Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lin, X.
Right arrow Articles by Conn, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lin, X.
Right arrow Articles by Conn, P. M.
Agricola
Right arrow Articles by Lin, X.
Right arrow Articles by Conn, P. M.
Biology of Reproduction 59, 1470-1476 (1998)
©Copyright 1998 Society for the Study of Reproduction, Inc.

Mutations at the Consensus Phosphorylation Sites in the Third Intracellular Loop of the Rat Gonadotropin-Releasing Hormone Receptor: Effects on Receptor Ligand Binding and Signal Transduction1

Xinwei Lina, Jo Ann Janovicka, and P. Michael Conn2,a,b

a Oregon Regional Primate Research Center, Beaverton, Oregon 97006 b Department of Physiology and Pharmacology, Oregon Health Sciences University, Portland, Oregon 97201


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, site-directed mutagenesis of potential phosphorylation sites (Thr238, Ser253, and Thr264) for protein kinase C and C-terminal portion (Ala260-Leu265) of the third intracellular loop of the rat GnRH receptor (rGnRHR) was performed to assess the significance of these regions in the function of the GnRHR. Mutation at one or all of the three potential phosphorylation sites had differential effects on receptor ligand binding. Mutation of Ser253 or Thr264 to Ala did not significantly affect the receptor-binding affinity but decreased the number of measurable binding sites. Mutation of Thr238 to Ala or triple mutation of Thr238, Ser253, and Thr264 impaired or abolished receptor-binding affinity. Mutations of the potential phosphorylation sites affected receptor-mediated inositol phospholipid (IP) production and correlated with alterations in receptor binding after mutation, but they did not significantly affect receptor-mediated cAMP production or cAMP-mediated prolactin release. In addition, mutation of Ser253 or Thr264 to Ala did not affect the GnRH-provoked desensitization in terms of GnRH agonist-stimulated IP production. Deletion of the C-terminal portion (Ala260-Leu265) of the third intracellular loop of the rGnRHR, including a potential phosphorylation site (Thr264), abolished the receptor-binding affinity and receptor-mediated signal transduction. Replacement of the deleted C-terminal portion with a C-terminal portion (Ala-Ala-Arg-Thr-Leu-Ser) of the third intracellular loop of the Gq/11-coupled rat M1 muscarinic acetylcholine receptor did not restore receptor function. These results suggest that the potential phosphorylation sites or the region around the phosphorylation site of the third intracellular loop of the GnRHR is important for the structural integrity and expression of the receptor but that phosphorylation at these sites is not required for desensitization.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Pituitary gonadotrophs respond to GnRH with the synthesis and secretion of gonadotropins, development of desensitization, and regulation of GnRH receptors (GnRHR). Binding of GnRH to the GnRHR is generally accepted as the first step in the mechanism of GnRH action [1]. The GnRHR is a member of the G protein-coupled receptor (GPCR) family [2]. The GnRHR appears to couple to multiple G proteins, including Gq/11, which activates phospholipase C, leading to production of diacylglycerol and activation of protein kinase C (PKC) [3–7]. The architecture of GPCRs is characterized by 7 hydrophobic stretches of amino acids that are predicted to form transmembrane helices, connecting by alternating extracellular and intracellular loops [8]. The N-terminus, extracellular loop, and/or the transmembrane domains of the GPCR are generally involved in the binding site for ligand. On the other hand, the intracellular loops, particularly the second and the third intracellular loops, and the membrane-proximal region of the intracellular C-terminal tail of GPCR are important for receptor-G protein coupling and specificity determination [8, 9]. Studies using ß-adrenergic receptor and other GPCRs as model systems have shown that phosphorylation of the GPCR by serine/threonine protein kinases—including second messenger-dependent kinases (protein kinase A and C) and G protein-coupled receptor kinases (GRKs)—on the phosphorylation sites (Ser/Thr) localized in the C-terminal tail and the third intracellular loop is involved in the mechanism leading to receptor regulation and desensitization [10, 11]. Molecular cloning of cDNA for the GnRHR from several species revealed that the mammalian GnRHR lacks the intracellular C-terminal tail, implying a different mechanism for receptor regulation [2]. In addition, sequence analysis of the GnRHR identified several potential phosphorylation sites in the intracellular loops, including three (Ser or Thr) phosphorylation sites for PKC in the third loop [2, 12]. However, it is unknown whether these sites are functional and are involved in the regulation of the receptor.

PKC appears to be a modulator involved in the gonadotroph responsiveness to GnRH [1]. Activation of PKC stimulated synthesis of the GnRHR [13, 14], and activators of PKC also stimulated an increase in both binding affinity and number of binding sites of agonist-occupied GnRHR [15]. Furthermore, activators of PKC and a GnRH agonist stimulated similar patterns of protein phosphorylation in pituitary cell cultures [16, 17]. These studies imply that PKC acts directly on the receptor level to modulate the GnRHR-binding affinity and receptor expression on the plasma membrane.

In the present study, the effects of mutations of the potential phosphorylation sites in the third intracellular loop of the rat GnRHR (rGnRHR) on receptor binding, signal transduction, and desensitization were examined using GH3 cells, a pituitary somatolactotropic cell line, which is a useful model system for heterologous expression of GnRHR and study of receptor-effector coupling [18].


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Materials

Rat GnRHR cDNA in pcDNA1 was generously provided by Drs. U.B. Kaiser and W.W. Chin [19]. The expression vector pcDNA3.1 was purchased from Invitrogen (San Diego, CA). Natural sequence GnRH was provided by the National Pituitary Agency, NIDDK (Rockville, MD). Buserelin (D-tert-butyl-Ser6-des-Gly10-Pro9-ethylamide-GnRH) was a kind gift from Hoechst-Roussel Pharmaceuticals (Somerville, NJ). Myo-[3H]inositol was purchased from Dupont (New England Nuclear, Boston, MA). DMEM, OPTI-MEM, and lipofectamine were purchased from Life Technologies (Grand Island, NY). MORPH Site-Specific Plasmid DNA Mutagenesis Kit was purchased from 5 Prime->3 Prime (Boulder, CO). Restriction enzymes, modified enzymes, and competent cells for subcloning were purchased from Promega (Madison, WI). Other reagents were of the highest degree of purity available from commercial sources.

Methods

Generation of mutant receptors Wild-type (wt) rGnRHR cDNA in pcDNA1 was subcloned into pcDNA3.1 at BamHI and XhoI restriction enzyme sites. The wt rGnRHR cDNA in pcDNA3.1 vector was used as a template for generation of site-directed mutations using the MORPH Site-Specific Plasmid DNA Mutagenesis Kit (5 Prime->3 Prime). Briefly, the MORPH Kit procedure involves annealing the 5'-phosphorylated mutagenic oligonucleotide primer to one strand of the denatured double-strand plasmid DNA; extension of the primer with T4 DNA polymerase to generate a hemi-methylated, double-stranded, "half-mutant" DNA; restriction digestion to virtually eliminate nonmutant plasmid DNA; and transformation into Escherichia coli mutS strain that is deficient in DNA repair strand selection. The sequence of the mutagenic primer for T238A mutation (mutation of Thr238 to Ala) was CTTCGC-CCTCCGAGTCCTTC; the underlined codon for Ala was substitution for ACA encoding Thr. The sequence of the primer for S253A mutation (mutation of Ser238 to Ala) was GCTGAATCAAAAGAATAATATCCC; the underlined codon for Ala was substitution for TCC encoding Ser. The sequence of the primer for T264A mutation (mutation of Thr264 to Ala) was CGGCTGAGACTAAAGATG; the underlined codon for Ala was a substitution for ACT encoding Thr. For triple mutation (T238A, S253A, T264A), the three primers described above for individual mutation were used at the same time. The sequence of the mutagenic primer for deletion of Ala260-Leu265 was GGCAAATGCCACTGTCATCTT/TCTTGGGATATTATTCTTGG (antisense); the sequence encoding Ala260-Arg-Leu-Arg-Thr-Leu265 (GCACGGCTGAGAACTCTA) was deleted at the position indicated by a slash. The sequence of the primer for replacement of the sequence for Ala260-Leu265 with the sequence encoding Ala-Ala-Arg-Thr-Leu-Ser, the C-terminal portion of the third intracellular loop of rat M1 subtype muscarinic acetylcholine receptor (M1AchR) [20], was GGCAAATGCCACTGTCATCTTTCTTGGGATATTATTCTTGG (antisense); the underlined sequence is complementary to the DNA sequence encoding Ala-Ala-Arg-Thr-Leu-Ser (GenBank accession number: M16406) [20].

All mutations were verified by dye terminator cycle sequencing according to the manufacturer's instructions (Perkin Elmer, Foster City, CA). For transfection, a large scale of plasmid DNAs containing wt or mutant receptor cDNAs was prepared by double-banded CsCl gradient centrifugation. The purity and identity of plasmid DNAs were further verified by restriction enzyme analysis.

Transient transfection of GH3 cells Wt and mutant receptors were transiently expressed in GH3 cells [21]. GH3 cells were maintained in growth medium (Dulbecco's Modified Eagle's Medium [DMEM] containing 10% fetal calf serum [Hyclone Laboratories, Logan, UT] and 20 µg/ml gentamicin [Gemini Bioproducts, Calabasas, CA]) in a humidified atmosphere (37°C) containing 5% CO2. Cells (105 cells per well) were seeded in 24-well plates (Costar, Cambridge, MA). Twenty-four hours after plating, the cells were transfected with 0.8 µg plasmid DNA per well using 2 µl lipofectamine in 0.25 ml OPTI-MEM. Five hours later, 0.25 ml of DMEM containing 20% fetal calf serum was added to each well. Twenty-four hours after the start of transfection, the medium was replaced with fresh growth medium, and the cells were allowed to grow for 48 h before functional assays (inositol phospholipid [IP] production, cAMP and prolactin [PRL] release) were performed. For receptor binding, the same transfection procedure was followed except that 20 µg plasmid DNA and 50 µl lipofectamine were used to transfect the cells in 75-cm2 flasks (Costar) when they were 60–80% confluent. The transfection efficiency has been determined to be approximately 35% by galactose histochemical staining of control cells transfected with pCIS-LacZ vector containing ß-galactosidase coding sequence. The efficiencies for transfection of GH3 cells with wt or mutant receptor expression vector were similar.

Receptor-binding assay Intact cell binding was assessed in a range of concentrations of 125I-buserelin prepared as previously reported [22], in DMEM-0.1% BSA. Seventy-two hours after the start of transfection, the cells transfected with wt or mutant receptor DNAs were scraped and resuspended in warm DMEM-BSA. Cells were then pelleted and washed twice with ice-cold DMEM-BSA. One hundred microliters of the cell suspension (106 cells) was added to each tube, and the assay was allowed to come to equilibrium (3 h) at 4°C at a final volume of 150 µl. Binding was terminated by overlayering each sample on 2 ml DMEM-0.3 M sucrose at 4°C and centrifuging at 2000 x g for 10 min at 4°C in a Sorvall (Newtown, CT) SM-24 rotor. The supernate was aspirated. The cell pellet was resuspended in 1 ml PBS, and radioactivity was determined using a Packard (Meriden, CT) 10-channel gamma counter.

Quantitation of IP Forty-eight hours after the start of transfection, the cells transfected with wt or mutant receptor DNAs were washed with DMEM-0.1% BSA; they were then incubated in 0.5 ml DMEM (without inositol) containing 4 µCi/ml [3H]inositol for 18 h at 37°C. After the preloading period, cells were washed twice in DMEM (inositol free) containing 5 mM LiCl and stimulated with medium or buserelin at indicated doses in 0.5 ml of DMEM-LiCl for 2 h at 37°C. For desensitization studies, the cells were pretreated with medium or 10-7 M GnRH in 0.5 ml DMEM (without inositol) for 2 h after the preloading period. The cells were then washed twice with DMEM (inositol free) containing 5 mM LiCl, returned to the incubator at 37°C for 20 min, and treated with medium or buserelin at indicated doses in 0.5 ml of DMEM (without inositol) containing 5 mM LiCl for 1 h at 37°C. The treatment solution was removed, and 1 ml 0.1 M formic acid was added to each well. The cells were frozen, then thawed to disrupt cell membranes. IP accumulation was determined by Dowex anion-exchange chromatography and liquid scintillation spectroscopy, as previously described [23].

Quantitation of cAMP Forty-eight hours after the start of transfection, the cells transfected with wt or mutant receptor DNAs were washed with DMEM containing 0.1% BSA (Irvine Scientific, Santa Ana, CA) and 20 µg/ml gentamicin (DMEM-BSA-gentamicin). The cells were then stimulated for 24 h with medium or buserelin (10-13-10-7 M) in DMEM-BSA-gentamicin containing 0.2 mM methyl isobutylxanthine (MIX) to prevent degradation of cAMP. After stimulation, the medium from each well was collected in tubes containing sufficient theophylline for a final concentration of 1 mM. The samples were heated (95°C) for 5 min to destroy phosphodiesterases. RIA of cAMP was performed by a modification of the method of Steiner et al. [24], with the addition of the acetylation step described by Harper and Brooker [25]. Cyclic AMP antiserum C-1B (prepared in our laboratory; [26]) was used at a titer of 1:5100. This antiserum showed less than 0.1% cross-reaction with cGMP, 2',3'-cAMP, 5'-cAMP, 3'-cAMP, ADP, GDP, ATP, CTP, MIX, or theophylline.

Quantitation of PRL release Forty-eight hours after the start of transfection, the cells transfected with wt or mutant receptor DNAs were washed twice with DMEM-BSA-gentamicin. The cells were then incubated with medium or various doses of buserelin in a 1-ml volume of DMEM-BSA-gentamicin at 37°C for 24 h. The medium was collected, and the PRL released in medium was measured by RIA using materials obtained from the Hormone Distribution Program of the National Pituitary Agency, NIDDK. PRL was radioiodinated by standard procedures [27]. Intra- and interassay variances were 5% and 7%, respectively.

Data analysis Data shown are the mean of triplicate assay wells and are presented as the mean ± SEM of replicates in each experiment. The SEM was typically less than 10% of the mean. The data were analyzed by Student's t-test, p < 0.05 being considered significant. Each experiment was repeated three or more times to ensure the reproducibility of the findings.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Effects of Mutations of the Potential Phosphorylation Sites in the Third Intracellular Loop of rGnRHR on Receptor Ligand Binding

Three consensus phosphorylation sites (Thr238, Ser253, and Thr264) for PKC in the third intracellular loop of the rGnRHR were substituted with Ala individually. The resulting mutations of the receptor were designated as T238A, S253A, and T264A, respectively. A triple-point mutation was also generated by substitution of the three phosphorylation sites with Ala at the same time and designated as T238A, S253A, T264A. In addition, rGnRHR with a deletion of C-terminal portion (Ala260-Leu265; Ala-Arg-Leu-Arg-Thr-Leu) of the third intracellular loop and rGnRHR with replacement of the deleted Ala260-Leu265 sequence with Ala-Ala-Arg-Thr-Leu-Ser, the C-terminal portion of the third intracellular loop of M1AchR, were generated.

Wt and mutant rGnRHRs were transiently expressed in GH3 cells. To compare the receptor expression and binding characteristics of wt rGnRHR with mutant receptors, receptor-binding assays were performed using a metabolically stable agonist of GnRH, 125I-buserelin. Scatchard analysis of the binding of 125I-buserelin is shown in Figure 1. Table 1 shows a comparison of receptor ligand-binding characteristics between wt rGnRHR and mutants. The S253A mutant showed a similar binding affinity to, and lower binding sites (reduction by 28%) than, the wt receptor (Fig. 1A). The T264A mutant showed a reduced binding affinity (1.55-fold lower compared with wt receptor) and fewer binding sites (reduction by 44%) (Fig. 1A). The T238A mutant showed a modest ligand-binding affinity (4.8-fold lower compared with wt receptor), while T238A, S253A, T264A triple mutant showed no measurable binding of buserelin (Fig. 1A). Rat GnRHR with a deletion of Ala260-Leu265, and rGnRHR with replacement of the deleted Ala260-Leu265 sequence with the portion of M1AchR, also showed no measurable binding of buserelin (Fig. 1B). Reverse transcription-polymerase chain reaction showed that there was no difference between the mRNA levels for the wt rGnRHR and mutant receptors (data not shown).



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 1. Scatchard plots for binding of 125-buserelin to GH3 cells expressing wt rGnRHR or mutant receptors. A) Binding of 125I-buserelin to GH3 cells expressing wt rGnRHR, mutant T238A, mutant S253A, mutant T264A, or triple-mutant T238A, S253A, T264A. B) Binding of 125I-buserelin to GH3 cells expressing wt rGnRHR or mutant receptors with deletion of Ala260-Leu265 or replacement of the deleted portion with the counterpart of M1Ach receptor. Seventy-two hours after transfection of GH3 cells, the cell suspension was incubated with increasing concentrations of 125I-buserelin, as indicated, for 3 h at 4°C. Cell-associated specific activity was measured (see Materials and Methods). Data shown are representative of one experiment that was repeated at least three times with similar results.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Ligand-binding characteristics of wt and mutant rGnRHR expressed in GH3 cells.*

Effects of Mutations of the Potential Phosphorylation Sites in the Third Intracellular Loop of rGnRHR on Receptor Signaling

A dose-response study of buserelin-stimulated IP production is shown in Figure 2. Two hours of stimulation with buserelin resulted in a significant, dose-dependent response in IP production from GH3 cells expressing wt rGnRHR, S253A, or T264A (Fig. 2A). The response of IP production from GH3 cells expressing S253A was significantly reduced compared with that observed for GH3 cells expressing wt receptor at 10-11-10-9 M buserelin treatment. The response of IP production from GH3 cells expressing T264A was significantly decreased compared with that observed for GH3 cells expressing wt receptor at 10-11-10-7 M buserelin treatment. Two-hour treatment with 10-13-10-9 M buserelin did not stimulate IP production from GH3 cells expressing mutant T238A, although an increase in IP production was observed at higher doses (10-8-10-7 M) of buserelin (Fig. 2A). There was no measurable elevation in IP production from GH3 cells expressing triple-mutant T238A, S253A, T264A (Fig. 2A), mutant receptor with deletion of Ala260-Leu265, or mutant receptor with replacement of deleted Ala260-Leu265 with M1AchR sequence at 10-13-10-7 M buserelin treatment (Fig. 2B).



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 2. Dose response of buserelin-stimulated IP production in GH3 cells expressing wt rGnRHR or mutant receptors. A) Buserelin-stimulated IP production in GH3 cells expressing wt rGnRHR, mutant T238A, mutant S253A, mutant T264A, or triple-mutant T238A, S253A, T264A. B) Buserelin-stimulated IP production in GH3 cells expressing wt rGnRHR or mutant receptors with deletion of Ala260-Leu265 or replacement of the deleted portion with the counterpart of M1Ach receptor. Forty-eight hours after transfection, the cells were preloaded with 4 µCi/ml [3H]inositol for 18 h. The GH3 cells were treated with medium or the indicated concentrations of buserelin for 2 h. Total IP production was determined by ion-exchange chromatography. The data shown are the means of triplicate determinations, represented by the percentage of control (treated with medium alone). Error bars show the SEM.

Incubation with 10-13-10-7 M buserelin for 24 h stimulated cAMP release in a dose-dependent manner in GH3 cells expressing wt rGnRHR, S253A, or T264A (Fig. 3, upper panel). However, there was no significant difference in buserelin-stimulated cAMP release between GH3 cells expressing wt rGnRHR and GH3 cells expressing mutant receptor. Similarly, a 24-h buserelin treatment stimulated PRL release in a dose-dependent manner in GH3 cells expressing wt receptor, S253A, or T264A (Fig. 3, lower panel), and there was no significant difference between the responses of wt receptor and mutant receptor.



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 3. Dose response of buserelin-stimulated cAMP release (upper panel) and PRL release (lower panel) in GH3 cells expressing wt rGnRHR, mutant S253A, or mutant T264A. For cAMP release, 48 h after transfection of GH3 cells with wt rGnRHR or mutant receptors, the cells were incubated with medium or the indicated concentrations of buserelin and 0.2 mM MIX for 24 h. The cAMP contents in medium collected were determined by RIA. For PRL release, 48 h after transfection, the GH3 cells were incubated with medium or the indicated concentrations of buserelin for 24 h. The medium was collected, and PRL release was measured by RIA. The data shown are the means of triplicate determinations, represented by the percentage of control (treated with medium alone). Error bars show the SEM.

Effects of Mutations of the Potential Phosphorylation Sites in the Third Intracellular Loop of rGnRHR on GnRH-Provoked Desensitization

Effects of GnRH pretreatment on buserelin-stimulated IP production was used to assess the influences of mutations of the potential phosphorylation sites in the third intracellular loop of the rGnRHR on GnRH-provoked desensitization (Fig. 4). One hour of stimulation with buserelin (10-11, 10-9, and 10-7 M) resulted in a significant, dose-dependent response in IP production from GH3 cells expressing wt rGnRHR, S253A, or T264A. Pretreatment with 10-7 M GnRH for 2 h significantly attenuated this stimulation of IP production by buserelin. In GH3 cells expressing wt rGnRHR, GnRH pretreatment attenuated maximal buserelin-stimulated IP production from 378.3% to 253.1% (percentage of control). In GH3 cells expressing S253A and GH3 cells expressing T264A, GnRH pretreatment attenuated maximal buserelin-stimulated IP production from 317.8% to 231.5% and from 296.0% to 233.8% (percentage of control), respectively.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 4. Influence of GnRH pretreatment on buserelin-stimulated IP production in GH3 cells expressing wt rGnRHR, mutant S253A, or mutant T264A. Forty-eight hours after transfection, the GH3 cells were preloaded with [3H]inositol for 18 h and then pretreated with medium or 10-7 M GnRH in DMEM (without inositol) for 2 h. The cells were washed twice with DMEM (inositol free) containing 5 mM LiCl and returned to the incubator at 37°C for 20 min; they were then treated with medium or buserelin at the indicated doses in DMEM (without inositol) containing 5 mM LiCl for 1 h. Total IP production was determined by ion-exchange chromatography. The data shown are the means of triplicate determinations, represented by the percentage of control (treated with medium alone). Error bars show the SEM.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In this study, mutational analysis of the potential phosphorylation sites and C-terminal portion of the third intracellular loop of the rGnRHR was performed to assess the significance of these sites and the region in the structural determination and function of the GnRHR. Mutation of one or all of the three potential phosphorylation sites had differential effects on receptor ligand binding. Mutant S253A and T264A showed similar receptor-binding affinity but a decreased number of binding sites compared with wt receptor. Mutant T238A or triple-mutant T238A, S253A, T264A showed only modest or nonmeasurable receptor binding. Mutations of the potential phosphorylation sites reduced buserelin-stimulated IP production, a reduction correlated with the alterations in receptor binding. Mutation of Ser253 and Thr264 did not significantly affect buserelin-stimulated cAMP production or cAMP-mediated PRL release. Deletion of a C-terminal portion, including a potential phosphorylation site, of the third intracellular loop abolished the receptor-binding affinity and receptor-mediated signal transduction. Replacement of the deleted C-terminal portion with a C-terminal portion of M1AchR failed to restore receptor function. In addition, mutants S253A and T264A did not show a change in the pattern of GnRH-provoked desensitization in terms of GnRH agonist-stimulated IP production.

The GnRHR is coupled to Gq/11, leading to activation of phospholipase C and IP turnover in gonadotroph cells [3–7]. In GGH3 cells (GH3 cells expressing rGnRHR), the GnRHR is coupled to Gq/11 as well as to Gs, which activates adenylate cyclase, leading to production of cAMP and cAMP-mediated PRL production and release [18, 28–30]. A recent study relying on palmitoylation of G proteins and overexpression of various G protein cDNAs showed that GnRHR couples to Gq/11 as well as to Gs and Gi in both GGH3 cells and pituitary gonadotrophs, suggesting that similar signal transduction pathways are employed to mediate GnRH action in GGH3 cells and in pituitary cells and that adenylate cyclase-cAMP signal transduction pathway is involved in GnRH action [31]. In the earlier study, mutational analyses of the second intracellular loop of the GnRHR revealed that the conserved Asp and Arg residues in the DRY motif are important for receptor structural integrity, expression, activation, and internalization [32, 33]. In addition, conserved Leu147 is important for both G protein coupling and agonist-induced receptor internalization, whereas Ser151, Ser153, Lys154, and Glu156 are important for receptor internalization but not for agonist-induced IP responses [32, 33]. Recently, mutation of Ala261 in the third intracellular loop of the human GnRHR caused a decrease in GnRH-induced IP production but retained the ability to bind ligand, indicating that the third intracellular loop of the GnRHR is also critical for G protein coupling as demonstrated in other GPCRs [34]. In the present study, mutation of Ser253 and Thr264, two potential phosphorylation sites in the third intracellular loop of the rGnRHR, to Ala retained receptor-binding affinity but showed decreased binding sites. The receptor-mediated signal transduction in terms of agonist-stimulated IP production was also decreased in S253A and T264A, in correlation with the decrease in receptor-binding sites. In addition, mutation of Thr238 to Ala or triple-mutant T238A, S253A, T264A abolished receptor-binding ability and signaling. These results suggest that mutation of Ser253 or Thr264 affects receptor expression on the cell surface, as the mutant receptor retained ligand-binding affinity but showed decreased binding sites and signaling. Mutation of Thr238 appears to affect receptor structure integrity, as the mutation abolished receptor-binding ability and signaling. The effect of mutation of Thr238 to Ala on the receptor structure may be explained by hindrance of the phosphorylation of receptor. On the other hand, several studies have shown that the charged amino acids located at the boundaries of the transmembrane segment are important determinants of the topology of the membrane-spanning proteins [35, 36]. In the current putative topology of the GnRHR described recently by Sealfon et al. [2], Thr238 and Thr264 are located at the boundaries of the third intracellular loop and transmembrane domains (fifth and sixth, respectively). Thus, mutation of either residue in the present study may have disturbed the charge balance or hydrogen bond potential in this region, which in turn could disrupt or destabilize the receptor topology and transmembrane segment assembly.

GnRH is released from the hypothalamus in a pulsatile pattern. The pulsatile pattern of GnRH maintains gonadotropin release, whereas constant or rapidly pulsed GnRH results in desensitization and diminished gonadotropin release [1]. The phenomenon of desensitization is ubiquitous in GPCR-mediated cell signaling. It has been shown that agonist-induced desensitization involves phosphorylation of GPCR by serine/threonine protein kinases (PKC, PKA, or GRKs) on the phosphorylation sites (Ser/Thr) localized mainly in the C-terminal tail and, more rarely, in the third intracellular loop [11]. Several GRK forms have been identified in {alpha}T3–1 gonadotroph cells, and overexpression of GRK inhibited GnRH-stimulated IP production in COS cells expressing GnRHR, suggesting the involvement of GRKs in the regulation of gonadotroph responsiveness to GnRH [37, 38]. However, sequence analysis of the cloned GnRHR revealed that the GnRHR completely lacks the intracellular C-terminal tail and potential Ser/Thr phosphorylation sites for GRKs in the intracellular domains [2]. Alternatively, several potential Ser/Thr phosphorylation sites for PKC, PKA, or casein kinase II were identified in the intracellular loops of the GnRHR [2, 12]. In the present study, single amino acid mutation (S253A and T264A) of two potential phosphorylation sites for PKC in the third intracellular loop did not affect GnRH-provoked desensitization in terms of agonist-stimulated IP production. In addition, mutation of another potential phosphorylation site (T238A) for PKC impaired receptor-binding affinity. These results suggest that the potential phosphorylation sites in the third intracellular loop of the GnRHR may not be functional or that the phosphorylation of the GnRHR by PKC does not contribute to the mechanism leading to desensitization. This is consistent with an earlier report indicating that phosphorylation of the epitope-tagged GnRHR is not associated with GnRH-provoked desensitization [39].

It was demonstrated that the intracellular domains, particularly the second and the third intracellular loops, and the membrane-proximal region of the intracellular C-terminal tail of GPCR are important for receptor-G protein coupling and specificity determination [8, 9]. In the previous study, overexpression of GGH3 cells with the cDNA for the third intracellular loop of rGnRHR inhibited agonist-stimulated signal transduction, indicating that the third loop of the rGnRHR is important for G protein coupling. In addition, this inhibition can be mimicked by overexpression of GGH3 cells with the cDNA for the third loop of Gq/11-coupled M1AchR or {alpha}1B-adrenergic receptor or Gs-coupled D1A dopamine receptor, suggesting that G protein can couple to different receptors in a nonspecific pattern [40]. In the present study, deletion of the C-terminal portion of the third intracellular loop including one of the potential phosphorylation sites abolished the receptor-binding affinity and signaling, probably due to the disruption of receptor structure. Replacement of the deleted portion with the counterpart in the third intracellular loop of M1AchR, which has been identified as a key region in Gq/11 protein recognition [41], did not restore the receptor ligand-binding ability. These results suggest that the region for G protein recognition may be also critical for receptor structure determination, which is receptor specific.


   ACKNOWLEDGMENTS
 
We are grateful to Drs. U.B. Kaiser and W.W. Chin for providing rGnRHR cDNA.


   FOOTNOTES
 
1 Supported by NIH grants HD-19899, HD-00163, and HD-18185. Back

2 Correspondence: P. Michael Conn, 505 NW 185th Ave., Beaverton, OR 97006. FAX: 503 690 5569; connm{at}ohsu.edu Back

Accepted: August 6, 1998.

Received: May 28, 1998.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Conn PM. The molecular mechanism of gonadotropin-releasing hormone action in the pituitary. In: Knobil E, Neill JD (eds.), The Physiology of Reproduction. New York: Raven Press; 1994: 1815–1832.
  2. Sealfon SC, Weinstein H, Millar RP. Molecular mechanisms of ligand interaction with the gonadotropin-releasing hormone receptor. Endocr Rev 1997; 18:180–205.[Abstract/Free Full Text]
  3. Hawes BE, Barnes S, Conn PM. Cholera toxin and pertussis toxin provoke differential effects on luteinizing hormone release, inositol phosphate production, and gonadotropin-releasing hormone (GnRH) receptor binding in the gonadotrope: evidence for multiple guanyl nucleotide binding proteins in GnRH action. Endocrinology 1993; 132:2124–2130.[Abstract/Free Full Text]
  4. Hsieh K-P, Martin TFJ. Thyrotropin-releasing hormone and gonadotropin-releasing hormone receptors activate phospholipase C by coupling to the guanosine triphosphate-binding proteins Gq and G11. Mol Endocrinol 1992; 6:1673–1681.[Abstract/Free Full Text]
  5. Shah BH, Milligan G. The gonadotropin-releasing hormone receptor of ßT3–1 pituitary cells regulates cellular levels of both of the phosphoinositidase C-linked G proteins, Gq{alpha} and G11{alpha}, equally. Mol Pharmacol 1994; 46:1–7.[Abstract]
  6. Stanislaus D, Janovick JA, Brothers S, Conn PM. Regulation of Gq/11{alpha} by the gonadotropin-releasing hormone receptor. Mol Endocrinol 1997; 11:738–746.[Abstract/Free Full Text]
  7. Conn PM, Janovick JA, Stanislaus D, Kuphal D, Jennes L. Molecular and cellular basis of gonadotropin-releasing hormone action in the pituitary and central nervous system. In: Litwack G (ed.), Vitamins and Hormones, vol. 50. New York: Academic Press; 1995: 151–214.
  8. Gudermann T, Schöneberg T, Schultz G. Functional and structural complexity of signal transduction via G-protein-coupled receptors. Annu Rev Neurosci 1997; 20:399–427.[CrossRef][Medline]
  9. Ulloa-Aguirre A, Conn PM. G protein-coupled receptors and the G protein family. In: Conn PM (ed.), Handbook of Physiology: Molecular and Cellular Endocrinology. New York: Oxford University Press; 1998:87–124.
  10. Hausdorff WP, Caron MG, Lefkowitz RJ. Turning off the signal: desensitization of ß-adrenergic receptor function. FASEB J 1990; 4:2881–2889.[Abstract]
  11. Freedman NJ, Lefkowitz RJ. Desensitization of G protein-coupled receptors. In: Conn PM (ed.), Recent Progress in Hormone Research, vol. 51. Bethesda: The Endocrine Society; 1996: 319–353.
  12. Davidson JS, Flanagan CA, Becker II, Illing N, Sealfon SC, Millar RP. Molecular function of the gonadotropin-releasing hormone receptor: insights from site-directed mutagenesis. Mol Cell Endocrinol 1994; 100:9–14.[CrossRef][Medline]
  13. Braden TD, Bervig T, Conn PM. Protein kinase-C activation stimulates synthesis of gonadotropin-releasing hormone (GnRH) receptors, but does not mediate GnRH-stimulated receptor synthesis. Endocrinology 1991; 129:2486–2490.[Abstract/Free Full Text]
  14. Braden TD, Hawes BE, Conn PM. Synthesis of GnRH receptors by gonadotrope cell cultures: both preexisting receptors and those unmasked by protein kinase C activators show a similar synthetic rate. Endocrinology 1989; 127:1623–1629.
  15. Huckle WR, McArdle CA, Conn PM. Differential sensitivity of gonadotropin-releasing hormone receptors to activators of protein kinase C, a marker for receptor activation. J Biol Chem 1988; 263:3296–3302.[Abstract/Free Full Text]
  16. Strulovici B, Tahilramani R, Nestor JJ. Phosphorylation substrates for protein kinase C in intact pituitary cells: characterization of a receptor-mediated event using novel gonadotropin-releasing hormone analogues. Biochemistry 1987; 26:6005–6011.[CrossRef][Medline]
  17. Turgeon JL, Cooper RH. Protein kinase C and an endogenous substrate associated with adenohypophyseal secretory granules. Biochem J 1986; 237:53–61.[Medline]
  18. Kaiser UB, Conn PM, Chin WW. Studies of gonadotropin-releasing hormone (GnRH) action using GnRH receptor-expressing pituitary cell lines. Endocr Rev 1997; 18:46–70.[Abstract/Free Full Text]
  19. Kaiser UB, Katzenellenbogen RA, Conn PM, Chin WW. Evidence that signalling pathways by which thyrotropin-releasing hormone and gonadotropin-releasing hormone act are both common and distinct. Mol Endocrinol 1994; 8:1038–1048.[Abstract/Free Full Text]
  20. Bonner TI, Buckley NJ, Young AC, Brann MR. Identification of a family of muscarinic acetylcholine receptor genes. Science 1987; 237:527–532.[Abstract/Free Full Text]
  21. Stanislaus D, Janovick JA, Jennes L, Kaiser UB, Chin WW, Conn PM. Functional and morphological characterization of four cell lines derived from GH3 cells stably transfected with gonadotropin-releasing hormone receptor complementary deoxyribonucleic acid. Endocrinology 1994; 135:2220–2227.[Abstract]
  22. Marian J, Conn PM. The calcium requirement in GnRH-stimulated LH release is not mediated through a specific action on receptor binding. Life Sci 1980; 27:87–92.[CrossRef][Medline]
  23. Huckle WR, Conn PM. The use of lithium ion in measurement of stimulated pituitary inositol phospholipid turnover. In: Conn PM, Means AR (eds.), Methods in Enzymology, vol. 141. Orlando: Academic Press; 1987: 149–155.
  24. Steiner AL, Parker CW, Kipnis DM. Radioimmunoassay for cyclic nucleotides. J Biol Chem 1972; 247:1106–1113.[Abstract/Free Full Text]
  25. Harper JF, Brooker G. Femtomole sensitive radioimmunoassay of cyclic AMP and cyclic GMP after 2'0 acetylation by acetic anhydride in aqueous solution. J Cyclic Nucleotide Res 1975; 1:207–218.[Medline]
  26. Andrews WV, Conn PM. Gonadotropin-releasing hormone stimulates mass changes in phosphoinositides and diacylglycerol accumulation in purified gonadotrope cell cultures. Endocrinology 1986; 118:1148–1158.[Abstract/Free Full Text]
  27. Hunter WM, Greenwood FC. Preparation of iodine-131 labeled growth hormone of high specific activity. Nature 1962; 194:795–496.
  28. Janovick JA, Conn PM. Gonadotropin-releasing hormone (GnRH)-receptor coupling to inositol phosphate and prolactin production in GH3 cells stably transfected with rat GnRH receptor complementary deoxyribonucleic acid. Endocrinology 1994; 135:2214–2219.[Abstract]
  29. Kuphal D, Janovick JA, Kaiser UB, Chin WW, Conn PM. Stable transfection of GH3 cells with rat gonadotropin-releasing hormone receptor complementary deoxyribonucleic acid results in expression of a receptor coupled to cyclic adenosine 3',5'-monophosphate-dependent prolactin release via a G-protein. Endocrinology 1994; 135:315–320.[Abstract]
  30. Lin X, Janovick JA, Brothers S, Blomenröhr M, Bogerd J, Conn PM. Addition of catfish gonadotropin-releasing hormone (GnRH) receptor intracellular carboxyl-terminal tail to rat GnRH receptor alters receptor expression and regulation. Mol Endocrinol 1998; 12:161–171.[Abstract/Free Full Text]
  31. Stanislaus D, Ponder S, Ji TH, Conn PM. Gonadotropin-releasing hormone receptor couples to multiple G-proteins in gonadotrophs and in GGH3 cells: evidence from palmitoylation and overexpression of G-proteins. Biol Reprod 1998; 59:579–586.[Abstract/Free Full Text]
  32. Arora KK, Sakai A, Catt KJ. Effects of second intracellular loop mutations on signal transduction and internalization of the gonadotropin-releasing hormone receptor. J Biol Chem 1995; 270:22820–22826.[Abstract/Free Full Text]
  33. Arora KK, Cheng Z, Catt KJ. Mutations of the conserved DRS motif in the second intracellular loop of the gonadotropin-releasing hormone receptor affect expression, activation, and internalization. Mol Endocrinol 1997; 11:1203–1212.[Abstract/Free Full Text]
  34. Myburgh DB, Millar RP, Hapgood JP. Alanine-261 in intracellular loop III of the human gonadotropin-releasing hormone receptor is crucial for G-protein coupling and receptor internalization. Biochem J 1998; 331:893–896.
  35. Dalbey RE. Positively charged residues are important determinants of membrane protein topology. Trends Biochem Sci 1990; 15:253–257.[CrossRef][Medline]
  36. Boyd D, Beckwith J. The role of charged amino acids in the localization of secreted and membrane proteins. Cell 1990; 62:1031–1033.[CrossRef][Medline]
  37. Neill JD, Musgrove LC, Sellers JC, Duck LW. Identification by polymerase chain reaction of the G protein-coupled receptor kinases expressed in the mouse gonadotropic {alpha}T3–1 cell line. Endocrinology 1996; 137:3942–3947.[Abstract]
  38. Neill JD, Duck LW, Musgrove LC, Sellers JC. Potential regulatory roles for G protein-coupled receptor kinases and ß-arrestins in gonadotropin-releasing hormone receptor signaling. Endocrinology 1998; 139:1781–1788.[Abstract/Free Full Text]
  39. Neill JD, Sellers JC, Musgrove LC, Duck LW. Epitope-tagged gonadotropin-releasing hormone receptors heterologously-expressed in mammalian (COS-1) and insect (Sf9) cells. Mol Cell Endocrinol 1997; 127:143–154.[CrossRef][Medline]
  40. Ulloa-Aguirre A, Stanislaus D, Arora V, Vaananen J, Brothers S, Janovick JA, Conn PM. The third intracellular loop of the rat gonadotropin-releasing hormone (GnRH) receptor couples the receptor to Gs- and Gq/11-mediated signal transduction pathways: evidence from loop fragment transfection in GGH3 cells. Endocrinology 1998; 139:2472–2478.[Abstract/Free Full Text]
  41. Wess J. Molecular biology of muscarinic acetylcholine receptors. Crit Rev Neurobiol 1996; 10:69–99.[Medline]



This article has been cited by other articles:


Home page
 Endocr. Rev.Home page
R. P. Millar, Z.-L. Lu, A. J. Pawson, C. A. Flanagan, K. Morgan, and S. R. Maudsley
Gonadotropin-Releasing Hormone Receptors
Endocr. Rev., April 1, 2004; 25(2): 235 - 275.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
A. Chamson-Reig, E. M. Sorianello, P. N. Catalano, M. O. Fernandez, O. P. Pignataro, C. Libertun, and V. A. R. Lux-Lantos
Gonadotropin-Releasing Hormone Signaling Pathways in an Experimental Ovarian Tumor
Endocrinology, July 1, 2003; 144(7): 2957 - 2966.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H.-O. Chung, Q. Yang, K. J. Catt, and K. K. Arora
Expression and Function of the Gonadotropin-releasing Hormone Receptor Are Dependent on a Conserved Apolar Amino Acid in the Third Intracellular Loop
J. Biol. Chem., December 10, 1999; 274(50): 35756 - 35762.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lin, X.
Right arrow Articles by Conn, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lin, X.
Right arrow Articles by Conn, P. M.
Agricola
Right arrow Articles by Lin, X.
Right arrow Articles by Conn, P. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS