generated from tammar epididymis and prostate were identical.

AR gene transcript was detected in tammar fetuses as early as Day 19 RPY, the earliest stage investigated (Fig. 2a). The genital ridge arises at around Day 20 RPY, and the gonad/mesonephros complex can be dissected by Day 23 RPY. AR transcript was detected in gonad/mesonephros on Day 23 and Day 24 RPY and in gonad from Day 25 RPY to Day 4 p.p., the oldest age examined (Fig. 2a). AR transcript was present in both sexes at all ages examined. AR transcript was also present in developing tammar brain from Day 23 RPY to Day 4 p.p. (oldest examined) in both sexes (Fig. 2b). Control PCR reactions detecting the PGK housekeeping gene were carried out on the same cDNA samples as used for PCR with AR primers. In all cases except one (Day 22 RPY male brain), control reactions were positive (Fig. 2c). The negative result for the Day 22 RPY male brain sample using both AR and PGK primers suggests that either the RNA extraction procedure or the reverse transcription reaction did not work. Control reactions using water instead of template DNA or omission of DNA polymerase were run with each reaction and were negative in all cases (results not shown).



View larger version (56K):
[in this window]
[in a new window]
 
FIG. 2. Expression of AR gene transcript in developing tammar tissues. Transcribed AR mRNA produces a band at ~270 base pairs (bp) and genomic DNA at ~870 bp. a) Posterior fetus and developing gonad. Lane 1, markers (bp); lanes 2–7, posterior half of fetus; lanes 8–11, gonad/mesonephros complex; lanes 12–21, gonad only (age and sex as marked); lane 22, genomic DNA. b) Brain. Lane 1, markers (bp); lanes 2–16, fetal and pouch young brain samples, age and sex as marked; lane 17, genomic DNA; lane 18, pGEMT plasmid containing insert used to generate the sequence in Fig. 1. c) Representative PGK control lanes as for b. dOB, day of birth; m, male; f, female.

Immunolocalization of AR

Adult prostate sections (included in each experiment as a positive control tissue) showed positive immunostaining for all three antibodies. Preabsorbing the antibody to its relevant antigenic peptide abolished any immunostaining in positive controls (Fig. 3). AR immunostaining was considered to be positive only if control sections (preabsorbed antibody or no primary antibody) showed no staining (Fig. 3, b, d, and f). PG21 and U402 antibodies localized AR immunostaining to the nucleus of positive cells (Fig. 3, a and c). R489 antibody staining was both nuclear and cytoplasmic (Fig. 3e).



View larger version (90K):
[in this window]
[in a new window]
 
FIG. 3. Immunohistochemical controls. a) Adult prostate incubated with antibody U402. All epithelial cells show positive ("ginger") immunostaining in nuclei only (arrows). b) Control, adult prostate incubated with antibody U402 preabsorbed to the peptide used to produce the antibody. c) Adult prostate incubated with antibody PG21. Epithelial nuclei show immunoreactive AR. d) Control, adult prostate incubated with secondary antibody only. e) Adult prostate incubated with R489 antibody; immunoreactive AR is present in both nucleus and cytoplasm of epithelial cells. f) Control, adult prostate incubated with secondary antibody only. Bars = 56 µm.

UGS and Developing Prostate

In the neonatal male, UGS AR immunostaining was clearly present in mesenchymal tissue (Fig. 4a). There was a weak localization in the male fetus at Day 25 of gestation approximately 1.5 days before birth (Fig. 4b), and AR was demonstrable in the mesenchyme of the UGS or the stroma of the prostate (Fig. 4d) until the oldest age examined (Day 152 p.p.). AR was present in both epithelium and stroma of adult prostate (Fig. 3), but in developing males the epithelium of the UGS showed no or very low levels of immunostaining of AR even after the prostate had differentiated. The oldest age examined was Day 152, when the glandular epithelium has differentiated and the ductal lumen within the glandular portion is beginning to expand. Epithelial cells remained, for the most part, AR negative except for occasional cells that stained at a very low level. No AR immunostaining was found in the posterior half of late-gestation female fetuses (results not shown). AR in the female were first found in the mesenchyme of both the UGS and developing mammary glands by the day of birth (Fig. 4c) and were strongly present by Day 2. Localization of AR in female pouch young was initially the same as that in males. The older female UGS differed from that of males in that AR immunostaining appeared in the epithelium of the UGS by approximately Day 50 of pouch life (Fig. 4e). By Day 158 when the vagina is fully differentiated, smooth muscle within the vaginal walls and the vaginal epithelium both stained strongly for AR (Fig. 4f), a pattern that was also found in the adult vagina. Interestingly, the R489 antibody showed an identical tissue localization of the AR in the early UGS, but the AR was found in the cytoplasm rather than the nucleus.



View larger version (109K):
[in this window]
[in a new window]
 
FIG. 4. a) Male at day of birth, cross section at level of bladder. ugs, urogenital sinus; m, mesenchyme; e, epithelium. Note scrotal bulges (sc); g, gut; p, pelvis. b) Male fetal UGS, Day 25 RPY. The UGS has formed and the bladder is developing. wd, wolffian ducts. c) Female pouch young, Day 0–1 p.p. mg, mammary gland primordia. d) Prostate of male pouch young, Day 152 p.p. Note lumen of the glandular epithelium has not yet expanded (arrows). s, stromal cells of the prostate; vd, vas deferens. e) Female UGS, Day 60 p.p. f) Female lower vagina, Day 158 p.p. sm, smooth muscle. g) Female phallus, cross section, Day 4 p.p. Bars = 286 µm except b, bar = 111 µm.

Phallus

AR was present in mesenchymal tissue of the phallus in pouch young of both sexes from Day 4 onward (Fig. 4g). In males, AR was found in urethral epithelium and in mesenchyme until at least Day 61 p.p., but at Day 152 AR were detectable in the epithelium of the urethra only (Fig. 5a). In females, receptors were seen in the mesenchymal tissue and epithelium of the urethra until Day 118, the oldest age examined (Fig. 5b).



View larger version (106K):
[in this window]
[in a new window]
 
FIG. 5. a) Male phallus, longitudinal section, Day 152 p.p. Note immunostaining in the urethral epithelium; bar = 625 µm. b) Female phallus, cross section, Day 118 p.p. c, corpus cavernosum; bar = 111 µm. c) Male pouch young Day 2 p.p. ugs, urogenital sinus; sc, scrotal bulges; gb, gubernaculum testis; bar = 286 µm. d) Scrotum and gonad, cross section, Day 32 p.p. t, testis; wd, wolffian duct. Inset, top, Sertoli cells (arrow heads) of the developing seminiferous tubules and some interstitial cells are AR positive. Inset, bottom, higher magnification of wolffian duct; note intense immunostaining of epithelium (arrowhead); bar = 286 µm for main figure and 56 µm for insets. e) The epididymis and f) the scrotal mesenchyme of male pouch young, Day 158 p.p. Note strong AR immunostaining in the epithelium (arrowhead); bar = 56 µm.

Gonads and Wolffian Ducts

AR was not detected in gonads of either sex except in two males. One Day 32 male showed strong immunostaining in Sertoli cells and interstitial cells (Fig. 5d), and in one Day 34 male, weak immunostaining was seen in the interstitial cells and the rete testis. In these same specimens the wolffian ducts had differentiated into the epididymides and vasa deferentia. Strong staining was present in the epithelial lining of the vas deferens, whereas the surrounding mesenchyme was devoid of AR immunostaining. In contrast, immunostaining once more appeared in the surrounding outer mesenchyme (Fig. 5d, inset). At Day 157 p.p. there was strong staining in the epithelium of the epididymal tubules (Fig. 5e).

Gubernaculum

The gubernaculum, a strand of mesenchymal tissue attached to the base of the scrotum, was immunoreactive for AR at a low level in a 2-day-old male pouch young (Fig. 5c). At Day 32 the gubernaculum was strongly AR positive (Fig. 5d). By Day 157, the remains of the gubernaculum are present as the tendon attaching the testis to the base of the scrotum, and this tissue showed a low level of AR-positive immunostaining.

Scrotum

Scrotal tissue was examined from male pouch young from Days 0–4, Day 32, Day 34, and Day 157. In all pouch young investigated, AR immunostaining was not detected in the scrotal mesenchyme (Figs. 4a and 5, c and d). Furthermore, at Days 32 and 157, despite strong staining in gubernaculum, testis, and vas deferens/wolffian duct, no staining was detectable in the scrotum (Fig. 5f).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Virilization in the male tammar wallaby is a prolonged process stretching throughout almost the entire postnatal period. As in other mammals, androgens are necessary for the development of the male sex tract. However, they do not themselves initiate virilization. This study has shown that the appearance of AR in target tissues also does not initiate virilization in this marsupial. Both mRNA and translated protein for AR are found in target tissues well before any morphological signs of virilization. In the tammar, androgen target tissues begin to virilize well after the establishment of androgen production and after cellular receptors and activating enzymes are present. Thus, AR, 5{alpha}-reductase, and high levels of circulating androgens are present in the UGS at least 15 days before the formation of prostatic buds ([10], this study). Initiation of virilization in the tammar therefore requires some, as yet unidentified, additional signal.

AR gene transcript appears very early in the fetal gonad and brain of both sexes. Transcriptional expression of the AR gene before birth is therefore not reliant on gonadal androgen, since there is no appreciable androgen in testes until after birth [10]. While AR transcript is readily detected in gonadal tissue, AR protein does not appear to be expressed consistently in the gonad, suggesting that there may be some posttranslational control of the level of AR protein. Similarly, in another marsupial, Monodelphis domestica, there was no immunolocalization of AR in the developing testis until after puberty [36]. Although females do not show virilization of the urogenital system, female and male fetuses and pouch young have a similar pattern of AR gene transcription. Initial transcription and translation of the AR gene is therefore androgen independent, as is also the case for AR in the developing UGS of the rat [37].

In eutherian mammals, the penis develops from the urogenital tubercle and parts of the labio-scrotal folds. In marsupials there are no labia, and the phallus develops cranial to the urogenital opening [8]. The phallus is initially identical in males and females and remains indistinguishable between the sexes until Day 100 p.p. (unpublished results). In males, the phallus elongates and enlarges to the typical form of the adult by Day 150 p.p. In females, the phallus changes little except for minimal growth. AR distribution in the male and female phallus mirrors this pattern, remaining identical until morphological changes are identifiable. AR are initially localized to both the mesenchyme and epithelium but found exclusively in the urethral epithelium of the differentiated male phallus.

Scrotal development in the tammar is independent of androgens. Scrotal primordia develop by Day 22 RPY, well before androgen production occurs in the developing testis [6, 10, 14], and are insensitive to hormone treatment [9]. AR were not identified immunohistochemically in the scrotum of any male examined from the day of birth to Day 152 of pouch life. In contrast, in Monodelphis domestica, strong immunostaining of AR is present in the scrotum by Day 5 p.p. [36]. Mesenchymal tissue of the scrotum of older tammar pouch young has a high water content and jellylike consistency. It is possible that the tissue is too diffuse for adequate immunostaining, but the scrotum in early pouch young is compact. The scrotum was clearly negative for AR even when immunostaining was strong in the gubernaculum, testis, and vas deferens/wolffian duct at Day 32. This observation suggests that AR is not expressed in the tammar scrotum. It should be noted, however, that 5{alpha}-reductase can be detected at a low level in the developing tammar scrotum at around Day 10 [10], possibly due to the presence of the gubernaculum within the scrotum.

The prostate of the tammar wallaby is first recognized via solid cords of epithelial cells invading the surrounding mesenchyme of the UGS around Day 25 p.p. [9]. AR can be immunolocalized to the mesenchyme of the UGS in males at birth and even as early as 1.5 days before birth. In females, UGS mesenchyme is AR positive by Day 0–1 p.p. Thus, AR protein is present in this androgen target tissue well before androgen production occurs in the testes.

Ontogeny of AR in the UGS differs between males and females in that epithelial AR is demonstrable at an earlier age in developing females. In males, the epithelial cells remain AR negative even after differentiation of the prostate has occurred. In adults of both sexes, AR is located in epithelial and smooth muscle cells of the prostate and vagina. This observation suggests that there are similar epithelial/stromal relationships in these organs. The adult-type epithelium may differentiate earlier in females in the absence of androgens as reflected in the earlier appearance of epithelial AR.

Localization of AR in UGS and phallus shows similar patterns of temporal and spatial distribution. Initially AR is located exclusively in the mesenchyme, and only later does it appear in the epithelium. This suggests that mesenchymal signals initiate epithelial morphogenesis indirectly via receptors in mesenchymal tissues [3, 38, 39]. Changes are then induced in the differentiating epithelium probably by the production in the mesenchyme of diffusible growth factors [38, 40, 41]. This model of morphogenesis is consistent with the pattern of AR immunolocalization during development of the UGS and phallus in the tammar.

Immunolocalization of AR demonstrates distribution of the receptor during development but not its functional status. However, there is evidence to support the assumption that immunoreactive AR is functionally competent. There is no evidence that posttranslational modification of the AR is necessary for functionality. Glycosylation of the AR does not occur, and phosphorylation of the AR is not obligatory for hormone binding or receptor transformation [42, 43].

Further support for this comes from the difference in the distribution of immunostaining among the antibodies used to identify AR in tammar tissue. R489 antibody localizes AR in Day 2 male UGS in the cytoplasm of the mesenchyme, whereas the U402 and PG21 antibodies identify receptors in the nuclei. This pattern may indicate the presence of functionally competent AR at this stage of development. Occupied AR are translocated to the nucleus whereas unoccupied receptors are perinuclear in distribution [44, 45]. R489 recognizes the ligand-binding domain of the human AR, and localization using this antibody may represent unoccupied receptors. Conversely, U402 and PG21 may identify occupied (activated) receptors. Thus, functional receptors may be present in the UGS before virilization commences.

Virilization is clearly under androgenic control in the tammar, yet despite the presence of androgens, 5{alpha}-reductase, and the AR, virilization does not begin until 2–3 wk after the establishment of these signals. The nature and molecular mechanism of the initiating signal(s) remain enigmatic.


    ACKNOWLEDGMENTS
 
We thank Dr. Wayne Tilley and Dr. James Aspinal for advice on immunohistochemistry; Bruce Abaloz for help with histology; and David Paul for photography. Animals were held under permit numbers RP-92–099 and RP-95–088 from the Department of Conservation and Natural Resources, Victoria, Australia.


    FOOTNOTES
 
1 This study was supported by grants from the National Health and Medical Research Council of Australia to M.B.R., R.V. Short, and G. Shaw, and from the Australian Research Council and the New Zealand Ministry of Agriculture to D.W.C. Back

2 Correspondence. FAX: 61 3 93447909; cbutler{at}eduserv.its.unimelb.edu.au Back

3 Current address: Australian Proteome Analysis Facility, School of Biological Sciences, Macquarie University, North Ryde, NSW, 2019, Australia. Back

Accepted: April 23, 1998.

Received: November 20, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. George F, Wilson J. Sex Determination and Differentiation. In: Knobil E, Neill J (eds.), The Physiology of Reproduction, vol. 1, 2nd ed. New York: Raven Press, Ltd.; 1994: 3–28.
  2. Wilson J. Syndromes of androgen resistance. Biol Reprod 1992; 46:168–173.[Abstract]
  3. Luke M, Coffey D. The male sex accessory tissues. In: Knobil E, Neill JD (eds.), The Physiology of Reproduction, vol. 1, 2nd ed. New York: Raven Press, Ltd.; 1994: 1435–1487.
  4. Evans R. The steroid and thyroid hormone receptor superfamily. Science 1988; 240:889–895.[Abstract/Free Full Text]
  5. Grino P, Griffin J, Wilson J. Testosterone at high concentrations interacts with the human androgen receptor similarly to dihydrotestosterone. Endocrinology 1990; 126:1165–1172.[Abstract]
  6. O W-S, Short R, Renfree M, Shaw G. Primary genetic control of somatic sexual differentiation in a mammal. Nature 1988; 331:716–717.[CrossRef][Medline]
  7. Renfree M, Short R. Sex determination in marsupials: evidence for a marsupial-eutherian dichotomy. Phil Trans R Soc Lond B 1988; 322:41–53.[Medline]
  8. Renfree M. The role of genes and hormones in marsupial sexual differentiation. J Zool (Lond) 1992; 226:165–173.
  9. Shaw G, Renfree M, Short R, O W-S. Experimental manipulation of sexual differentiation in wallaby pouch young treated with exogenous steroids. Development 1988; 104:689–701.[Abstract/Free Full Text]
  10. Renfree M, Wilson J, Short R, Shaw G, George F. Steroid hormone content of the gonads of the tammar wallaby during sexual differentiation. Biol Reprod 1992; 47:644–647.[Abstract]
  11. Lucas J, Renfree M, Shaw G, Butler C. The influence of the anti-androgen flutamide on early sexual differentiation of the marsupial male. J Reprod Fertil 1997; 109:205–212.[Abstract]
  12. Ryhorchuk A, Shaw G, Butler C, Renfree M. Effects of a 5{alpha}-reductase inhibitor, Finasteride, on the developing prostate and testis of a marsupial. J Androl 1997; 18:123–130.[Abstract/Free Full Text]
  13. Tyndale-Biscoe C, Hinds L. Influence of the immature testis on sexual differentiation in the tammar wallaby, Macropus eugenii (Macropodidae: Marsupialia). Reprod Fertil Dev 1989; 1:243–254.[CrossRef][Medline]
  14. Renfree M, Short R, Shaw G, O W-S. Sexual differentiation of the urogenital system of the fetal and neonatal tammar wallaby, Macropus eugenii. Anat Embryol 1996; 194:111–134.[Medline]
  15. Williamson P, Fletcher TP, Renfree MB. Testicular development and maturation of the hypothalamic-pituitary-testicular axis in the male tammar, Macropus eugenii. J Reprod Fertil 1990; 88:549–557.[Abstract]
  16. Renfree M, Harry J, Shaw G. The marsupial male: a role model for sexual development. Phil Trans R Soc Lond B 1995; 350:243–251.[Medline]
  17. Warren D, Haltmeyer G, Eik-Nes K. Testosterone in the fetal rat testis. Biol Reprod 1973; 8:560–565.[Abstract]
  18. Habert R, Picon R. Testosterone, dihydrotestosterone and estradiol-17ß levels in maternal and fetal plasma and in fetal testes in the rat. J Steroid Biochem 1984; 21:193–198.[CrossRef][Medline]
  19. Price D. Normal development of the prostate and seminal vesicles of the rat with a study of experimental postnatal modifications. Am J Anat 1936; 60:79–128.[CrossRef]
  20. Eusterschulte B, Reisert I, Pilgrim C. Absence of sex differences in size of the genital ducts of the rat prior to embryonic day 15.5–16.0. Tissue Cell 1992; 24:483–489.[CrossRef][Medline]
  21. Lipsett M, Tullner W. Testosterone synthesis by the fetal rabbit gonad. Endocrinology 1965; 77:273–277.[Medline]
  22. Wilson J, Siiteri P. Developmental pattern of testosterone synthesis in the fetal gonad of the rabbit. Endocrinology 1973; 92:1182–1191.[Medline]
  23. Veyssiere G, Berger M, Jean-Faucher C, De Turckheim M, Jean C. Developmental patterns of the testicular response to experimental modifications of circulating androgen levels in the fetal rabbit. Endocrinology 1979; 105:232–236.[Abstract]
  24. Attal J. Levels of testosterone, androstenedione, estrone and estradiol-17ß in the testes of fetal sheep. Endocrinology 1969; 85:280–289.[Medline]
  25. Rigaudiere N. The androgens in the guinea-pig foetus throughout the embryonic development. Acta Endocrinol 1979; 92:174–186.
  26. Siiteri P, Wilson J. Testosterone formation and metabolism during male sexual differentiation in the human embryo. J Clin Endocrinol Metab 1974; 38:113–125.[Medline]
  27. George F, Noble J. Androgen receptors are similar in fetal and adult rabbits. Endocrinology 1984; 115:1451–1458.[Abstract]
  28. George F, Catt K, Neaves W, Wilson J. Studies on the regulation of testosterone synthesis in the fetal rabbit testis. Endocrinology 1978; 102:665–673.[Medline]
  29. Tyndale-Biscoe C, Renfree M. Reproductive Physiology of Marsupials. Cambridge: Cambridge University Press; 1987.
  30. Poole W, Simms N, Wood J, Lubulwa M. Tables for age determination of the Kangaroo Island wallaby (tammar), Macropus eugenii, from body measurements. Canberra: CSIRO, Division of Wildlife and Ecology; 1991: Technical Memorandum: No 32.
  31. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162:156–159.[Medline]
  32. Harry J, Koopman P, Brennan F, Marshall Graves J, Renfree M. Widespread expression of the testis determining gene SRY in a marsupial. Nat Genet 1995; 11:347–349.[CrossRef][Medline]
  33. Husmann D, Wilson C, McPhaul M, Tilley W, Wilson J. Antipeptide antibodies to two distinct regions of the androgen receptor localize the receptor protein to the nuclei of target cells in the rat and human prostate. Endocrinology 1990; 126:2359–2368.[Abstract]
  34. Prins G, Birch L, Greene G. Androgen receptor localization in different cell types of the adult rat prostate. Endocrinology 1991; 129:3187–3199.[Abstract]
  35. Lubahn D, Tan J-A, Quarmby V, Sar M, Joseph D, French F, Wilson E. Structural analysis of the human and rat androgen receptors and expression in male reproductive tract tissues. Ann NY Acad Sci 1989; 564:48–56.[Medline]
  36. Sonea S, Iqbal J, Prins G, Jacobson C. Ontogeny of androgen receptor-like immunoreactivity in the reproductive tract of male Monodelphis domestica. Biol Reprod 1997; 56:852–860.[Abstract]
  37. Bentvelsen FM, McPhaul MJ, Wilson JD, George FW. The androgen receptor of the urogenital tract of the fetal rat is regulated by androgen. Mol Cell Endocrinol 1994; 105:21–26.[CrossRef][Medline]
  38. Chang S-M, Chung L. Interaction between prostatic fibroblast and epithelial cells in culture: role of androgen. Endocrinology 1989; 125:2719–2727.[Abstract]
  39. Cooke P, Young P, Cunha G. Androgen receptor expression in developing male reproductive organs. Endocrinology 1991; 128:2867–2873.[Abstract]
  40. Shima H, Tsuji M, Elfman F, Cunha G. Development of male urogenital epithelia elicited by soluble mesenchymal factors. J Androl 1995; 16:233–241.[Abstract/Free Full Text]
  41. Timme R, Truong L, Merz V, Krebs T, Kadmon D, Flanders K, Park S, Thompson T. Mesenchymal-epithelial interactions and transforming growth factor-ß expression during mouse prostate morphogenesis. Endocrinology 1994; 134:1039–1045.[Abstract]
  42. Kuiper G, de Ruiter P, Grootegoed J, Brinkmann A. Synthesis and post-translational modification of the androgen receptor in LNCaP cells. Mol Cell Endocrinol 1991; 80:65–73.[CrossRef][Medline]
  43. Kuiper G, de Ruiter P, Brinkmann A. Androgen receptor heterogeneity in LNCaP cells is caused by a hormone independent phosphorylation step. J Steroid Biochem Mol Biol 1992; 41:697–700.[CrossRef][Medline]
  44. Wilson E, Simental J, French F, Sar M. Molecular analysis of the androgen receptor. Ann NY Acad Sci 1991; 637:56–63.[Medline]
  45. Simental J, Sar M, Wilson E. Domain functions of the androgen receptor. J Steroid Biochem Mol Biol 1992; 43:37–41.[CrossRef][Medline]



This article has been cited by other articles:


Home page
EndocrinologyHome page
G. Shaw, J. Fenelon, M. Sichlau, R. J. Auchus, J. D. Wilson, and M. B. Renfree
Role of the Alternate Pathway of Dihydrotestosterone Formation in Virilization of the Wolffian Ducts of the Tammar Wallaby, Macropus eugenii
Endocrinology, May 1, 2006; 147(5): 2368 - 2373.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
U. Drews, O. Sulak, and P. A. Schenck
Androgens and the Development of the Vagina
Biol Reprod, October 1, 2002; 67(4): 1353 - 1359.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. D. Wilson, F. W. George, G. Shaw, and M. B. Renfree
Virilization of the Male Pouch Young of the Tammar Wallaby Does Not Appear to be Mediated by Plasma Testosterone or Dihydrotestosterone
Biol Reprod, August 1, 1999; 61(2): 471 - 475.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Butler, C. M.
Right arrow Articles by Renfree, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Butler, C. M.
Right arrow Articles by Renfree, M. B.
Agricola
Right arrow Articles by Butler, C. M.
Right arrow Articles by Renfree, M. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS