Chronic Oxytocin Pretreatment Inhibits Adenylyl Cyclase Activity in Cultured Rat Myometrial Cells¹

^a Departments of Anesthesiology/Critical Care Medicine, Environmental Health Sciences and Oncology, The Johns Hopkins Medical Institutions, Baltimore, Maryland 21205

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
To determine whether chronic oxytocin pretreatment inhibits adenylyl cyclase, we compared adenylyl cyclase activity in membranes prepared from cultured, immortalized rat myometrial cells that were untreated or pretreated for 24 h with oxytocin. Chronic oxytocin pretreatment (1 x 10^-5 M for 24 h) attenuated basal, guanosine triphosphate (1 x 10^-5 M)-, isoproterenol (1 x 10^-4 M)-, forskolin (1 x 10^-5 M)-, MnCl₂ (20 mM)- or NaF (1 x 10^-2 M)-stimulated adenylyl cyclase activity by 27 ± 5% to 39 ± 11% (n = 6, p < 0.05). Oxytocin pretreatment for 2 h (n = 5) did not produce a significant effect. To understand the mechanism by which oxytocin pretreatment decreased activity of the adenylyl cyclase pathway, we compared effects of pretreatment with either oxytocin or phenylephrine on adenylyl cyclase activity and determined the effects of G_i inhibition and protein kinase C (PKC) depletion. Chronic (24 h) phenylephrine pretreatment (1 x 10^-4 M) had effects similar to those of oxytocin pretreatment (1 x 10^-5 M). PKC depletion with phorbol 12-myristate 13-acetate (1 x 10^-6 M, 41 h) prevented attenuation of adenylyl cyclase activity by oxytocin pretreatment (1 x 10^-5 M for 24 h). Inhibition of G_i by pertussis toxin pretreatment (1.25 µg/ml, 41 h) had no significant effect. These findings suggest that chronic oxytocin pretreatment desensitizes the adenylyl cyclase pathway by a cross-regulatory mechanism that involves activation of G_q and PKC.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Initiation of labor involves a change from a state of uterine quiescence during pregnancy to one characterized by regular, intermittent, forceful contractions needed to deliver the fetus. Although hormonal, metabolic, and neural influences modulate uterine activity, uterine tone ultimately depends on the contractile state of the myometrium. Many external influences effect changes in myometrial function by the binding of agonists to specific cell surface receptors that activate or inhibit pathways producing contraction or relaxation.

Following agonist occupation of many of these receptors, signal transduction involves heterotrimeric G proteins. Agonist occupation of receptors linked to G_s activates adenylyl cyclase, the enzyme regulating conversion of ATP to cAMP, and produces uterine relaxation [1]. Agonist occupation of receptors linked to G_i inhibits adenylyl cyclase and therefore inhibits relaxation. Agonist occupation of receptors linked to G_q produces uterine contraction by activating phospholipase C-ß, leading to increased intracellular concentrations of inositol trisphosphate and increased activity of protein kinase C (PKC) [2, 3].

Oxytocin plays a significant role in contracting the uterus during labor, but its role in the initiation of labor is not well established. During pregnancy, the uterus becomes more sensitive to oxytocin, primarily because of increased concentrations of oxytocin receptors [4]. Myometrial oxytocin receptors couple to the G proteins G_q [5] and G_i [6, 7]. Increases in uterine contractility by activation of these G proteins occur acutely, during occupation of the oxytocin receptor by oxytocin.

Myometrial ß-adrenergic receptors are coupled to G_s and promote uterine relaxation, in part, by activating adenylyl cyclase and stimulating the conversion of ATP to cAMP. Decreases in myometrial ß-adrenergic receptor concentrations at the end of pregnancy have been reported [8], but studies showing decreased adenylyl cyclase activity in response to stimulation of G_s [9] also implicate postreceptor site(s) in desensitization of the adenylyl cyclase pathway just before parturition.

Continued exposure of a receptor to its agonist causes homologous and/or heterologous desensitization of intracellular signaling pathways. Chronic oxytocin exposure decreases concentrations of myometrial oxytocin receptors [10], but the effects of chronic oxytocin exposure on other signaling pathways in myometrial cells are unknown. Because oxytocin sensitivity increases at the end of pregnancy with associated increases in oxytocin receptor concentrations [4], we questioned whether chronic oxytocin exposure produces desensitization of the pathway that stimulates adenylyl cyclase.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Cell Culture

Pregnant rats (Sprague-Dawley), near term at Day 21 of gestation, were anesthetized with inhaled halothane (1%) until loss of spontaneous movement and were killed by decapitation. Investigations were conducted in accordance with the Guiding Principles for the Care and Use of Research Animals endorsed by the Society for the Study of Reproduction. Uteri were removed and cleared of adherent fat and mesentery, and the horns were incised longitudinally. Fetuses, placental tissues, and implantation sites were excised, and endometrium was removed by scraping the luminal surface with a razor blade. Uterine horns were minced into fragments (about 1 mm³) that were placed into cold, sterile Hanks' Balanced Salt Solution and washed twice. Myometrial cells were dispersed by digestion with agitation for 90 min at 37°C in Hanks' Balanced Salt Solution containing collagenase type IV (640 µg/ml), elastase type IV (10 U/ml), and soybean trypsin inhibitor (1 mg/ml). Nondispersed tissue fragments were separated from myometrial cells by centrifugation at 200 x g for 10 sec. Dispersed cells were collected by centrifugation of the resulting supernatant at 1300 x g for 10 min. Primary cell lines were established by plating enzymatically dispersed cells from the pellet (1 x 10⁵ cells/cm²) in high glucose (4500 mg/L) Dulbecco's Modified Eagle's medium (DMEM) containing 10% heat-inactivated fetal bovine serum, penicillin (200 U/ml), streptomycin (200 µg/ml), and amphotericin B (0.25 µg/ml). Cell culture flasks were maintained in 95% air:5% CO₂ at 37°C until confluent (1–2 wk). Complete medium was replaced every 2–4 days.

Immortalization of Cultured Myometrial Cells

Primary cultures were immortalized at the second passage using an amphotropic recombinant retroviral construct containing the E7 open reading frame of human papillomavirus type 16 [11, 12]. The plasmid was initially packaged within the virus by transfection into the CRIP amphotropic packaging cell line. DOTAP (Boehringer-Mannheim, Indianapolis, IN) liposomal transfection reagent (5, 40, or 75 µg/ml) was added to the supernatants from CRIP cells and was allowed to incubate at room temperature for 10 min. After removal of media, viral supernatants were incubated with primary cultures (10 ml supernatant/75 cm² flask) of rat myometrial cells for 4, 8, or 16 h at 37°C, after which time the viral supernatant was removed and high glucose DMEM with 10% heat-inactivated serum and antibiotics was added. Primary cultures of rat uterine cells have grown for only 1–4 wk, while cells transformed as above have grown for 2 yr in our laboratory.

After 6 wk, polymerase chain reaction (PCR) was used to detect incorporation of the E7 open reading frame of the human papillomavirus into the genome of the infected cells. PCR primers were designed to anneal to the 5' end of the human papillomavirus type 16 DNA. The 5' primer was AGAAACCCAGCTGTAATCAT and the 3' primer was TGGTTTCTGAGAACAGATGG designed to allow amplification of the 312-base pair (bp) fragment (bases 544–855) of human papillomavirus type 16 [13]. PCR was performed using 0.5 µg DNA extracted from confluent cells using DNAzol (Gibco-BRL, Gaithersburg, MD) in buffer (20 mM Tris, pH 8.4, 50 mM KCl, 1.5 mM MgCl₂) with 0.2 mM of each dNTP, 1 µM each primer, and 0.025 U/ml of Taq DNA polymerase. PCR was performed for 40 cycles with an annealing temperature of 60°C. PCR products were resolved on a 7% polyacrylamide gel and visualized by ethidium bromide straining.

Preparation of Membrane Fraction

Myometrial cells were detached from flasks by incubation in a hypotonic buffer containing Hepes (10 mM), EDTA (2 mM), and PMSF (100 µM) at pH 8.0 for 45 min at 37°C. Plasma membrane fractions were prepared by homogenization, using 30 strokes with a Potter-Elvehjem glass homogenizer with a motor-driven Teflon (Dupont, Wilmington, DE) pestle at 4°C. The homogenate was centrifuged at 48 000 x g for 20 min, 4°C, to produce a membrane pellet, which was resuspended in a buffer containing Tris (50 mM), MgCl₂ (10 mM), EDTA (2 mM), and dithiothreitol (0.5 mM) at pH 7.4. Cell membrane pellets were resuspended, washed, and centrifuged twice more using the same buffer and centrifugation protocol. The last pellet was resuspended in buffer at a protein concentration of 1–2 mg/ml.

Measurement of Adenylyl Cyclase Activity

Adenylyl cyclase activity was measured in cell membranes in triplicate samples by incubating membrane fractions in a solution (100 µl final volume, 30°C) containing sodium-Hepes (50 mM, pH 8.0), NaCl (50 mM), MgCl₂ (7 mM), EGTA (0.4 mM), BSA (0.25 mg/ml), [-³²P]ATP (0.1 mM, 0.1–0.2 mCi/mmol), cAMP (1 mM), creatine phosphate (5 mM), and creatine phosphokinase (50 U/ml). The reaction was initiated by the addition of membrane protein (10–25 µg) and was terminated after 10 min by the addition of buffer (100 µl) containing SDS (2%), Hepes (50 mM, pH 7.5), ATP (2 mM), and cAMP (0.5 mM), with [³H]cAMP (40 nM [25 Ci/mmol] to allow subsequent calculation of column recoveries) and by boiling for 3 min. Increases in adenylyl cyclase activity in response to isoproterenol were determined in the presence of guanosine triphosphate (GTP; 1 x 10^-5 M), and assays containing 10 mM NaF also contained 10 µM AlCl₃. Newly synthesized [³²P]cAMP was separated from the precursor [³²P]ATP by sequential column chromatography over Dowex (Bio-Rad, Hercules, CA) and alumina [14]. Results are expressed as picomoles of cAMP/mg protein per 10 min. Protein concentrations were determined according to the method of Lowry et al. [15], with BSA as the standard.

Immunoblotting

Cellular protein (100–200 µg) was solubilized in Laemmli's buffer (62.5 mM Tris, pH 6.8, 2% SDS, 10% glycerol, 5% ß-mercaptoethanol) and subjected to electrophoresis at constant current (50 mA/gel) through 9% SDS-polyacrylamide gels. After electrophoretic transfer under constant voltage (200 V, 2 h) to polyvinylidene fluoride filters, nonspecific sites were blocked with 3% BSA in Tris-buffered saline (TBS) (1 h, room temperature). The filters were washed and incubated with primary antibody overnight. After two 30-min washes in TBS with 0.1% Tween 20, filters were incubated with a secondary antibody (2 h, room temperature) that reacts with the primary antibody and that was preconjugated to alkaline phosphatase. The blot was then developed by the manufacturer's chemiluminescent protocol and exposed to film for a period ranging from seconds to minutes.

Primary antibody specific for smooth muscle desmin was used to confirm expression of desmin proteins by the transformed uterine smooth muscle cells. Primary antibody specific for PKC (Gibco-BRL) was used to detect depletion of PKC by phorbol-12-myristate 13-acetate (PMA) pretreatment.

Immunohistochemical Staining

Cells were grown to confluence on 8-well microscope slides (Nunc Chambers, Naperville, IL). After the removal of media, cells were air dried for 30 min, fixed in 95% cold ethanol for 20 min at -20°C, then washed three times and permeabilized for 20 min in 0.3% Triton X-100 in PBS, pH 7.5. The cells were blocked and incubated with -actin primary antibody (CGA7) for 2 h and biotinylated secondary antibody according to manufacturer's protocol (Vectastain Elite ABC Kit; Vector, Burlingame, CA).

Materials

[-³²P]ATP and [³H]cAMP were obtained from New England Nuclear (Boston, MA). L-Isoproterenol bitartrate, oxytocin, forskolin, PMA, MgCl₂, MnCl₂, NaF, AlCl₃, Hepes, ATP, BSA, cAMP, SDS, GTP, creatine phosphokinase, creatine phosphate, rabbit polyclonal primary antibody for desmin, and primary monoclonal antibody (CGA7) specific for -actin were obtained from Sigma Chemical Co. (St. Louis, MO). Secondary antibody goat anti-rabbit IgG preconjugated to alkaline phosphatase and goat anti-mouse IgG coupled to horseradish peroxidase were obtained from Bio-Rad.

Data Analysis

Adenylyl cyclase responses in the presence or absence of oxytocin or phenylephrine pretreatment were compared in a single assay using paired t-tests. Concentration-response data and responses in the presence or absence of PMA or pertussis toxin were examined by ANOVA for repeated measures with Dunnett's test. We used p < 0.05 to indicate statistical significance. Data are expressed as means ± SE.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Characterization of Immortalized Myometrial Cells

Immortalized rat myometrial cells demonstrated morphological characteristics consistent with cultured smooth muscle cells, including elongation to ends that fan out for broad areas of attachment (Fig. 1). These cells expressed -actin filaments, as expected for a cell line of myogenic origin (Fig. 1). Further evidence that the immortalized cell line retained characteristics of muscle cells was the identification of desmin protein by immunoblot in membrane fractions derived from these cells (Fig. 2A).

View larger version (171K): [in this window] [in a new window]   FIG. 1. Immunohistochemical stain of -actin filaments in immortalized rat myometrial cells. All cells stained for -actin filaments. ;ts400.

View larger version (15K): [in this window] [in a new window]   FIG. 2. A) Representative immunoblot identification of desmin protein in immortalized rat myometrial cells. Immunoreactive protein (indicated by arrow) of 53 kDa was identified in membrane fractions of fresh porcine trachealis muscle (lane 1, positive control) and immortalized rat myometrial cells (lane 2). B) PCR amplification of a segment of human papilloma virus 16 cDNA. An appropriately sized PCR product (arrow) was obtained using primers (see text) specific for viral transforming construct stably infected in primary cultures of myometrium derived from late-gestation rats. Genomic DNA was harvested from myometrial cells at 6 wk postinfection. Lane 1, molecular weight markers (x10-3); lane 2, cDNA of noninfected control cells; lane 3, cDNA of infected myometrial cells.

Immortalized rat myometrial cells were maintained in culture for over 2 yr and at least 15 passages, without obvious changes in cell morphology. In contrast, primary cultures of rat myometrial cells senesced after 2–4 wk (three passages). In addition, PCR resulted in an appropriately sized product for the viral transforming construct within the genome of infected cells (Fig. 2B). The sustained growth of the transformed cell line and incorporation of viral DNA were indications of successful immortalization.

To demonstrate functional components of the ß-adrenergic signaling pathway, confluent myometrial cells were harvested, and adenylyl cyclase activity was measured in membranes prepared from these cells. Basal adenylyl cyclase activity was 52–140 pmol cAMP/mg protein per 10 min (n = 6, Fig. 3). Activation of G proteins with GTP increased adenylyl cyclase activity to 288 ± 89% of basal levels. Activation of ß-adrenergic receptors with isoproterenol and GTP increased adenylyl cyclase activity to 324 ± 85% of basal levels and was significantly greater (p < 0.05) than with stimulation by GTP alone. Direct stimulation of G proteins (fluoroaluminates) or adenylyl cyclase (forskolin) produced the greatest increases in adenylyl cyclase activity (1443 ± 291% or 1728 ± 343% above basal levels, respectively).

View larger version (18K): [in this window] [in a new window]   FIG. 3. Adenylyl cyclase activity in membranes derived from immortalized rat myometrial cells.

Effect of Chronic Oxytocin Pretreatment on Adenylyl Cyclase Activity

To determine the effects of chronic oxytocin pretreatment, confluent myometrial cells were exposed to oxytocin (0 or 1 x 10^-5 M), dissolved in serum-free medium, for 24 h. Data for control (untreated) cells are shown in Figure 3. In myometrial membranes pretreated with and washed free of oxytocin, adenylyl cyclase activity was attenuated when compared with that of membranes prepared from cells not exposed to oxytocin (n = 6, Fig. 4). Basal and stimulated adenylyl cyclase activity were significantly less in oxytocin-pretreated cells (p < 0.05). Adenylyl cyclase activity was decreased by 29 ± 7% under basal conditions and by 36 ± 3%, 32 ± 7%, 32 ± 5%, and 27 ± 5% during stimulation with GTP, isoproterenol, forskolin, and fluoroaluminates, respectively.

View larger version (22K): [in this window] [in a new window]   FIG. 4. Adenylyl cyclase activity in membranes derived from immortalized rat myometrial cells pretreated with oxytocin (0 or 1 x 10-5 M) for 24 h. Responses were significantly less (p < 0.05) in oxytocin-pretreated cells than in controls.

Concentration-Response Relationship

To determine the concentration-response relationship of chronic oxytocin pretreatment on adenylyl cyclase, confluent myometrial cells were pretreated with oxytocin (0–1 x 10^-5 M) dissolved in serum-free medium. After 24 h, adenylyl cyclase activity was measured in washed membranes. Because decreases in basal and forskolin-stimulated adenylyl cyclase activity suggested that at least one site of desensitization of the adenylyl cyclase pathway was at the level of adenylyl cyclase, for these experiments we selected MnCl₂, which specifically activates adenylyl cyclase. In control cells, basal adenylyl cyclase activity was 99 ± 19 pmol cAMP/mg protein per 10 min (n = 6). MnCl₂ (20 mM) increased adenylyl cyclase activity to 656 ± 120 pmol cAMP/mg protein per 10 min. Oxytocin pretreatment produced concentration-dependent inhibition of MnCl₂-stimulated adenylyl cyclase activity (p < 0.05, Fig. 5). Responses to MnCl₂ were 61 ± 11% of the control value after 24-h pretreatment with the highest concentration of oxytocin (1 x 10^-5 M).

View larger version (14K): [in this window] [in a new window]   FIG. 5. Concentration-dependent inhibition of MnCl2-stimulated adenylyl cyclase activity in membranes derived from immortalized rat myometrial cells pretreated with oxytocin for 24 h (n = 6). * p < 0.05.

Effect of Duration of Oxytocin Pretreatment

Confluent myometrial cells were pretreated with oxytocin (0 or 1 x 10^-5 M) dissolved in serum-free medium, which was washed away after 2 h. In control (unpretreated) cells (Fig. 6), basal and stimulated adenylyl cyclase activity were similar to basal and stimulated adenylyl cyclase activity in control cells incubated without serum for 24 h (Figs. 3 and 4). Adenylyl cyclase activity was not inhibited by a 2-h pretreatment duration (n = 5, p = 0.92).

View larger version (26K): [in this window] [in a new window]   FIG. 6. Adenylyl cyclase activity in membranes derived from immortalized rat myometrial cells pretreated with oxytocin (0 or 1 x 10-5 M) for 2 h (n = 5). Responses did not differ significantly between oxytocin-pretreated cells and controls.

Effect of Chronic Phenylephrine Pretreatment on Adenylyl Cyclase Activity

To understand the mechanism of desensitization of adenylyl cyclase by chronic oxytocin pretreatment, myometrial cells were pretreated with an ₁-adrenergic agonist that, like oxytocin, is coupled to G_q but, in contrast to oxytocin, is not coupled to G_i. Phenylephrine (0 or 1 x 10^-4 M) was dissolved in serum-free medium, and propranolol (1 x 10^-5 M) was added to phenylephrine-containing medium to prevent activation of ß-adrenergic receptors by phenylephrine. The cells were washed free of phenylephrine/propranolol after 24 h, and adenylyl cyclase activity was measured in membranes. In control (untreated) cells, basal adenylyl cyclase activity ranged from 27 to 147 pmol cAMP/mg protein per 10 min. Stimulation of adenylyl cyclase activity by GTP, isoproterenol, forskolin, or fluoroaluminates produced increases of 414 ± 262%, 649 ± 190%, 2359 ± 562%, or 2560 ± 656% above basal levels, respectively (n = 5). The effect of 24-h phenylephrine/propranolol pretreatment was similar to that of oxytocin (Fig. 7). Phenylephrine/propranolol pretreatment attenuated basal and stimulated adenylyl cyclase activity (p < 0.05).

View larger version (22K): [in this window] [in a new window]   FIG. 7. Adenylyl cyclase activity in membranes derived from immortalized rat myometrial cells pretreated with phenylephrine (0 or 1 x 10-4 M) for 24 h. Propranolol (1 x 10-5 M) was included in phenylephrine-containing medium to prevent activation of myometrial ß-adrenergic receptors. Responses were significantly less (p < 0.05) in phenylephrine-pretreated cells than in controls.

Role of G_i in Desensitization of Adenylyl Cyclase

To investigate further whether oxytocin pretreatment desensitized adenylyl cyclase by activating pertussis toxin-sensitive G proteins, myometrial cells were exposed to pertussis toxin (0 or 1.25 µg/ml in serum-free medium) for a total of 41 h. This concentration and duration of pretreatment partially inhibited oxytocin-stimulated phosphoinositide hydrolysis [16, 17] in cultured myometrial cells. Higher concentrations of pertussis toxin provided no further inhibitory effect [16]. Seventeen hours after the start of pertussis toxin exposure, oxytocin pretreatment (0 or 1 x 10^-5 M, 24 h) was begun. Pertussis toxin exposure was continued during 24-h oxytocin pretreatment. After the pretreatment period, cells were washed and basal adenylyl cyclase activity was measured in membranes. In control (untreated) cells, basal adenylyl cyclase activity was 55 ± 12 pmol cAMP/mg protein per 10 min (n = 3, Fig. 8A). We rejected the null hypothesis that mean basal adenylyl cyclase activity was equal under the four pretreatment conditions: 1) no pretreatment, 2) pertussis toxin, 3) oxytocin, and 4) pertussis toxin with oxytocin (p = 0.03). Basal adenylyl cyclase activity in pertussis toxin-exposed cell membranes (49 ± 8 pmol cAMP/mg protein per 10 min) did not differ significantly from the control value. Oxytocin pretreatment inhibited (p < 0.05) basal adenylyl cyclase activity (30 ± 4 pmol cAMP/mg protein per 10 min, 57 ± 6% of control, Fig. 8A). In cells exposed to pertussis toxin and then pretreated with oxytocin, basal adenylyl cyclase activity (32 ± 4 pmol cAMP/mg protein per 10 min, 62 ± 9% of control) was also less than control levels (p < 0.05, Fig. 8A), indicating that pertussis toxin exposure failed to prevent the decrease in basal adenylyl cyclase activity induced by chronic oxytocin pretreatment.

View larger version (23K): [in this window] [in a new window]   FIG. 8. Basal adenylyl cyclase activity in membranes derived from immortalized myometrial cells. A) Cells were pretreated with pertussis toxin (0 or 1.25 µg/ml, 41 h) and oxytocin (0 or 1 x 10-5 M, for the last 24 h of the pertussis toxin exposure). Basal adenylyl cyclase activity was significantly lower in cells pretreated with oxytocin or with oxytocin and pertussis toxin when compared with that in control, untreated cells. * p < 0.05. B) Cells were pretreated with oxytocin (0 or 1 x 10-5 M, 24 h) and PMA (0 or 1 x 10-6 M, 41 h). Basal adenylyl cyclase activity in oxytocin-pretreated cells was significantly reduced when compared with responses in either control cells or cells pretreated with PMA and oxytocin. * p < 0.05.

Effect of PKC Depletion on Desensitization of Adenylyl Cyclase

To determine the importance of PKC in the desensitization of adenylyl cyclase by chronic oxytocin pretreatment, cells were depleted of PKC by chronic exposure to a PKC activator, PMA (0 or 1 x 10^-6 M in serum-free medium), for a total of 41 h. After an initial period of PMA incubation (17 h), the medium was replaced with medium containing oxytocin (0 or 1 x 10^-5 M) and PMA (0 or 1 x 10^-6 M) for the final 24 h. At the end of the pretreatment period, basal and stimulated adenylyl cyclase activity were measured in membranes washed free of PMA and oxytocin. In control (untreated) cells, basal adenylyl cyclase activity was 96 ± 9 pmol cAMP/mg protein per 10 min (n = 4). After chronic PMA exposure alone, basal adenylyl cyclase activity was 93 ± 9 pmol cAMP/mg/protein per 10 min and did not differ significantly from the level in controls (p > 0.05). We rejected the null hypothesis that mean basal adenylyl cyclase activity was equal under the four pretreatment conditions: 1) no pretreatment, 2) PMA alone, 3) oxytocin alone, or 4) oxytocin with PMA (n = 4, p = 0.03, Fig. 8B). Basal adenylyl cyclase activity (64 ± 6 pmol cAMP/mg protein per 10 min, 67 ± 2% of control) was significantly less in membranes pretreated only with oxytocin (24 h) when compared with membranes from control (unpretreated) cells (p < 0.05). PKC depletion by 41-h PMA pretreatment completely prevented oxytocin-induced decreases in adenylyl cyclase activity, so that basal adenylyl cyclase activity (106 ± 19 pmol cAMP/mg protein per 10 min) did not differ significantly (p > 0.05) between PMA/oxytocin-pretreated membranes and controls.

PMA exposure also affected adenylyl cyclase activity stimulated either with fluoroaluminates (1 x 10^-2 M NaF/1 x 10^-4 M AlCl₃) or with forskolin (1 x 10^-5 M). In control (untreated) membranes, fluoroaluminate-stimulated adenylyl cyclase activity was 1205 ± 191 pmol cAMP/mg protein per 10 min (1238 ± 133% of basal, n = 4). We rejected the null hypothesis that mean fluoroaluminate-stimulated adenylyl cyclase activity was equal under the four pretreatment conditions (p = 0.004). Fluoroaluminate-stimulated adenylyl cyclase activity (761 ± 126 pmol cAMP/mg protein per 10 min, 63 ± 3% of control) was significantly less in membranes pretreated only with oxytocin when compared with membranes from control (unpretreated) cells (p < 0.05). PKC depletion alone did not significantly affect fluoraluminate-stimulated adenylyl cyclase activity (971 ± 203 pmol cAMP/mg protein per 10 min, 79 ± 5% of control, p > 0.05) but completely prevented decreased adenylyl cyclase activity by oxytocin pretreatment. After combined PMA/oxytocin pretreatment, fluoroaluminate-stimulated adenylyl cyclase activity (1179 ± 273 pmol cAMP/mg protein per 10 min, 96 ± 6% of control) did not differ significantly (p > 0.05) from the level in controls.

For control (untreated) membranes, forskolin-stimulated adenylyl cyclase activity was 2011 ± 358 pmol cAMP/mg protein per 10 min (2069 ± 297% of basal, n = 4). We rejected the null hypothesis that mean forskolin-stimulated adenylyl cyclase activity was equal under the four pretreatment conditions (p = 0.003). Forskolin-stimulated adenylyl cyclase activity (1305 ± 275 pmol cAMP/mg protein per 10 min, 65 ± 4% of control) was significantly less in membranes pretreated only with oxytocin when compared with membranes from control (unpretreated) cells (p < 0.05). PKC depletion, alone, did not significantly affect forskolin-stimulated adenylyl cyclase activity (1809 ± 397 pmol cAMP/mg protein per 10 min, 89 ± 7% of control, p > 0.05). PKC depletion completely prevented the decrease in adenylyl cyclase activity after oxytocin pretreatment, so that forskolin-stimulated adenylyl cyclase activity (1909 ± 311 pmol cAMP/mg protein per 10 min, 96 ± 3% of control) after PMA/oxytocin pretreatment did not differ significantly (p > 0.05) from the level in controls.

To determine whether chronic PMA exposure depleted cytosolic PKC in these cells, immunoblot analysis was used to detect PKC in lysates from control cells and cells exposed to PMA with or without oxytocin pretreatment. PKC was detected in lysates from all control cells (n = 4) but not from cells exposed to PMA either with or without oxytocin pretreatment (data not shown).

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
This study presents the first evidence that chronic oxytocin exposure of rat myometrial cells desensitizes the pathway leading to adenylyl cyclase stimulation. The significant effects observed under basal conditions without stimulation, or during direct G protein stimulation with fluoroaluminates or direct adenylyl cyclase stimulation with either forskolin or MnCl₂, suggest that the site of inhibition is distal to the ß-adrenergic receptor. The lack of an effect of pertussis toxin diminishes a potential role for pertussis toxin-sensitive G proteins. Because pretreatment with an ₁-adrenergic agonist produced an effect similar to that of oxytocin, activation of G_q is likely to be involved. The ability of PKC depletion to completely prevent inhibition of adenylyl cyclase further implicates a G_q-mediated pathway and localizes the effect to PKC.

The immortalized rat myometrial cells retained many characteristics of uterine smooth muscle cells. Expression of -actin (Fig. 1) and desmin (Fig. 2A) supported a myogenic origin of these cells. Like fresh rat myometrium, these cells expressed functional ß-adrenergic receptors linked to relevant intracellular signaling pathways, as evidenced by the ability of a ß-adrenergic agonist (isoproterenol), a G protein activator (GTP or fluoroaluminates), or a direct stimulator of adenylyl cyclase (forskolin or MnCl₂) to stimulate adenylyl cyclase activity (Figs. 3 and 6). The immortalized cells also expressed oxytocin and -adrenergic receptors, as evidenced by significant effects of chronic oxytocin (Fig. 4) and phenylephrine (Fig. 7) pretreatment.

Twenty-four-hour oxytocin (1 x 10^-5 M) pretreatment, without concurrent occupation of the oxytocin receptor by its agonist, attenuated basal adenylyl cyclase activity (Fig. 4). This decrease was also reflected in adenylyl cyclase activity stimulated by activation of ß-adrenergic receptors (isoproterenol), G proteins (GTP or fluoroaluminates), and adenylyl cyclase (forskolin), suggesting that the site of inhibition is distal to the ß-adrenergic receptor, at the G protein and/or adenylyl cyclase level. Although forskolin stimulates the catalytic subunit of adenylyl cyclase, G protein activation may be required to produce maximal effect [18]. Thus, changes in responses to forskolin may be mediated by effects at the level of the G protein and/or at the level of adenylyl cyclase. However, attenuation of responses to MnCl₂ (Fig. 5), a more selective activator of adenylyl cyclase, strongly suggests that at least one site of desensitization is at the level of adenylyl cyclase.

Myometrial responses to oxytocin primarily depend on oxytocin receptor concentrations [19–21]. Concentrations of oxytocin (1 x 10^-6 M, Fig. 5) required to inhibit adenylyl cyclase activity were greater than those required to contract rat uterus in vitro [22, 23]. Twenty-four-hour oxytocin pretreatment down-regulates myometrial oxytocin receptors in cultured cells [24], perhaps mandating higher concentrations of oxytocin to produce the effects observed in this study. Alternatively, higher concentrations of oxytocin may be required to produce desensitization of adenylyl cyclase than to contract isolated uterine strips, because higher concentrations of PKC may be required for this effect. The ability of higher concentrations of oxytocin to produce greater activation of PKC is substantiated by the fact that acute exposure of cultured myometrial cells to oxytocin produces concentration-dependent increases in formation of inositol phosphates [16], at concentrations up to 1 x 10^-5 M, the highest concentration used in this study.

The inability of short-term (2 h) pretreatment to affect adenylyl cyclase activity (Fig. 6) suggests that acute modifications to preexisting proteins, such as phosphorylation, do not play an important role in this response. Long-term modifications, such as synthesis of new proteins or chronic protein degradation, are more likely to play significant roles. The inability of short-term pretreatment to produce the effect also contrasts with the known G_i protein-mediated inhibition of adenylyl cyclase activity that occurs with concurrent occupation of the oxytocin receptor [6, 25] and suggests that the underlying mechanisms differ.

The similarity between effects of chronic pretreatment with an ₁-adrenergic agonist, phenylephrine (Fig. 7), and those of oxytocin supports the idea that activation of G_q is required to desensitize adenylyl cyclase. ₁-Adrenergic receptors, like oxytocin receptors, link to phosphoinositide hydrolysis [26], but, unlike oxytocin receptors, do not inhibit adenylyl cyclase activity via linkage to G_i. The inability of pertussis toxin to prevent desensitization of adenylyl cyclase by chronic oxytocin pretreatment (Fig. 8A) provides further support to the idea that although oxytocin receptors are known to couple to both G_q and G_i in this tissue, pertussis toxin-sensitive G proteins, e.g., G_i, do not play a significant role in this response. More likely, G_q-mediated activation of phospholipase C-ß, the pathway common to both oxytocin and ₁-adrenergic receptors, plays a greater role in effects of chronic oxytocin pretreatment.

Although G_q-mediated activation of phospholipase C-ß stimulates a variety of intracellular processes, stimulation of PKC appears to play a central role in desensitization of adenylyl cyclase by oxytocin pretreatment. PKC depletion, using chronic PMA exposure, completely prevented effects of subsequent oxytocin pretreatment on basal (Fig. 8B), fluoroaluminate-, or forskolin-stimulated adenylyl cyclase activity. PMA exposure alone did not significantly alter adenylyl cyclase activity, indicating that prevention of oxytocin pretreatment did not result from nonspecific stimulation of adenylyl cyclase activity by PMA. The identification of PKC in lysates from control cells, but not in lysates from PMA/oxytocin-pretreated cells (data not shown), suggests that PMA exposure successfully depleted this isoform of PKC. Although we cannot identify the specific isoforms of PKC involved in desensitization of adenylyl cyclase, chronic phorbol ester exposure of a gonadotroph-derived cell line depleted cytosolic PKC and PKC [27], as in this study. These data suggest that classic and/or novel PKC isoforms, rather than atypical isoforms, are important in desensitization of adenylyl cyclase.

In vivo, desensitization of adenylyl cyclase by chronic oxytocin pretreatment would inhibit uterine relaxation mediated by agents that activate adenylyl cyclase. Inhibition of relaxation would enhance the direct, oxytocin-induced increases in myometrial contractility that result from activation of phospholipase C-ß [2, 3] or from effects on Ca²⁺ channels [7, 28, 29]. Desensitization of the pathway that stimulates adenylyl cyclase by chronic oxytocin exposure is most likely to be important in vivo when oxytocin receptor concentrations are greatest, just before parturition. The role of oxytocin in triggering human labor is unclear, primarily because it has been difficult to demonstrate that increased pituitary or uterine oxytocin release precedes the onset of labor. Without a change in oxytocin release, desensitization of adenylyl cyclase would provide a mechanism for increasing sensitivity to oxytocin and therefore initiating labor. Potentiation of contractile responses to oxytocin by this pathway would markedly increase uterine sensitivity to oxytocin and result in loss of uterine quiescence that was present during gestation. In rats, concentrations of myometrial oxytocin receptors abruptly increase about 24 h before parturition [30]; this is identical to the time course of desensitization of adenylyl cyclase by oxytocin pretreatment in this study (Figs. 4 and 6). By linking to pathways that desensitize adenylyl cyclase, these newly expressed oxytocin receptors would potentiate uterine sensitivity to oxytocin, thus stimulating labor.

In summary, 24-h pretreatment of cultured myometrial cells with oxytocin inhibited adenylyl cyclase activity. Because inhibition of adenylyl cyclase activity occurred during direct stimulation of G_s or adenylyl cyclase, the site of desensitization is distal to the receptor coupled to G_s. The similarity between effects of pretreatment with oxytocin or an ₁-adrenergic agonist, which activates G_q but not G_i, suggests that at least one mechanism of inhibition involves G_q. The ability of PKC depletion to prevent desensitization of adenylyl cyclase by chronic oxytocin pretreatment provides further support to the idea that G_q is involved, and localizes the relevant intracellular messenger to PKC. We propose that oxytocin inhibition of the pathway that stimulates adenylyl cyclase provides a mechanism for potentiating the ability of increased oxytocin receptor concentrations to sensitize the uterus to oxytocin and may, therefore, be important in initiation of labor.

	FOOTNOTES

 
¹ Supported by NIH R55 HD/OD 34782.

² Correspondence: Karen S. Lindeman, The Johns Hopkins Hospital, 600 North Wolfe Street, Meyer 297A, Baltimore, MD 21287–7294. FAX: 410 955 0299; klindema{at}welchlink.welch.jhu.edu

Accepted: June 25, 1998.

Received: March 18, 1998.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Fuchs A. Plasma membrane receptors regulating myometrial contractility and their hormonal modulation. Semin Perinatol 1995; 19:15–30.[CrossRef][Medline]
2. Schrey MP, Read AM, Steer PJ. Oxytocin and vasopressin stimulate inositol phosphate production in human gestational myometrial and decidual cells. Biosci Rep 1986; 7:613–619.
3. Marc S, Lieber D, Harbon S. Carbachol and oxytocin stimulate the generation of inositol phosphates in the guinea pig myometrium. FEBS Lett 1986; 201:9–14.[CrossRef][Medline]
4. Fuchs A, Fuchs F, Husslein P, Soloff MS. Oxytocin receptors in the human uterus during pregnancy and parturition. Am J Obstet Gynecol 1984; 150:734–741.[Medline]
5. Ku CY, Qian A, Wen Y, Sanborn BM. Oxytocin stimulates myometrial guanosine triphosphatase and phospholipase-C activities via coupling to G_q/11. Endocrinology 1995; 136:1509–1515.[Abstract]
6. Bhalla RC, Sanborn BM, Korenman SG. Hormonal interactions in the uterus: inhibition of isoproterenol-induced accumulation of adenosine 3':5'-cyclic monophosphate by oxytocin and prostaglandins. Proc Natl Acad Sci USA 1972; 69:3761–3764.[Abstract/Free Full Text]
7. Anwer K, Sanborn BM. Changes in intracellular free calcium in isolated myometrial cells: role of extracellular and intracellular calcium and possible involvement of guanine nucleotide-sensitive protein. Endocrinology 1989; 124:17–23.[Abstract]
8. Maltier JP, Benghan-Eyene Y, Legrand C. Regulation of myometrial ß₂-adrenergic receptors by progesterone and estradiol-17ß in the late pregnant rats. Biol Reprod 1989; 40:531–540.[Abstract]
9. Cohen-Tannoudji J, Vivat V, Helimann J, Legrand C, Maltier JP. Regulation by progesterone of the high-affinity state of myometrial ß-adrenergic receptors and of adenylate cyclase activity in the pregnant rat. J Mol Endocrinol 1991; 6:137–145.[Abstract/Free Full Text]
10. Engstrom T, Atke A, Vilhardt H. Oxytocin receptors and contractile response of the myometrium after long term infusion of prostaglandin F₂, indomethacin, oxytocin and an oxytocin antagonist in rats. Regul Pept 1988; 20:65–72.[CrossRef][Medline]
11. Perez-Reyes N, Halbert CL, Smith PP, Benditt EP, McDougall JK. Immortalization of primary human smooth muscle cells. Proc Natl Acad Sci USA 1992; 89:1224–1228.[Abstract/Free Full Text]
12. Monga M, Ku CY, Dodge K, Sanborn BM. Oxytocin-stimulated responses in a pregnant human immortalized myometrial cell line. Biol Reprod 1996; 55:427–432.[Abstract]
13. Seedorf K, Krammer C, Durst M, Suhaij S, Rewekamp WG. Human papillomavirus type 16 DNA sequence. Virology 1985; 145:181–185.[CrossRef][Medline]
14. Salomon Y, Londos C, Rodbell M. A highly sensitive adenylate cyclase assay. Ann Biochem 1974; 58:541–548.
15. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem 1951; 193:265–275.[Free Full Text]
16. Phaneuf S, Europe-Finner GN, Varney M, MacKenzie IZ, Watson SP, Lopez-Bernal A. Oxytocin-stimulated phosphoinositide hydrolysis in human myometrial cells: involvement of pertussis toxin-sensitive and -insensitive G-proteins. J Endocrinol 1993; 136:497–509.[Abstract/Free Full Text]
17. Asboth G, Phaneuf S, Europe-Finner GN, Toth M, Lopez-Bernal A. Prostaglandin E2 activates phospholipase C and elevates intracellular calcium in cultured myometrial cells: involvement of EP1 and EP3 receptor subtypes. Endocrinology 1996; 137:2572–2579.[Abstract]
18. Darfler F, Mahan LC, Koachman AM, Insel PA. Stimulation by forskolin of intact s49 lymphoma cells involves the nucleotide regulatory protein of adenylate cyclase. J Biol Chem 1982; 2517:11901–11907.
19. Fuchs A, Periyasami S, Soloff MS. Systemic and local regulation of oxytocin receptors in the rat uterus. Can J Biochem Cell Biol 1983; 61:615–624.[Medline]
20. Nissenson RA, Flouret G, Hechter O. Oxytocin receptors coupled to uterine contraction in estrogen-dominated rabbits. Biochim Biophys Acta 1980; 628:209–219.[Medline]
21. Riemer RK, Goldfien AC, Roberts JM. Rabbit uterine oxytocin receptors and in vitro contractile response: abrupt changes at term and the role of eicosanoids. Endocrinology 1986; 118:699–704.
22. Izumi H, Byam-Smith M, Garfield RE. Gestational changes in oxytocin- and endothelin-1-induced contractility of pregnant rat myometrium. Eur J Pharmacol 1995; 278:187–194.[CrossRef][Medline]
23. Phillippe M. Protein kinase C, an inhibitor of oxytocin-stimulated phasic myometrial contractions. Biol Reprod 1994; 50:855–859.[Abstract]
24. Adachi S, Oku M. The regulation of oxytocin receptor expression in human myometrial monolayer culture. J Smooth Muscle Res 1995; 31:175–187.[Medline]
25. Goureau O, Tanfin Z, Harbon S. Prostaglandins and muscarinic agonists induce cyclic AMP attenuation by two distinct mechanisms in the pregnant-rat myometrium. Biochem J 1990; 271:667–673.[Medline]
26. Breuiller-Fouche M, Doualla BK, Geny B, Ferre F. Alpha-1 Adrenergic receptor: binding and phosphoinositide breakdown in human myometrium. J Pharmacol Exp Ther 1991; 258:82–87.[Abstract/Free Full Text]
27. Johnson MS, Simpson J, Mitchell R. Effect of phorbol 12, 13-dibutyrate on ligand binding, enzyme activity and translocation of protein kinase C isoforms in the alpha T3–1 gonadotrope-derived cell line. Mol Cell Biochem 1996; 165:65–75.[Medline]
28. Mizuki J, Tasaka K, Masumoto N, Kasahara K, Miyake A, Tanizawa O. Magnesium sulfate inhibits oxytocin-induced calcium mobilization in human puerperal myometrial cells: possible involvement of intracellular free magnesium concentration. Am J Obstet Gynecol 1993; 169:134–139.[Medline]
29. Tasaka K, Masumoto N, Miyake A, Tanizawa O. Direct measurement of intracellular free calcium in cultured human puerperal myometrial cells stimulated by oxytocin: effects of extracellular calcium and calcium channel blockers. Obstet Gynecol 1991; 77:101–106.[Abstract/Free Full Text]
30. Soloff MS, Alexandrova M, Fernstrom MJ. Oxytocin receptors: triggers for parturition and lactation. Science 1979; 204:1313–1315.[Abstract/Free Full Text]