|
|
||||||||
a Department of Animal Sciences, University of Missouri, Columbia, Missouri 65211
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Stem cell factor (SCF) is a multipotent, stimulatory growth factor expressed by the corpus luteum [11]. Upon interaction with its receptor (c-kit), SCF stimulates cellular migration, proliferation, and differentiation [1213] and survival of responsive cells [1418]. Although SCF is best known for its effects on hematopoietic stem cells [12, 13], it is essential for normal gonadal development. Inactivation by mutation of either SCF or c-kit impairs colonization of the gonad by primordial germ cells as well as subsequent germ cell proliferation and differentiation [19]. A growing body of evidence indicates that SCF may be an important regulator of normal reproductive function in postnatal life as well. Both SCF [20] and c-kit [21, 22] have been identified in the adult mouse ovary, and exogenous SCF stimulated growth of oocytes cultured in the presence of ovarian follicular cells [23]. In addition, steroid production by follicles was impaired in SCF mutant mice [24], in which follicles did not develop more than a single layer of granulosa cells [2426].
As a member of the platelet-derived growth factor/colony-stimulating factor-1 receptor family [27], the SCF receptor is a transmembrane tyrosine kinase receptor; c-kit is a glycosylated protein between 124 and 160 kDa [28, 29] and is the normal cellular homologue of v-kit, the acute transforming feline leukemia virus [30]. As with related tyrosine kinase receptors, ligand binding to c-kit induces receptor dimerization [31] and activation of the kinase domain [32].
Previous data [11] indicated that SCF was expressed by the ovine corpus luteum throughout the luteal phase and that it was expressed by steroidogenic luteal cells. Local action of SCF requires that c-kit must also be expressed. Furthermore, identification of the specific cell types that express c-kit is essential. Given the expression of SCF in the corpus luteum and the importance of localizing its receptor in the corpus luteum, the objectives of the present study were to 1) determine whether c-kit is expressed by the ovine corpus luteum, 2) characterize the temporal pattern of its expression in corpora lutea collected throughout the luteal phase, and 3) localize expression of c-kit mRNA within corpora lutea collected both early and late in the luteal phase.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Chemical reagents, unless specified otherwise, were obtained from Fisher Scientific (St. Louis, MO). Likewise, unless otherwise specified, enzymes were purchased from Stratagene (La Jolla, CA). Radionuclides were obtained from New England Nuclear (Wilmington, DE) and autoradiographic film, developers, and emulsion from Eastman Kodak (Rochester, NY).
Tissue Collection
Studies were conducted according to protocol no. 2328, approved by the University of Missouri Animal Care and Use Committee. For characterization of c-kit expression during the estrous cycle, ewes were ovariectomized on Days 3, 7, 10, 13, and 16 of the estrous cycle (Day 0 = estrus; n = 45 per day) and individual corpora lutea were removed and decapsulated. For total cellular (tc) RNA isolation, tissue was homogenized immediately in 4 M guanidine thiocyanate, 1% ß-mercaptoethanol (GTC/ßME) and stored at -80°C until tcRNA was isolated on cesium chloride gradients ([33]; storage time 26 wk before isolation). For in situ hybridization, ovarian blocks containing both stromal and luteal tissue were snap frozen in mounting medium over liquid nitrogen vapor before storage at -80°C.
Molecular Cloning
A portion (558 base pairs [bp]) of the transmembrane domain of ovine c-kit cDNA was amplified from 1 µl of a Day 10 ovine luteal amplified cDNA library (synthesized for this laboratory by Clontech, Palo Alto, CA) by the polymerase chain reaction (PCR; Perkin Elmer Cetus, Norwalk, CT). Primers were selected based on conserved sequences within human, mouse, and rat c-kit and were designed to minimize amplification of related tyrosine kinase receptors. Primer sequences were 5' primer5'GGAGATCTGTGAGAATAGGCTC3'; 3' primer5'TTAGCTGAACAATTTGCTT3'. Conditions of PCR reactions were as follows: 94°C, 1 min; 48°C, 1 min; 72°C, 1 min; 40 cycles. The resulting PCR product was ligated into pCRII vector (Invitrogen, San Diego, CA) and transformed into INVF
' Escherichia coli (Stratagene, La Jolla, CA), and both strands were completely sequenced using Sequenase II (U.S. Biochemical, Cleveland, OH).
For quantitation of c-kit mRNA by RNase protection assay, a cDNA encoding a portion (632 bp, corresponding to the region spanning bases 16648 of human c-kit) of the ligand-binding domain of c-kit (KLB) was amplified by reverse transcriptase (RT)-PCR from Day 10 luteal RNA. Conditions for RT reactions were 42°C, 60 min; 5°C for a minimum of 5 min. Conditions for PCR reactions were as described above, and primer sequences were as follows: 5' primer5'ACCGCGATGAGAGGCGCT3'; 3' primer5'TTGATGGCTGCCCGCACTTT3'. The resulting PCR product was ligated into pCRII, transformed into INV
F' E. coli, and sequenced to verify identity of the cDNA.
Northern Analysis
Size and number of c-kit mRNA species expressed by the ovine corpus luteum throughout the luteal phase were determined by Northern analysis. Ten micrograms tcRNA isolated from single corpora lutea collected on Days 3, 7, 10, 13, and 16 was separated by electrophoresis through an agarose-formaldehyde gel and capillary transferred to a nylon membrane [34]. The membrane was prehybridized overnight at 42°C in hybridization buffer comprised as follows: 50% formamide, 5-strength Denhardt's (single-strength = 0.02% w:v Ficoll, 0.2% w:v polyvinylpyrrolidone, 0.02% w:v BSA [all from Sigma Chemical Co., St. Louis, MO]), 5-strength SSC (single-strength SSC = 0.15 M NaCl, 0.015 M trisodium citrate), 50 mM sodium phosphate, 0.5% SDS, 150 µg/ml sheared herring sperm DNA (Boehringer-Mannheim, Indianapolis, IN), and 50 µg/ml yeast tRNA (Boehringer-Mannheim). The KLB cDNA was random-prime labeled (Amersham, Arlington Heights, IL) to a specific activity of approximately 5 x 108 cpm/µg DNA with [
-32P]dCTP. Hybridization was conducted at 42°C for 16 h in fresh hybridization buffer. The membrane was subsequently washed twice at 42°C with double-strength SSC, 0.5% SDS for 30 min each and once at 65°C with 0.1-strength SSC, 0.5% SDS for 20 min; it was then exposed to Kodak XAR film at -80°C for 7 days.
RNase Protection Assays
Expression of c-kit mRNA was quantified in tcRNA from luteal tissue collected on Days 3, 7, 10, 13, and 16 of the estrous cycle (n = 4, 4, 5, 4, and 4 animals per group, respectively) by RNase protection assay (RPAII kit; Ambion, Austin, TX). All samples were run in duplicate.
To normalize loading differences across samples, a 280-bp fragment of ovine glyceraldehyde-3-phosphate dehydrogenase (G3PDH) was selected as an internal control. Constancy of G3PDH expression in all animals and at all times was verified by dot-blot analysis and RNase protection assay; values did not differ among animals or across days (p > 0.10; data not shown). Both G3PDH and c-kit cRNA probes were included in each sample.
Briefly, KLB or transmembrane domain cRNA probes were synthesized with an in vitro transcription kit (Stratagene, La Jolla, CA) according to manufacturer directions with the following exceptions: 1) For KLB cRNA probes, 120 µCi [
-32P]CTP (3000 Ci/mmol) was added, and 2) due to the high level of G3PDH expression relative to c-kit, it was necessary to reduce the specific activity of the G3PDH cRNA probe by decreasing the level of [
-32P]CTP to 62.5 µCi/reaction and readjusting the final concentration of CTP in the reaction to 200 µM with unlabeled CTP. The labeling reaction proceeded at 37°C for 1 h; template was digested with RNase-free DNase for 15 min. After the labeling reaction, probes were gel-purified on an 8 M urea:5% acrylamide gel. The gel was briefly exposed to XRP film, and the bands corresponding to the transcript of appropriate size were excised and placed in elution buffer (Ambion, Austin, TX) overnight at 42°C. As determined by trichloroacetic acid precipitation, specific activities of the KLB and G3PDH probes were approximately 7.8 x 108 and 1.1 x 108 cpm/µg, respectively.
Fifteen micrograms of tcRNA was coprecipitated with approximately 105 cpm of each probe and resuspended in hybridization buffer, denatured at 95°C for 34 min, and allowed to incubate overnight at 44°C. In addition to sample tubes, two control tubes containing 15 µg yeast RNA were included in each assay. At the RNase digestion step, one served as a negative control and was incubated with RNase to verify complete digestion of single-stranded (unhybridized) probe. The other control tube was not exposed to RNase digestion in order to verify length of the undigested probe.
After hybridization, single-stranded RNA was digested with RNase A/T1 (10 µg/ml RNAse A and 200 U/ml RNAse T1, respectively) in RNase digestion buffer for 30 min at 37°C. To stop the reaction, samples were precipitated, resuspended in gel loading buffer (Ambion), and denatured at 95°C. Protected fragments were separated on 8 M urea:5% acrylamide gels. Urea was removed from the gels by washing twice for 20 min each in 20% methanol, 10% glacial acetic acid before drying for 2 h at 80°C. Gels were then exposed to XAR film for 24 h, and density of G3PDH and c-kit bands was quantified by densitometric analysis. All samples were measured in a single assay.
In Situ Hybridization
Messenger RNA for c-kit was localized in luteal tissue from ovaries collected on Days 3 and 14 of the estrous cycle (n = 4 each) as described by Smith et al. [35]. Sense and antisense c-kit [35S]UTP-labeled KLB cRNA probes were generated by in vitro transcription, with unincorporated nucleotides removed on a G50 Sephadex spin column.
Hybridizations were carried out on serial sections (14 µm) of cryopreserved luteal tissue mounted on positively charged slides. After fixation in 4% formalin, acetylation, and dehydration, sections were incubated with 1 x 106 cpm probe in 20 µl hybridization buffer (40% formamide, 10% dextran sulfate, single-strength Denhardt's solution, 4-strength SSC, 50 mM dithiothreitol, 1 mg/ml yeast tRNA, 1 mg/ml sheared herring sperm DNA). Sections were covered with parafilm and incubated overnight at 50°C in a humidified chamber. After hybridization, slides were washed twice in 50% formamide, double-strength SSC at 52°C (5 min, then 20 min) and twice in double-strength SSC at 25°C for 1 min each. To remove unhybridized probe, samples were digested with 100 µg/ml RNase A in double-strength SSC at 25°C for 30 min and washed three times. Slides were washed first in single-strength SSC, 10 mM ßME for 15 min at 25°C; second in 0.5-strength SSC, 10 mM ßME at 25°C for 15 min; and third in 0.1-strength SSC, 10 mM ßME for 30 min at 37°C. Slides were dehydrated, dried, and subsequently dipped in NTB-3 emulsion and exposed at 4°C for 10 days, developed with Dektol developer, and counterstained with hematoxylin and eosin.
Statistical Analysis
As stated above, G3PDH was used as an internal standard; therefore, all c-kit values from RNase protection assays were expressed as a ratio of c-kit:G3PDH densitometric units. Data were analyzed as a completely randomized design using General Linear Models procedures of the Statistical Analysis System [36], with day of cycle as the main effect. Ratio data were normalized by arcsin transformation; however, results of analysis of transformed values were similar to those for untransformed values, and therefore untransformed values are presented.
| RESULTS |
|---|
|
|
|---|
A partial cDNA encoding ovine c-kit was amplified from a Day 10 corpus luteum cDNA library and was found, as expected, to encode a portion of the transmembrane domain of the tyrosine kinase receptor, c-kit. Sequence identity of this cDNA with sequences reported for other, nonruminant species was 90.5%, 86%, and 81% for humans [30], mice [37, 38], and the v-kit oncogene [27], respectively. In contrast, sequence identity of the ovine c-kit cDNA with that reported for bovine c-kit was 62% [39]. Sequence identity with the related tyrosine kinase receptors colony-stimulating factor-1 receptor, platelet-derived growth factor, and fibroblast growth factor receptor ranged from 62% to 68%. Sequence identity of the cDNA encoding the ligand-binding domain (KLB) with c-kit of other species and related tyrosine kinases was similar to that of the transmembrane domain.
Expression of c-kit in Luteal Tissue
To determine whether c-kit mRNA was expressed by luteal tissue in measurable quantities, the 558-bp c-kit cDNA was used in an RNase protection assay of Day 10 tcRNA. Intensity of the protected fragments increased with increasing mass of RNA added (Fig. 1A). However, the region of c-kit encoded by the 558-bp ovine cDNA is the region of highest sequence homology among this family of tyrosine kinase receptors. Also, there are reports of truncated c-kit mRNA species in the testis [40, 41], one of which has been shown to encode a receptor lacking the ligand-binding domain [41]. Therefore, to verify expression of a functional c-kit mRNA, a second c-kit cDNA corresponding to bases 16648 of human c-kit was generated by RT-PCR, subcloned, and subsequently used in RNase protection assays. Sequence analysis of the ligand-binding domain of ovine c-kit was similar to that for the transmembrane fragment. Intensity of protected fragments increased with increasing mass of RNA added (Fig. 1B). In corpora lutea collected throughout the luteal phase, Northern analysis (Fig. 2) of c-kit mRNA revealed two major transcripts of ~5.1 kilobases (kb) and 2.3 kb.
|
|
Quantification of c-kit mRNA
As determined by RNase protection analysis (Fig. 3A), c-kit mRNA levels were low early in the luteal phase, increased to maximum values by Day 13 (p < 0.05), and decreased on Day 16 (p < 0.05).
|
Localization of c-kit
In situ hybridization was employed to localize expression of c-kit mRNA within sections of luteal tissue collected on Days 3 and 14 of the estrous cycle. An antisense 35S-labeled c-kit riboprobe hybridized specifically within luteal tissue on both Day 3 (Fig. 4B) and 14 (Fig. 4E). Intensity of hybridization was low in sections of corpora lutea collected on Day 3, in agreement with results from RNase protection assays. On Day 14, the c-kit probe hybridized in a highly cell-specific pattern. Hybridization was markedly absent from large luteal cells but was present in surrounding small luteal cells and endothelial cells (Fig. 4, G and H). On both days examined, hybridization of the antisense probe to stromal tissue did not appear to be above background levels when compared to negative control sections hybridized with a sense 35S-labeled c-kit riboprobe (Fig. 4, C, F, and I).
|
| DISCUSSION |
|---|
|
|
|---|
Complementary DNAs encoding two different regions of ovine c-kit were isolated from corpora lutea. Sequence analysis of the cDNA encoding the transmembrane domain revealed high sequence identity with known sequences from other species as well as marked identity with related tyrosine kinase receptors. Likewise, the cDNA encoding the ligand-binding domain bore high sequence identity with known c-kit sequences. With only one exception, ovine luteal c-kit likely is not markedly different from c-kit molecules in other species or tissues. Surprisingly, when compared with a bovine c-kit cDNA sequence published by Kubota et al. [39], both ovine c-kit cDNAs demonstrated only 6062% sequence identity. Given the high identity of ovine c-kit with other species and the single exception of the bovine c-kit to the general agreement among species, it may be that the sequence published by Kubota et al. [39] is not c-kit.
The probe directed against the c-kit ligand-binding domain was used for c-kit mRNA quantification for the following reasons. First, although initial analysis of luteal c-kit expression with the probe encoding the transmembrane domain generated only one protected fragment in RNase protection assays (Fig. 4A), this region of c-kit bears high sequence homology to other members of the tyrosine kinase receptor family and, though unlikely, this probe could potentially detect other tyrosine kinase receptors. Second, we wished to quantify mRNA encoding a functional receptor; on the basis of the report [42] of a truncated c-kit transcript lacking the ligand-binding domain, it was essential to minimize the chances of detecting mRNAs encoding nonfunctional receptors.
There is variation in c-kit transcript size among species and tissues. In mouse and human tissues, c-kit was expressed as a single transcript of approximately 5 kb [30, 37, 38]. In two hematopoietic cell lines, an alternatively spliced variant lacking four amino acids has been reported [43]. In testes, multiple transcripts ranging in size from 2.3 to 12 kb [40, 41, 44] have been reported. The predominant transcript in most tissues and species is approximately 5 kb, and predicted amino acid sequences of reported 5-kb cDNAs indicate that this species encodes the functional receptor. A 3.2-kb c-kit cDNA obtained from testes by Rossi et al. [41] encodes a truncated c-kit receptor that, if translated, would lack the transmembrane and ligand-binding domains. In the present study, Northern analysis of ovine luteal c-kit indicated that two transcripts of approximately 5.1 and 2.3 kb were expressed. While the 5.1-kb transcript presumably encodes the functional receptor, the nature of the 2.3-kb transcript has not been determined. Northern analysis is not sufficiently sensitive to detect variants lacking only small portions of the receptor, and the probe used in RNase protection assays was not generated against the region known to contain the small deletions in the intracellular domain reported by Vandenbark et al. [43]; therefore it is not known whether these variants are expressed by luteal tissue.
Previous data [11] indicated that luteal SCF mRNA levels remained constant throughout the luteal phase. This raised the possibility that regulation of SCF action in the corpus luteum may be at the level of receptor expression. In the present study, c-kit mRNA expression was low early in the luteal phase, increased by midluteal phase, and decreased by Day 16. On the basis of known effects of SCF on cellular differentiation, proliferation, and migration [12], the low levels of expression observed early in the luteal phase were unexpected. After ovulation, cells of the developing corpus luteum are proliferating at a rate comparable to that of fastest growing tumors [45]. Furthermore, follicular cells differentiate into luteal cells and migrate during luteal development [46]. Since c-kit expression was not elevated at this stage, SCF is not likely a primary factor directing cellular proliferation, migration, and differentiation occurring at this time. Alternatively, the low levels of c-kit mRNA expression observed within corpora lutea collected early in the luteal phase may indicate that the number of cells within the population that express c-kit at this time is low. Localization of c-kit mRNA by in situ hybridization on Day 3 indicated that c-kit mRNA was expressed at low levels throughout the corpus luteum, with areas of more intense hybridization at the periphery of luteal tissue. We were unable to discern the specific cell types that expressed c-kit mRNA on Day 3. Given the low level of c-kit expression on Day 3, it appears that SCF is not a primary regulator at this time.
Expression of luteal c-kit increased during the luteal phase, reaching a maximum expression on Day 13. This pattern of expression parallels the functional maturation of the corpus luteum, including the increase in progesterone secretion [47], expression of LH receptor mRNA [48], and the increase in numbers of small luteal cells, fibroblasts, and endothelial cells within luteal tissue [49]. Within the mouse ovary, SCF is essential for follicular maturation and steroidogenesis [24]. As such, c-kit may play a role in the continued maturation of luteal tissue that occurs during its life span. The increase in c-kit expression between Days 3 and 13 may be due to the increase in cell number, or may be indicative of temporal regulation of c-kit.
Likewise, the differential expression of c-kit observed within small versus large luteal cells raises the possibility of intercellular communication between these two cell types, as well as possible autocrine effects within small luteal cells, which we have shown to express SCF. In addition to interactions between small and large luteal cells, SCF likely influences luteal endothelial cells. Observation of c-kit mRNA within luteal endothelial cells is consistent with reports from other systems [50, 51]. However, the role of SCF in endothelial cell function is unclear. This cell population has been reported to express c-kit [50, 51], SCF [52], and in some cases, SCF and c-kit [53].
Lastly, c-kit may be involved in differentiation of luteal stem cells. This population, first proposed by Niswender et al. [54], would differentiate into steroidogenic cells and could explain the increase in number of small luteal cells that occurs between Days 3 and 14 [49] and the observation of luteal cells with morphological characteristics intermediate between those of fibroblasts and small luteal cells [55]. At this time we can neither confirm nor deny expression of c-kit in fibroblasts. Fibroblasts are commonly associated with supportive roles. Classically, fibroblasts express SCF and promote differentiation and survival of hematopoietic precursors [56] and mast cells [57, 58]. Fibroblasts are also considered to be an undifferentiated cell species that can be recruited into the functional cell population, as presumably occurs during thecal cell differentiation [55]. SCF has been shown to stimulate differentiation of canine bone marrow fibroblasts into cells with characteristics of hematopoietic precursors [59]. SCF is expressed in granulosa cells [20], the precursor of large luteal cells [47], and large luteal cells [11]. Expression of c-kit could provide a mechanism by which luteal fibroblasts could acquire steroidogenic capability. Both large and small luteal cells express SCF and could therefore recruit potential stem cells.
In combination, the results of the present study and those of our previous study indicate that SCF produced by the corpus luteum could act locally on cells expressing its receptor, c-kit. Further studies examining expression by luteal fibroblasts are necessary to determine whether this growth factor acts on these cells, as well as studies designed to assess the precise biological role within the corpus luteum.
| FOOTNOTES |
|---|
2 Correspondence: Michael F. Smith, Department of Animal Sciences, 160 Animal Sciences Research Center, Columbia, MO 65211. FAX: 573 882 6827; smithmf{at}missouri.edu ![]()
3 Current address: Department of Animal Science, University of Arizona, Tucson, AZ 85724. ![]()
4 Current address: Department of Animal Science, Michigan State University, East Lansing, MI 48824. ![]()
Accepted: June 9, 1998.
Received: August 12, 1996.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. Spanel-Borowski, K. Sass, S. Loffler, E. Brylla, M. Sakurai, and A. M Ricken KIT receptor-positive cells in the bovine corpus luteum are primarily theca-derived small luteal cells Reproduction, October 1, 2007; 134(4): 625 - 634. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Sleer and C. C. Taylor Platelet-Derived Growth Factors and Receptors in the Rat Corpus Luteum: Localization and Identification of an Effect on Luteogenesis Biol Reprod, March 1, 2007; 76(3): 391 - 400. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Eckery, S. B. Lawrence, J. L. Juengel, P. Greenwood, K. P. McNatty, and A. E. Fidler Gene Expression of the Tyrosine Kinase Receptor c-kit During Ovarian Development in the Brushtail Possum (Trichosurus vulpecula) Biol Reprod, February 1, 2002; 66(2): 346 - 353. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Juengel, L. D. Quirke, D. J. Tisdall, P. Smith, N. L. Hudson, and K. P. McNatty Gene Expression in Abnormal Ovarian Structures of Ewes Homozygous for the Inverdale Prolificacy Gene Biol Reprod, June 1, 2000; 62(6): 1467 - 1478. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |