Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gentry, P. C.
Right arrow Articles by Smith, M. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gentry, P. C.
Right arrow Articles by Smith, M. F.
Agricola
Right arrow Articles by Gentry, P. C.
Right arrow Articles by Smith, M. F.
Biology of Reproduction 59, 983-990 (1998)
©Copyright 1998 Society for the Study of Reproduction, Inc.

Ontogeny of Stem Cell Factor Receptor (c-kit) Messenger Ribonucleic Acid in the Ovine Corpus Luteum1

Paula C. Gentry3,a, George W. Smith4,a, David R. Leighra, Bagna Baoa, , and Michael F. Smith2,a

a Department of Animal Sciences, University of Missouri, Columbia, Missouri 65211


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Stem cell factor (SCF) is a pleiotropic growth factor that is expressed by the ovine corpus luteum throughout its life span by both small and large steroidogenic cells. Determination of the action of SCF, however, requires localization of its receptor, c-kit; therefore, the objectives of the present study were to identify and localize c-kit within corpora lutea. Two cDNAs encoding different portions of the c-kit molecule were amplified by the polymerase chain reaction. The first was a 558-base pair (bp) cDNA encoding portions of the transmembrane and tyrosine kinase domains; the second was a 632-bp cDNA encoding most of the ligand-binding domain. Expression of c-kit was quantified by RNase protection assay of total cellular RNA collected on Days 3, 7, 10, 13, and 16 (n = 4, 4, 5, 4, and 4 per group, respectively) of the estrous cycle (Day 0 = estrus). The level of c-kit mRNA was low early in the luteal phase, reached (p < 0.05) maximum levels on Day 13, and then decreased (p < 0.01) on Day 16. On Day 3 (n = 4), c-kit was expressed in a cell-specific manner throughout the corpus luteum; identity of the specific cell types expressing c-kit could not be determined at this stage. On Day 14 (n = 4), c-kit did not appear to be expressed within large luteal cells but was prominently expressed in cells that surrounded large luteal cells and that possessed the morphological characteristics of small luteal cells and endothelial cells. Given the temporal regulation of c-kit expression within the corpus luteum, these data suggest that luteal SCF may act locally.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although pituitary hormones are believed to be essential for initiation of the morphological and biochemical transformations characteristic of luteinization as well as subsequent function of the ruminant corpus luteum, an increasing body of evidence indicates that factors acting at the local level may also be important in regulation of luteal life span and function. Peptide growth factors, which are receiving increased attention, may help regulate such processes as mitosis, angiogenesis, luteinization, and steroidogenesis [1]. For example, insulin-like growth factor-I has been shown to stimulate progesterone production [26]. Epidermal growth factor appears to modulate the response of luteal cells to pituitary gonadotropins [7, 8]. Lastly, basic fibroblast growth factor [9] and vascular endothelial growth factor [10] regulate luteal angiogenesis.

Stem cell factor (SCF) is a multipotent, stimulatory growth factor expressed by the corpus luteum [11]. Upon interaction with its receptor (c-kit), SCF stimulates cellular migration, proliferation, and differentiation [1213] and survival of responsive cells [1418]. Although SCF is best known for its effects on hematopoietic stem cells [12, 13], it is essential for normal gonadal development. Inactivation by mutation of either SCF or c-kit impairs colonization of the gonad by primordial germ cells as well as subsequent germ cell proliferation and differentiation [19]. A growing body of evidence indicates that SCF may be an important regulator of normal reproductive function in postnatal life as well. Both SCF [20] and c-kit [21, 22] have been identified in the adult mouse ovary, and exogenous SCF stimulated growth of oocytes cultured in the presence of ovarian follicular cells [23]. In addition, steroid production by follicles was impaired in SCF mutant mice [24], in which follicles did not develop more than a single layer of granulosa cells [2426].

As a member of the platelet-derived growth factor/colony-stimulating factor-1 receptor family [27], the SCF receptor is a transmembrane tyrosine kinase receptor; c-kit is a glycosylated protein between 124 and 160 kDa [28, 29] and is the normal cellular homologue of v-kit, the acute transforming feline leukemia virus [30]. As with related tyrosine kinase receptors, ligand binding to c-kit induces receptor dimerization [31] and activation of the kinase domain [32].

Previous data [11] indicated that SCF was expressed by the ovine corpus luteum throughout the luteal phase and that it was expressed by steroidogenic luteal cells. Local action of SCF requires that c-kit must also be expressed. Furthermore, identification of the specific cell types that express c-kit is essential. Given the expression of SCF in the corpus luteum and the importance of localizing its receptor in the corpus luteum, the objectives of the present study were to 1) determine whether c-kit is expressed by the ovine corpus luteum, 2) characterize the temporal pattern of its expression in corpora lutea collected throughout the luteal phase, and 3) localize expression of c-kit mRNA within corpora lutea collected both early and late in the luteal phase.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Materials

Chemical reagents, unless specified otherwise, were obtained from Fisher Scientific (St. Louis, MO). Likewise, unless otherwise specified, enzymes were purchased from Stratagene (La Jolla, CA). Radionuclides were obtained from New England Nuclear (Wilmington, DE) and autoradiographic film, developers, and emulsion from Eastman Kodak (Rochester, NY).

Tissue Collection

Studies were conducted according to protocol no. 2328, approved by the University of Missouri Animal Care and Use Committee. For characterization of c-kit expression during the estrous cycle, ewes were ovariectomized on Days 3, 7, 10, 13, and 16 of the estrous cycle (Day 0 = estrus; n = 4–5 per day) and individual corpora lutea were removed and decapsulated. For total cellular (tc) RNA isolation, tissue was homogenized immediately in 4 M guanidine thiocyanate, 1% ß-mercaptoethanol (GTC/ßME) and stored at -80°C until tcRNA was isolated on cesium chloride gradients ([33]; storage time 2–6 wk before isolation). For in situ hybridization, ovarian blocks containing both stromal and luteal tissue were snap frozen in mounting medium over liquid nitrogen vapor before storage at -80°C.

Molecular Cloning

A portion (558 base pairs [bp]) of the transmembrane domain of ovine c-kit cDNA was amplified from 1 µl of a Day 10 ovine luteal amplified cDNA library (synthesized for this laboratory by Clontech, Palo Alto, CA) by the polymerase chain reaction (PCR; Perkin Elmer Cetus, Norwalk, CT). Primers were selected based on conserved sequences within human, mouse, and rat c-kit and were designed to minimize amplification of related tyrosine kinase receptors. Primer sequences were 5' primer—5'GGAGATCTGTGAGAATAGGCTC3'; 3' primer—5'TTAGCTGAACAATTTGCTT3'. Conditions of PCR reactions were as follows: 94°C, 1 min; 48°C, 1 min; 72°C, 1 min; 40 cycles. The resulting PCR product was ligated into pCRII vector (Invitrogen, San Diego, CA) and transformed into INVF{alpha}' Escherichia coli (Stratagene, La Jolla, CA), and both strands were completely sequenced using Sequenase II (U.S. Biochemical, Cleveland, OH).

For quantitation of c-kit mRNA by RNase protection assay, a cDNA encoding a portion (632 bp, corresponding to the region spanning bases 16–648 of human c-kit) of the ligand-binding domain of c-kit (KLB) was amplified by reverse transcriptase (RT)-PCR from Day 10 luteal RNA. Conditions for RT reactions were 42°C, 60 min; 5°C for a minimum of 5 min. Conditions for PCR reactions were as described above, and primer sequences were as follows: 5' primer—5'ACCGCGATGAGAGGCGCT3'; 3' primer—5'TTGATGGCTGCCCGCACTTT3'. The resulting PCR product was ligated into pCRII, transformed into INV{alpha}F' E. coli, and sequenced to verify identity of the cDNA.

Northern Analysis

Size and number of c-kit mRNA species expressed by the ovine corpus luteum throughout the luteal phase were determined by Northern analysis. Ten micrograms tcRNA isolated from single corpora lutea collected on Days 3, 7, 10, 13, and 16 was separated by electrophoresis through an agarose-formaldehyde gel and capillary transferred to a nylon membrane [34]. The membrane was prehybridized overnight at 42°C in hybridization buffer comprised as follows: 50% formamide, 5-strength Denhardt's (single-strength = 0.02% w:v Ficoll, 0.2% w:v polyvinylpyrrolidone, 0.02% w:v BSA [all from Sigma Chemical Co., St. Louis, MO]), 5-strength SSC (single-strength SSC = 0.15 M NaCl, 0.015 M trisodium citrate), 50 mM sodium phosphate, 0.5% SDS, 150 µg/ml sheared herring sperm DNA (Boehringer-Mannheim, Indianapolis, IN), and 50 µg/ml yeast tRNA (Boehringer-Mannheim). The KLB cDNA was random-prime labeled (Amersham, Arlington Heights, IL) to a specific activity of approximately 5 x 108 cpm/µg DNA with [{alpha}-32P]dCTP. Hybridization was conducted at 42°C for 16 h in fresh hybridization buffer. The membrane was subsequently washed twice at 42°C with double-strength SSC, 0.5% SDS for 30 min each and once at 65°C with 0.1-strength SSC, 0.5% SDS for 20 min; it was then exposed to Kodak XAR film at -80°C for 7 days.

RNase Protection Assays

Expression of c-kit mRNA was quantified in tcRNA from luteal tissue collected on Days 3, 7, 10, 13, and 16 of the estrous cycle (n = 4, 4, 5, 4, and 4 animals per group, respectively) by RNase protection assay (RPAII kit; Ambion, Austin, TX). All samples were run in duplicate.

To normalize loading differences across samples, a 280-bp fragment of ovine glyceraldehyde-3-phosphate dehydrogenase (G3PDH) was selected as an internal control. Constancy of G3PDH expression in all animals and at all times was verified by dot-blot analysis and RNase protection assay; values did not differ among animals or across days (p > 0.10; data not shown). Both G3PDH and c-kit cRNA probes were included in each sample.

Briefly, KLB or transmembrane domain cRNA probes were synthesized with an in vitro transcription kit (Stratagene, La Jolla, CA) according to manufacturer directions with the following exceptions: 1) For KLB cRNA probes, 120 µCi [{alpha}-32P]CTP (3000 Ci/mmol) was added, and 2) due to the high level of G3PDH expression relative to c-kit, it was necessary to reduce the specific activity of the G3PDH cRNA probe by decreasing the level of [{alpha}-32P]CTP to 62.5 µCi/reaction and readjusting the final concentration of CTP in the reaction to 200 µM with unlabeled CTP. The labeling reaction proceeded at 37°C for 1 h; template was digested with RNase-free DNase for 15 min. After the labeling reaction, probes were gel-purified on an 8 M urea:5% acrylamide gel. The gel was briefly exposed to XRP film, and the bands corresponding to the transcript of appropriate size were excised and placed in elution buffer (Ambion, Austin, TX) overnight at 42°C. As determined by trichloroacetic acid precipitation, specific activities of the KLB and G3PDH probes were approximately 7.8 x 108 and 1.1 x 108 cpm/µg, respectively.

Fifteen micrograms of tcRNA was coprecipitated with approximately 105 cpm of each probe and resuspended in hybridization buffer, denatured at 95°C for 3–4 min, and allowed to incubate overnight at 44°C. In addition to sample tubes, two control tubes containing 15 µg yeast RNA were included in each assay. At the RNase digestion step, one served as a negative control and was incubated with RNase to verify complete digestion of single-stranded (unhybridized) probe. The other control tube was not exposed to RNase digestion in order to verify length of the undigested probe.

After hybridization, single-stranded RNA was digested with RNase A/T1 (10 µg/ml RNAse A and 200 U/ml RNAse T1, respectively) in RNase digestion buffer for 30 min at 37°C. To stop the reaction, samples were precipitated, resuspended in gel loading buffer (Ambion), and denatured at 95°C. Protected fragments were separated on 8 M urea:5% acrylamide gels. Urea was removed from the gels by washing twice for 20 min each in 20% methanol, 10% glacial acetic acid before drying for 2 h at 80°C. Gels were then exposed to XAR film for 24 h, and density of G3PDH and c-kit bands was quantified by densitometric analysis. All samples were measured in a single assay.

In Situ Hybridization

Messenger RNA for c-kit was localized in luteal tissue from ovaries collected on Days 3 and 14 of the estrous cycle (n = 4 each) as described by Smith et al. [35]. Sense and antisense c-kit [35S]UTP-labeled KLB cRNA probes were generated by in vitro transcription, with unincorporated nucleotides removed on a G50 Sephadex spin column.

Hybridizations were carried out on serial sections (14 µm) of cryopreserved luteal tissue mounted on positively charged slides. After fixation in 4% formalin, acetylation, and dehydration, sections were incubated with 1 x 106 cpm probe in 20 µl hybridization buffer (40% formamide, 10% dextran sulfate, single-strength Denhardt's solution, 4-strength SSC, 50 mM dithiothreitol, 1 mg/ml yeast tRNA, 1 mg/ml sheared herring sperm DNA). Sections were covered with parafilm and incubated overnight at 50°C in a humidified chamber. After hybridization, slides were washed twice in 50% formamide, double-strength SSC at 52°C (5 min, then 20 min) and twice in double-strength SSC at 25°C for 1 min each. To remove unhybridized probe, samples were digested with 100 µg/ml RNase A in double-strength SSC at 25°C for 30 min and washed three times. Slides were washed first in single-strength SSC, 10 mM ßME for 15 min at 25°C; second in 0.5-strength SSC, 10 mM ßME at 25°C for 15 min; and third in 0.1-strength SSC, 10 mM ßME for 30 min at 37°C. Slides were dehydrated, dried, and subsequently dipped in NTB-3 emulsion and exposed at 4°C for 10 days, developed with Dektol developer, and counterstained with hematoxylin and eosin.

Statistical Analysis

As stated above, G3PDH was used as an internal standard; therefore, all c-kit values from RNase protection assays were expressed as a ratio of c-kit:G3PDH densitometric units. Data were analyzed as a completely randomized design using General Linear Models procedures of the Statistical Analysis System [36], with day of cycle as the main effect. Ratio data were normalized by arcsin transformation; however, results of analysis of transformed values were similar to those for untransformed values, and therefore untransformed values are presented.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning and Sequencing of c-kit

A partial cDNA encoding ovine c-kit was amplified from a Day 10 corpus luteum cDNA library and was found, as expected, to encode a portion of the transmembrane domain of the tyrosine kinase receptor, c-kit. Sequence identity of this cDNA with sequences reported for other, nonruminant species was 90.5%, 86%, and 81% for humans [30], mice [37, 38], and the v-kit oncogene [27], respectively. In contrast, sequence identity of the ovine c-kit cDNA with that reported for bovine c-kit was 62% [39]. Sequence identity with the related tyrosine kinase receptors colony-stimulating factor-1 receptor, platelet-derived growth factor, and fibroblast growth factor receptor ranged from 62% to 68%. Sequence identity of the cDNA encoding the ligand-binding domain (KLB) with c-kit of other species and related tyrosine kinases was similar to that of the transmembrane domain.

Expression of c-kit in Luteal Tissue

To determine whether c-kit mRNA was expressed by luteal tissue in measurable quantities, the 558-bp c-kit cDNA was used in an RNase protection assay of Day 10 tcRNA. Intensity of the protected fragments increased with increasing mass of RNA added (Fig. 1A). However, the region of c-kit encoded by the 558-bp ovine cDNA is the region of highest sequence homology among this family of tyrosine kinase receptors. Also, there are reports of truncated c-kit mRNA species in the testis [40, 41], one of which has been shown to encode a receptor lacking the ligand-binding domain [41]. Therefore, to verify expression of a functional c-kit mRNA, a second c-kit cDNA corresponding to bases 16–648 of human c-kit was generated by RT-PCR, subcloned, and subsequently used in RNase protection assays. Sequence analysis of the ligand-binding domain of ovine c-kit was similar to that for the transmembrane fragment. Intensity of protected fragments increased with increasing mass of RNA added (Fig. 1B). In corpora lutea collected throughout the luteal phase, Northern analysis (Fig. 2) of c-kit mRNA revealed two major transcripts of ~5.1 kilobases (kb) and 2.3 kb.



View larger version (61K):
[in this window]
[in a new window]
 
FIG. 1. RNase protection assay of ovine luteal RNA demonstrating increasing intensity of signal with increasing mass of RNA. Position of c-kit and G3PDH protected fragments are indicated. A) c-kit probe spanning 558 bases of transmembrane domain. Lane 1: 100-bp DNA ladder. Lane 2: yeast RNA control (-) verifying complete digestion of single-stranded cRNA probes. Lanes 3–5: 10, 20, and 30 µg tcRNA, respectively. B) c-kit probe spanning 632 bases of ligand-binding domain. Lane 1: 100-bp DNA ladder. Lane 2: yeast RNA control plus 32P-labeled c-kit cRNA not exposed to RNase (-) and demonstrating size of undigested, single-stranded c-kit probe. Lane 3: yeast RNA control plus 32P-labeled c-kit cRNA exposed to RNase (+) verifying complete digestion of single-stranded cRNA probes. Lanes 4–6: 10, 20, and 30 µg tcRNA, respectively.



View larger version (49K):
[in this window]
[in a new window]
 
FIG. 2. Northern blot analysis of ovine luteal c-kit expression in individual corpora lutea collected on Days 3, 7, 10, 13, and 16. Ten micrograms tcRNA was used per lane, and size was estimated based on position of 18 and 28S RNA as well as relative migration of HindIII fragments of phage {lambda}.

Quantification of c-kit mRNA

As determined by RNase protection analysis (Fig. 3A), c-kit mRNA levels were low early in the luteal phase, increased to maximum values by Day 13 (p < 0.05), and decreased on Day 16 (p < 0.05).



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 3. A) Quantification of c-kit mRNA expression in ovine corpora lutea collected on Days 3, 7, 10, 13, and 16 postestrus (n = 4, 4, 5, 4, and 4 animals, respectively), determined by RNase protection analysis and expressed as the ratio of densitometric units c-kit:densitometric units G3PDH (± SEM); A–D, p < 0.05. B) Representative example of RNase protection assay from each of the 5 days of the estrous cycle examined.

Localization of c-kit

In situ hybridization was employed to localize expression of c-kit mRNA within sections of luteal tissue collected on Days 3 and 14 of the estrous cycle. An antisense 35S-labeled c-kit riboprobe hybridized specifically within luteal tissue on both Day 3 (Fig. 4B) and 14 (Fig. 4E). Intensity of hybridization was low in sections of corpora lutea collected on Day 3, in agreement with results from RNase protection assays. On Day 14, the c-kit probe hybridized in a highly cell-specific pattern. Hybridization was markedly absent from large luteal cells but was present in surrounding small luteal cells and endothelial cells (Fig. 4, G and H). On both days examined, hybridization of the antisense probe to stromal tissue did not appear to be above background levels when compared to negative control sections hybridized with a sense 35S-labeled c-kit riboprobe (Fig. 4, C, F, and I).



View larger version (149K):
[in this window]
[in a new window]
 
FIG. 4. In situ localization of c-kit mRNA in ovine luteal tissue. A) Brightfield micrograph of a section of a Day 3 corpus luteum hybridized with antisense c-kit cRNA probe and stained with hematoxylin and eosin. Bar = 100 µm. B) Darkfield micrograph of the same section of Day 3 corpus luteum shown in A. C) Darkfield micrograph of a section of Day 3 corpus luteum adjacent to that represented in A and B and hybridized with a sense c-kit cRNA (negative control). D) Brightfield micrograph of a section of a Day 14 corpus luteum hybridized with an antisense c-kit cRNA and stained with hematoxylin and eosin. E) Darkfield micrograph of the same section of Day 14 corpus luteum shown in D. F) Darkfield micrograph of a section of Day 14 corpus luteum adjacent to that represented in D and E and hybridized with a sense c-kit cRNA (negative control). Magnification in B–F is equal to that in A. G) Brightfield micrograph of a section of a Day 14 corpus luteum hybridized with an antisense c-kit cRNA. Bar = 60 µm. Inset: Endothelial cell is indicated by an arrowhead. Bar = 20 µm. H) Micrograph of the same section of Day 14 corpus luteum shown in G visualized with Nomarski illumination. In G and H, the same large luteal cell is indicated by an arrow. I) Micrograph of a section of Day 14 corpus luteum adjacent to that represented in G and H, hybridized with a sense c-kit cRNA (negative control) and visualized with Nomarski illumination. Magnification in H and I is equal to that in G. S, Ovarian stromal tissue; L, luteal tissue.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
For a putative intraovarian regulator to have a meaningful role, it must meet certain criteria: evidence must be found for local production, local reception, and local action [42]. Although the picture is not yet complete, a growing body of evidence indicates that SCF acts as an intraovarian regulator. Previously we showed that SCF was expressed by the ovine corpus luteum and that levels of SCF mRNA remained constant throughout the luteal phase [11]. In the present experiments, we addressed the second requirement, that of local reception.

Complementary DNAs encoding two different regions of ovine c-kit were isolated from corpora lutea. Sequence analysis of the cDNA encoding the transmembrane domain revealed high sequence identity with known sequences from other species as well as marked identity with related tyrosine kinase receptors. Likewise, the cDNA encoding the ligand-binding domain bore high sequence identity with known c-kit sequences. With only one exception, ovine luteal c-kit likely is not markedly different from c-kit molecules in other species or tissues. Surprisingly, when compared with a bovine c-kit cDNA sequence published by Kubota et al. [39], both ovine c-kit cDNAs demonstrated only 60–62% sequence identity. Given the high identity of ovine c-kit with other species and the single exception of the bovine c-kit to the general agreement among species, it may be that the sequence published by Kubota et al. [39] is not c-kit.

The probe directed against the c-kit ligand-binding domain was used for c-kit mRNA quantification for the following reasons. First, although initial analysis of luteal c-kit expression with the probe encoding the transmembrane domain generated only one protected fragment in RNase protection assays (Fig. 4A), this region of c-kit bears high sequence homology to other members of the tyrosine kinase receptor family and, though unlikely, this probe could potentially detect other tyrosine kinase receptors. Second, we wished to quantify mRNA encoding a functional receptor; on the basis of the report [42] of a truncated c-kit transcript lacking the ligand-binding domain, it was essential to minimize the chances of detecting mRNAs encoding nonfunctional receptors.

There is variation in c-kit transcript size among species and tissues. In mouse and human tissues, c-kit was expressed as a single transcript of approximately 5 kb [30, 37, 38]. In two hematopoietic cell lines, an alternatively spliced variant lacking four amino acids has been reported [43]. In testes, multiple transcripts ranging in size from 2.3 to 12 kb [40, 41, 44] have been reported. The predominant transcript in most tissues and species is approximately 5 kb, and predicted amino acid sequences of reported 5-kb cDNAs indicate that this species encodes the functional receptor. A 3.2-kb c-kit cDNA obtained from testes by Rossi et al. [41] encodes a truncated c-kit receptor that, if translated, would lack the transmembrane and ligand-binding domains. In the present study, Northern analysis of ovine luteal c-kit indicated that two transcripts of approximately 5.1 and 2.3 kb were expressed. While the 5.1-kb transcript presumably encodes the functional receptor, the nature of the 2.3-kb transcript has not been determined. Northern analysis is not sufficiently sensitive to detect variants lacking only small portions of the receptor, and the probe used in RNase protection assays was not generated against the region known to contain the small deletions in the intracellular domain reported by Vandenbark et al. [43]; therefore it is not known whether these variants are expressed by luteal tissue.

Previous data [11] indicated that luteal SCF mRNA levels remained constant throughout the luteal phase. This raised the possibility that regulation of SCF action in the corpus luteum may be at the level of receptor expression. In the present study, c-kit mRNA expression was low early in the luteal phase, increased by midluteal phase, and decreased by Day 16. On the basis of known effects of SCF on cellular differentiation, proliferation, and migration [12], the low levels of expression observed early in the luteal phase were unexpected. After ovulation, cells of the developing corpus luteum are proliferating at a rate comparable to that of fastest growing tumors [45]. Furthermore, follicular cells differentiate into luteal cells and migrate during luteal development [46]. Since c-kit expression was not elevated at this stage, SCF is not likely a primary factor directing cellular proliferation, migration, and differentiation occurring at this time. Alternatively, the low levels of c-kit mRNA expression observed within corpora lutea collected early in the luteal phase may indicate that the number of cells within the population that express c-kit at this time is low. Localization of c-kit mRNA by in situ hybridization on Day 3 indicated that c-kit mRNA was expressed at low levels throughout the corpus luteum, with areas of more intense hybridization at the periphery of luteal tissue. We were unable to discern the specific cell types that expressed c-kit mRNA on Day 3. Given the low level of c-kit expression on Day 3, it appears that SCF is not a primary regulator at this time.

Expression of luteal c-kit increased during the luteal phase, reaching a maximum expression on Day 13. This pattern of expression parallels the functional maturation of the corpus luteum, including the increase in progesterone secretion [47], expression of LH receptor mRNA [48], and the increase in numbers of small luteal cells, fibroblasts, and endothelial cells within luteal tissue [49]. Within the mouse ovary, SCF is essential for follicular maturation and steroidogenesis [24]. As such, c-kit may play a role in the continued maturation of luteal tissue that occurs during its life span. The increase in c-kit expression between Days 3 and 13 may be due to the increase in cell number, or may be indicative of temporal regulation of c-kit.

Likewise, the differential expression of c-kit observed within small versus large luteal cells raises the possibility of intercellular communication between these two cell types, as well as possible autocrine effects within small luteal cells, which we have shown to express SCF. In addition to interactions between small and large luteal cells, SCF likely influences luteal endothelial cells. Observation of c-kit mRNA within luteal endothelial cells is consistent with reports from other systems [50, 51]. However, the role of SCF in endothelial cell function is unclear. This cell population has been reported to express c-kit [50, 51], SCF [52], and in some cases, SCF and c-kit [53].

Lastly, c-kit may be involved in differentiation of luteal stem cells. This population, first proposed by Niswender et al. [54], would differentiate into steroidogenic cells and could explain the increase in number of small luteal cells that occurs between Days 3 and 14 [49] and the observation of luteal cells with morphological characteristics intermediate between those of fibroblasts and small luteal cells [55]. At this time we can neither confirm nor deny expression of c-kit in fibroblasts. Fibroblasts are commonly associated with supportive roles. Classically, fibroblasts express SCF and promote differentiation and survival of hematopoietic precursors [56] and mast cells [57, 58]. Fibroblasts are also considered to be an undifferentiated cell species that can be recruited into the functional cell population, as presumably occurs during thecal cell differentiation [55]. SCF has been shown to stimulate differentiation of canine bone marrow fibroblasts into cells with characteristics of hematopoietic precursors [59]. SCF is expressed in granulosa cells [20], the precursor of large luteal cells [47], and large luteal cells [11]. Expression of c-kit could provide a mechanism by which luteal fibroblasts could acquire steroidogenic capability. Both large and small luteal cells express SCF and could therefore recruit potential stem cells.

In combination, the results of the present study and those of our previous study indicate that SCF produced by the corpus luteum could act locally on cells expressing its receptor, c-kit. Further studies examining expression by luteal fibroblasts are necessary to determine whether this growth factor acts on these cells, as well as studies designed to assess the precise biological role within the corpus luteum.


    FOOTNOTES
 
1 Contribution from the Missouri Agricultural Experiment Station. Journal Series No. 12,522. Back

2 Correspondence: Michael F. Smith, Department of Animal Sciences, 160 Animal Sciences Research Center, Columbia, MO 65211. FAX: 573 882 6827; smithmf{at}missouri.edu Back

3 Current address: Department of Animal Science, University of Arizona, Tucson, AZ 85724. Back

4 Current address: Department of Animal Science, Michigan State University, East Lansing, MI 48824. Back

Accepted: June 9, 1998.

Received: August 12, 1996.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Tsafiri A, Adashi EY. Local nonsteroidal regulators of ovarian function. In: Knobil E, Neill JD (eds.), The Physiology of Reproduction. New York: Raven Press, Ltd.; 1994: 817–859.
  2. McArdle CA, Holtorf A-P. Oxytocin and progesterone release from bovine corpus luteal cells in culture: effects of insulin-like growth factor I, insulin, and prostaglandins. Endocrinology 1989; 124:1278–1286.[Abstract/Free Full Text]
  3. Constantino CX, Keyes PL, Kostyo JL. Insulin-like growth factor-I stimulates steroidogenesis in rabbit luteal cells. Endocrinology 1991; 128:1702–1708.[Abstract/Free Full Text]
  4. Talavera F, Menon KMJ. Studies on rat luteal cell response to insulin-like growth factor I (IGF-I): identification of a specific cell membrane receptor for IGF-I in the luteinized rat ovary. Endocrinology 1991; 129:1340–1346.[Abstract/Free Full Text]
  5. Einspanier R, Miyamoto A, Schams D, Müller M, Brem G. Tissue concentration, mRNA expression and stimulation of IGF-I in luteal tissue during the estrous cycle and pregnancy of cows. J Reprod Fertil 1990; 90:439–445.[Abstract/Free Full Text]
  6. Sauerwein H, Miyamoto A, Günther J, Meyer HHD, Schams D. Binding and action of insulin-like growth factors and insulin in bovine luteal tissue during the estrous cycle. J Reprod Fertil 1992; 96:103–115.[Abstract/Free Full Text]
  7. Pereira ME, Segaloff DL, Ascoli M. Inhibition of gonadotropin-responsive adenylate cyclase in MA-10 Leydig tumor cells by epidermal growth factor. J Biol Chem 1988; 263:9761–9766.[Abstract/Free Full Text]
  8. Hafez MM, Ascoli M. Epidermal growth factor desensitizes the gonadotropin-responsive adenylyl cyclase in membranes isolated from MA-10 Leydig tumor cells and luteinized rat ovaries. Endocrinology 1990; 127:394–402.[Abstract/Free Full Text]
  9. Gospodarowicz D, Cheng J, Lui GM, Baird A, Esch F, Bohlen P. Corpus luteum angiogenic factor is related to fibroblast growth factor. Endocrinology 1985; 117:2283–2391.
  10. Shweiki D, Itin A, Neufeld G, Gitay-Goren H, Keshet E. Patterns of expression of vascular endothelial growth factor (VEGF) and VEGF receptors in mice suggest a role in hormonally regulated angiogenesis. J Clin Invest 1993; 91:2235–2243.
  11. Gentry PC, Smith GW, Anthony RV, Zhang Z, Long DK, Smith MF. Characterization of ovine stem cell factor mRNA and protein throughout the luteal phase. Biol Reprod 1996; 54:970–979.[Abstract]
  12. Witte ON. Steel locus defines new multipotent growth factor. Cell 1990; 63:5–6.[CrossRef][Medline]
  13. Bachvarova RF, Manova K, Besmer P. Role in gametogenesis of c-kit encoded at the W locus of mice. In: Bernfield M (ed.), Molecular Basis of Morphogenesis. New York: Wiley-Liss, Inc.; 1993: 1–18.
  14. Steel KP, Davidson DR, Jackson IJ. TRP-2/DT, a new early melanoblast marker, shows that steel growth factor (c-kit ligand) is a survival factor. Development 1992; 115:1111–1119.[Abstract]
  15. Mekori YA, Oh CK, Metcalfe DD. IL-3-dependent murine mast cells undergo apoptosis on removal of IL-3. Prevention of apoptosis by c-kit ligand. J Immunol 1993; 151:3775–3784.[Abstract]
  16. Muta K, Krantz SB. Apoptosis of human erythroid colony-forming cells is decreased by stem cell factor and insulin-like growth factor I as well as erythropoietin. J Cell Physiol 1993; 156:264–271.[CrossRef][Medline]
  17. Cáceres-Cortés J, Rajotte D, Dumochel J, Haddad P, Hoang T. Product of the steel locus suppresses apoptosis in hemopoietic cells. Comparison with pathways activated by granulocyte macrophage colony-stimulating factor. J Biol Chem 1994; 269:12084–12091.[Abstract/Free Full Text]
  18. Iemura A, Tsai M, Ando A, Wershil BK, Galli SJ. The c-kit ligand, stem cell factor, promotes mast cell survival by suppressing apoptosis. Am J Pathol 1994; 144:321–328.[Abstract]
  19. Russell ES. Hereditary anemias of the mouse. Adv Genet 1979; 20:357–459.[Medline]
  20. Manova K, Huang EJ, Angeles M, De Leon V, Sanchez S, Pronovost SM, Besmer P, Bachvarova RF. The expression pattern of the c-kit ligand in gonads of mice supports a role for the c-kit receptor in oocyte growth and in proliferation of spermatogonia. Dev Biol 1993; 157:85–99.[CrossRef][Medline]
  21. Manova K, Nocka K, Besmer P, Bachvarova RF. Gonadal expression of c-kit encoded at the W locus of the mouse. Development 1990; 110:1057–1069.[Abstract/Free Full Text]
  22. Horie K, Takakura K, Tail S, Narimoto K, Noda Y, Nishikawa S, Nakayama H, Fujita J, Mori T. The expression of c-kit protein during oogenesis and early embryonic development. Biol Reprod 1991; 45:547–552.[Abstract]
  23. Packer AI, Hsu YC, Besmer P, Bachvarova RF. The ligand of the c-kit receptor promotes oocyte growth. Dev Biol 1994; 161:194–205.[CrossRef][Medline]
  24. Terada N, Kuroda H, Nakayama H, Matsumoto K, Kitamura Y. Effect of genetically defined oocyte depletion on production of androgens and oestrogens by ovaries of suckling mice. J Steroid Biochem 1986; 25:83–89.[Medline]
  25. Kuroda H, Terada N, Nakayama H, Matsumoto K, Kitamura Y. Infertility due to growth arrest of ovarian follicles in Sl/Slt mice. Dev Biol 1988; 126:71–79.[CrossRef][Medline]
  26. Huang EJ, Manova K, Packer AI, Sanchez S, Bachvarova RF, Besmer P. The murine steel Panda mutation affects kit ligand expression and growth of early ovarian follicles. Dev Biol 1993; 157:100–109.[CrossRef][Medline]
  27. Qiu F, Ray P, Brown K, Barker PE, Jhanwar S, Ruddle FH, Besmer P. Primary structure of c-kit: relationship with the CSF-1/PDGF receptor kinase family—oncogenic activation of v-kit involves deletion of extracellular domain and C terminus. EMBO J 1988; 7:1003–1011.[Medline]
  28. Majumder S, Brown K, Qiu F, Besmer P. c-kit protein, a transmembrane kinase: identification in tissues and characterization. Mol Cell Biol 1988; 8:4896–4903.[Abstract/Free Full Text]
  29. Rottapel R, Reedjik M, Williams DE, Lyman SD, Anderson DM, Pawson T, Bernstein A. The Steel/W transduction pathway: kit autophosphorylation and its association with a unique subset of cytoplasmic signaling proteins is induced by the steel factor. Mol Cell Biol 1991; 11:3043–3051.[Abstract/Free Full Text]
  30. Yarden Y, Kuang W, Yang-Feng T, Coussens L, Munemitsu S, Dull TJ, Chen E, Schlessinger J, Francke U, Ullrich A. Human proto-oncogene c-kit: a new cell surface receptor tyrosine kinase for an unidentified ligand. EMBO J 1987; 6:3341–3351.[Medline]
  31. Lev S, Yarden Y, Givoli D. Dimerization and activation of the kit receptor by monovalent and bivalent binding of stem cell factor. J Biol Chem 1992; 267:15970–15977.[Abstract/Free Full Text]
  32. Blume-Jenson P, Claesson-Welch L, Siegbahn A, Zsebo KM, Westermark B, Heldin C. Activation of the human c-kit product by ligand-induced dimerization mediates circular actin reorganization and chemotaxis. EMBO J 1991; 10:4121–4128.[Medline]
  33. Chirgwin JM, Pryzbala AE, Macdonald RJ, Rutter WJ. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 1979; 18:5294–5299.[CrossRef][Medline]
  34. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning—A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1989.
  35. Smith GW, McCrone S, Peterson SL, Smith MF. Expression of messenger ribonucleic acid encoding tissue inhibitor of metalloproteinases-2 within ovine follicles and corpora lutea. Endocrinology 1995; 134:344–352.[Abstract/Free Full Text]
  36. SAS. SAS User's Guide: Statistics. Cary, NC: Statistical Analysis System Institute, Inc.; 1988.
  37. Chabot B, Stephenson DA, Chapman VM, Besmer P, Bernstein A. The proto-oncogene c-kit encoding a transmembrane tyrosine kinase receptor maps to the W locus. Nature 1988; 335:88–89.[CrossRef][Medline]
  38. Geissler EN, Ryan MA, Housman DE. The dominant-white spotting (W) locus of the mouse encodes the c-kit proto-oncogene. Cell 1988; 55:185–192.[CrossRef][Medline]
  39. Kubota T, Hikono H, Sasaki E, Sakurai M. Sequence of a bovine c-kit proto-oncogene. Gene 1994; 141:305–306.[CrossRef][Medline]
  40. Sorrentino V, Giorgi M, Geremia R, Besmer P, Rossi P. Expression of the c-kit proto-oncogene in the murine male germ cells. Oncogene 1991; 6:149–151.[Medline]
  41. Rossi P, Marziali G, Albanesi C, Charlesworth A, Geremia R, Sorrentino V. A novel c-kit transcript, potentially encoding a truncated receptor, originates within a kit gene intron in mouse spermatids. Dev Biol 1992; 152:203–207.[CrossRef][Medline]
  42. Adashi EY. With a little help from my friends&; evolving story of intraovarian regulation. Endocrinology 1995; 136:4161–4162.[CrossRef][Medline]
  43. Vandenbark GR, deCastro CM, Taylor H, Dew-Knight S, Kaufman RE. Cloning and structural analysis of the human c-kit gene. Oncogene 1992; 7:1259–1266.[Medline]
  44. Dym M, Jia MC, Dirami G, Price JM, Rabin SJ, Mocchetti I, Ravindranath N. Expression of c-kit receptor and its autophosphorylation in immature rat type A spermatogonia. Biol Reprod 1995; 52:8–9.[Abstract]
  45. Jablonka-Shariff A, Grazul-Bilska AT, Redmer DA, Reynolds LP. Growth and cellular proliferation of ovine corpora lutea throughout the estrous cycle. Endocrinology 1993; 133:1871–1879.[Abstract/Free Full Text]
  46. Smith MF, McIntush EW, Smith GW. Mechanisms associated with corpus luteum development. J Anim Sci 1994; 72:1857–1872.[Abstract]
  47. Niswender GD, Nett TM. Corpus luteum and its control in infraprimate species. In: Knobil E, Neill JD (eds.), The Physiology of Reproduction. New York: Raven Press, Ltd.; 1994: 781–816.
  48. Smith GW, Gentry PC, Roberts RM, Smith MF. Ontogeny and regulation of luteinizing hormone receptor messenger ribonucleic acid within the ovine corpus luteum. Biol Reprod 1996; 54:76–83.[Abstract]
  49. Farin CE, Moeller CL, Sawyer HR, Gamboni F, Niswender GD. Morphometric analysis of cell types in the ovine corpus luteum throughout the estrous cycle. Biol Reprod 1986; 35:1299–1308.[Abstract]
  50. Broudy VC, Kovach NL, Bennet LG, Lin N, Jacobsen FW, Kidd PG. Human umbilical endothelial cells display high-affinity c-kit receptors and produce a soluble form of the c-kit receptor. Blood 1994; 83:2145–2152.[Abstract/Free Full Text]
  51. Miyamoto T, Sasaguri Y, Sugama K, Azakami S, Morimatsu M. Expression of the c-kit mRNA in human aortic endothelial cells. Biochem Mol Biol Int 1994; 34:513–520.[Medline]
  52. Aye MT, Hashemi S, Leclair B, Zeibdawi A, Trudel E, Halpenny M, Fuller V, Cheng G. Expression of stem cell factor and c-kit mRNA in cultured endothelial cells, monocytes and cloned bone marrow stromal cells (CFU-RF). Exp Hematol 1992; 20:523–527.[Medline]
  53. Heinrich MC, Dooley DC, Freed AC, Band L, Hoatlin ME, Keeble WW, Peters ST, Silvey KV, Ey FS, Kabat D. Constitutive expression of steel factor gene by human stromal cells. Blood 1993; 82:771–783.[Abstract/Free Full Text]
  54. Niswender GD, Schwall RH, Fitz TA, Farin CE, Sawyer HR. Regulation of luteal function in domestic ruminants: new concepts. Recent Prog Horm Res 1985; 41:101–151.
  55. O'Shea JD, Cran DG, Hay MF. Fate of the theca interna following ovulation in the ewe. Cell Tissue Res 1982; 210:305–309.
  56. Toksoz D, Zsebo KM, Smith KA, Hu S, Brankow D, Suggs SV, Martin FH, Williams DA. Support of human hematopoiesis in long-term bone marrow cultures by murine stromal cells selectively expressing the membrane-bound and secreted forms of the steel gene product, stem cell factor. Proc Natl Acad Sci USA 1992; 89:7350–7354.[Abstract/Free Full Text]
  57. Fujita J, Nakayama H, Onoue H, Kanakura Y, Nakano T, Asai H, Takeda S, Honjo T, Kitamura Y. Fibroblast dependent growth of mast cells in vitro: duplication of mast cell depletion in mutant mice of W/Wv genotype. J Cell Physiol 1988; 134:78–84.[CrossRef][Medline]
  58. Fujita J, Onoue H, Ebi Y, Nakayama H, Kanakura Y. In vitro duplication and in vivo cure of mast-cell deficiency of Sl/Sld mutant mice by cloned 3T3 fibroblasts. Proc Natl Acad Sci USA 1989; 86:2888–2891.[Abstract/Free Full Text]
  59. Huss R, Hong DS, McSweeney PA, Hoy CA, Deeg HJ. Differentiation of canine bone marrow cells with hemopoietic characteristics from an adherent stromal cell precursor. Proc Natl Acad Sci USA 1995; 92:748–752.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
ReproductionHome page
K. Spanel-Borowski, K. Sass, S. Loffler, E. Brylla, M. Sakurai, and A. M Ricken
KIT receptor-positive cells in the bovine corpus luteum are primarily theca-derived small luteal cells
Reproduction, October 1, 2007; 134(4): 625 - 634.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
L. S. Sleer and C. C. Taylor
Platelet-Derived Growth Factors and Receptors in the Rat Corpus Luteum: Localization and Identification of an Effect on Luteogenesis
Biol Reprod, March 1, 2007; 76(3): 391 - 400.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
D. C. Eckery, S. B. Lawrence, J. L. Juengel, P. Greenwood, K. P. McNatty, and A. E. Fidler
Gene Expression of the Tyrosine Kinase Receptor c-kit During Ovarian Development in the Brushtail Possum (Trichosurus vulpecula)
Biol Reprod, February 1, 2002; 66(2): 346 - 353.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. L. Juengel, L. D. Quirke, D. J. Tisdall, P. Smith, N. L. Hudson, and K. P. McNatty
Gene Expression in Abnormal Ovarian Structures of Ewes Homozygous for the Inverdale Prolificacy Gene
Biol Reprod, June 1, 2000; 62(6): 1467 - 1478.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gentry, P. C.
Right arrow Articles by Smith, M. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gentry, P. C.
Right arrow Articles by Smith, M. F.
Agricola
Right arrow Articles by Gentry, P. C.
Right arrow Articles by Smith, M. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS