| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
a Schepens Eye Research Institute and Department of Ophthalmology, Harvard Medical School,Boston, Massachusetts 02114
b Department of Medicine, Denver Health Medical Center, Denver, Colorado 80204
c Departments of Medicine and Anatomic Pathology, VA Medical Center and University of Minnesota,Minneapolis, Minnesota 55417
d Brigham and Women's Hospital, Boston, Massachusetts 02115
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
With the exception of MUCs 3 and 7, all the cloned mucins have been reported to be expressed in the endocervix; however, presence of MUC2 appears to be sporadic [13–15]. Messenger RNA of MUCs 1, 4, 5AC, 5B, 6, and 8 are of sufficient amount to be detectable by Northern blot analysis [13, 16]; and all of these, with the exception of MUC8, have been demonstrated in endocervical epithelium by in situ hybridization [13–15]. By in situ hybridization, message for MUC4 and 5AC was more intense in luminal epithelia than in glandular epithelia, with MUC5B and 6 being equal in luminal and glandular epithelia [13]. In most of the studies of mucin mRNA tissue distribution, oligonucleotide or cDNA probes to the tandem repeat sequences have been used. Since these probes can bind to multiple sites on the mucin mRNA and since the numbers of tandem repeats in most mucins vary from individual to individual, tandem repeat probes are not useful for quantitative analysis. To compare amounts of message in tissues in which multiple mucins are expressed, or to reliably compare amounts of mRNA between differing tissue/cell conditions (i.e., stages of menstrual cycle), probes from nontandem repeat regions are necessary.
Just prior to ovulation, the cervical mucus changes character, from a thick viscous gel to a watery consistency, to allow sperm penetrance [1–4]. The molecular nature of this change is unknown. To begin to understand the change in character, we wished to determine the relative amounts of the gel-forming mucins at the mRNA level in the cervical cells in relation to the menstrual cycle. To that end, the purpose of this study was to determine the relative amounts of mRNA of the three known gel-forming mucins expressed in the endocervix, for which mRNA has been shown at levels demonstrable by both Northern blot analysis and in situ hybridization. These include MUCs 5AC, 5B, and 6. MUC4, a relatively uncharacterized mucin for which only tandem repeat sequence has been published, has been reported to be the dominant mucin of the endocervix as measured by in situ hybridization using oligonucleotides to its tandem repeat sequence [15]. In order to measure MUC4 mRNA, we obtained nontandem repeat sequence from a genomic clone to allow quantitative analysis of MUC4 mRNA in relationship to the gel-forming mucins MUCs 5AC, 5B, and 6.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Human endocervical epithelium was obtained by cytobrush from normal cycling females [17]. Samples were obtained every two weeks over 2 mo such that each week of the 4-wk menstrual cycle was represented. Cytobrush sampling of the cervical epithelium may yield more luminal cell mRNA than glandular cell mRNA. While there may be sampling bias in favor of luminal cells, this is not considered problematic since, in our previous in situ hybridization studies, we demonstrated that luminal and glandular epithelia both expressed all the mucin genes, with luminal expression greater than or equal to that of the glandular cells [13].
Blood samples were taken at the time of cytobrush sampling whenever possible. All tissue and blood collections were done in accordance with human studies guidelines, and approval and informed consent were obtained from all human subjects in accordance with a protocol approved by Schepens Eye Research Institute's IRB. In this study, total RNA was isolated using Trizol reagent (Gibco BRL Life Technologies, Gaithersburg, MD) according to manufacturer's recommendations. Correlative blood levels of estradiol and progesterone were determined by the Assay Core Laboratory of the Reproductive Endocrine Sciences Center, Massachusetts General Hospital, Boston, MA (funded by NIH Grant #HD28138) using techniques of Crowley et al. [18] and Filicori et al. [19], respectively.
Derivation of MUC4 Genomic Clone and MUC4 Sequencing
A genomic clone for MUC4 was obtained by screening a human bacterial artificial chromosome library (Genome Systems, St. Louis, MO) with a 220-base pair (bp) MUC4 tandem repeat cDNA probe generated by polymerase chain reaction (PCR), using primers (5'ACGCCTCTTCCTGTCACTAG, 3'ACCTGTGGAGAGTGAGGAAAG) from the published MUC4 tandem repeat sequence [12]. The genomic clone was digested with ApaI or PstI, and the resulting fragments were checked by Southern blot analysis for hybridization with specific MUC4 probes (see Results). Fragments were subcloned into pBluescript KS(+) vector (Stratagene, La Jolla, CA) for sequencing. The fragments were partially sequenced using the dideoxy-mediated chain termination method as previously described [20]. Sequence information was analyzed using Genetics Computer Group software (Madison, WI). Nucleotide sequence outside the tandem repeat region was obtained, and PCR primers (Table 1) were designed to give a 236-bp nontandem repeat cDNA.
|
Semiquantitative Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Semiquantitative RT-PCR for analysis of endocervical mRNA in relation to menstrual cycle has been successfully applied in studies of cytokines and their receptors [21] and expression of cystic fibrosis transmembrane receptor [17]. We used a similar approach. In this study, total RNA (0.5 µg/sample) was reverse-transcribed using random hexamer primers as previously described [22]. An aliquot (one-tenth the total volume) of the same RT products per cytobrush sample was used in the PCR amplification reaction for each of the mucin genes investigated.
Oligonucleotide primers to the nontandem repeat region of MUCs 5AC, 5B, and 6 (Table 1) were designed from published sequences [23–25]; those to the nontandem repeat region of MUC4 (Table 1) were designed from new sequences obtained from a genomic clone of MUC4 (see Figs. 1 and 2). PCR amplifications were performed as previously described [22]. The sequence of each PCR product was confirmed by the dideoxy-mediated chain termination method. PCR amplimer sets for ß-actin, glyceraldehyde-3-phosphate dehydrogenase, transferrin, and ß2-microglobulin (Clontech, Palo Alto, CA) were tested on RT products from several stages of the cycle to determine the best control gene. ß2-microglobulin was chosen because it showed no variations correlated to cycle. The PCR primers for MUC5B span an intron, so genomic contamination was easily ruled out for all samples. The linear range of the amplification reaction for ß2-microglobulin and MUCs 4 and 5B was determined by checking amplification after each cycle from cycles 24–35. From these determinations, 27 cycles (midlinear phase for all three) were chosen for amplification of all genes. Some endocervical samples showing no amplification after 27 cycles were checked after 35–40 cycles of amplification to verify presence of low copy numbers of message.
|
|
PCR Parameters
All PCR amplifications started with denaturation for 5 min at 94°C and ended with a final elongation at 72°C for 7 min. The parameters for the 27 cycles of amplification were optimized for each gene using endocervical and control tissue RT products and are as follows: ß2-microglobulin: 94°C for 45 sec, 55°C for 45 sec, 72°C for 1 min; MUC4: 94°C for 45 sec, 60°C for 45 sec, 72°C for 2 min; MUC5AC: 94°C for 30 sec, 55°C for 1 min, 72°C for 1 min; MUC5B: 94°C for 30 sec, 55°C for 1 min, 72°C for 1 min; MUC6: 94°C for 40 sec, 64°C for 1 min, 72°C for 2 min.
Quantitation of PCR Products
PCR products were run on standardized 1% agarose gels, stained with ethidium bromide, and photographed with Polaroid (Cambridge, MA) Type 665 positive/negative film. The amount of amplified products was quantified for each sample from the Polaroid negatives using a Molecular Dynamics Computing Densitometer Model 300A and ImageQuant Software Version 2.0 (Molecular Dynamics, Sunnyvale, CA). Each value was determined as the mean of four densitometry readings. The final amount of PCR product was expressed as the ratio of mucin gene amplified to that of ß2-microglobulin to account for any differences in starting amounts of RNA.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Isolation and Sequencing of the MUC4 Genomic Clone
The published sequence of MUC4 is from the tandem repeat region of the molecule [12]. Since quantitation with probes or primers to tandem repeat sequence does not accurately reflect copy number of mRNA, we cloned and sequenced a coding but nontandem repeat region of a MUC4 genomic clone. A 220-bp cDNA to MUC4 tandem repeat region (see Materials and Methods for details) was used to screen a bacterial artificial chromosome library. The resultant genomic clone of approximately 60 kilobases (kb) was digested with endonucleases, and the resulting fragments were analyzed. ApaI digestion resulted in a fragment of approximately 10 kb, which hybridized with the MUC4 tandem repeat probe by Southern blot (data not shown). A 671-bp sequence was obtained directly 5' to the tandem repeat region (Fig. 1). Sequencing of the 3' end of the 10-kb fragment yielded 33 bp downstream from tandem repeat sequence (Fig. 1). Primers to the 5' nontandem repeat sequence, spanning the end of the tandem repeat region and an upstream position of about 720 bp upstream, were used for RT-PCR on DNase-treated endocervical epithelial RNA. The PCR yielded a 720-bp product that upon sequencing matched the genomic sequence in size and identity, thus indicating that the region sequenced 5' to tandem repeat is coding (exon).
A 236-bp cDNA obtained by PCR was designed from this nontandem repeat region and was used to screen a PstI digest of the genomic clone. A 505-bp fragment was identified, which yielded an additional 110 bp beyond the 5' end of the 10-kb fragment. A 38-mer oligonucleotide from the new sequence was used to screen an ApaI digest of the genomic clone, and an additional 5-kb fragment containing no tandem repeat sequence was identified. Partial sequence of this fragment yielded an additional 1898 bp from the 3' region. Thus a total of approximately 2.7 kb (2679 bp) sequence 5' to the tandem repeat has been obtained.
To confirm the sequence obtained from the genomic clone, several additional sets of PCR primers were designed for RT-PCR on endocervical epithelial RNA known to be free of genomic contamination. (It is known to be free of genomic contamination because MUC5B primer sets, which span an intron, showed only one band corresponding to the cDNA size. See Table 1.) Sequencing of the resulting RT-PCR products, which span the entire 2679 bp 5' to the tandem repeat, yielded sequence that was 99.9% identical to that obtained from the genomic clone, with mismatches in only 4 bases. Thus, the entire sequence of the nontandem repeat region 5' to the tandem repeat region reported here is from the coding region (exon) of the MUC4 gene.
The whole nontandem repeat region is rich in serine and threonine, 20% and 22%, respectively, with 7.7% proline content. No cysteine-rich regions or D-domains common to the gel-forming mucins on chromosome 11p15.5 have been identified. The short nontandem repeat sequence of 11 amino acids (AA) located 3' to the tandem repeat region is also rich in serine but not threonine.
Semiquantitative RT-PCR Analysis of Message Levels of MUCs 4, 5AC, 5B, and 6 in Endocervical Epithelium
To ensure optimal PCR conditions for each mucin primer set, preliminary experiments using varying annealing temperatures and various denaturation, annealing, and extension times were performed. Optimal conditions were established and are listed in Materials and Methods. Amplification of genomic DNA with the MUC5B primers yields a larger product than by RT-PCR (~2 kb). Thus, these primers spanned an intron, and since the same RT products were used for all primer sets, the 5B amplification served as control to ensure lack of genomic DNA contamination throughout. No genomic contamination was evident in any of the experimental samples.
A total of 21 samples of cytobrush-derived endocervical RNA were assayed. These samples were taken from six individual subjects. From each of four subjects, four samples were taken, one from each week of the menstrual cycle, over a 2-mo period. From one subject, three samples were obtained, and from the remaining subject, two samples were obtained. Yield of RNA per cytobrush samples varied from 1.6 µg to 54.4 µg. The average yield was 20 µg.
To appropriately compare message levels of several genes within experimental groups, the linear phase of amplification must be demonstrated [26]. For MUC4, 5B, and the control housekeeping gene, ß2-microglobulin, which did not show variation with cycle, the linear phase was established at 27 cycles of amplification. In 2 samples, MUC4 and 5B did not amplify at 27 cycles; but when amplified by 40 cycles, samples showed the presence of MUC4 mRNA but not 5B. In no samples was MUC5AC amplified at 27 cycles, but in all it was amplified at 40 cycles. In 7 of 21 samples, MUC6 mRNA was amplified at 40 cycles (Table 2 and Fig. 2). Those samples in which MUC6 was amplified were samples taken at the beginning of the menstrual cycle, when high levels of both MUC4 and 5B were amplified. These data indicate that MUC4 and MUC5B mRNA are the predominant mucin message.
|
Densitometric comparisons of MUC4 and 5B message level to that of the ß2-microglobulin of each of these samples were obtained. In 15 of the 21 samples from six subjects, MUC4:ß2 ratios were greater than MUC5B:ß2 ratios. In 5 samples, MUC5B:ß2 ratios were greater, and in one instance, the 4:ß2 ratio was equal to the 5B:ß2 ratio.
Progesterone and estradiol levels from peripheral blood samples obtained at the time of cytobrush sampling were correlated with MUC4:ß2 and MUC5B:ß2 ratios in 18 of the 21 samples. There was a consistent inverse relationship between MUC4 and MUC5B message levels and blood progesterone levels (Fig. 3), which reflects a decrease in message following ovulation at midcycle. These data correlated with subject self-report of cycle day, with one exception: with subject 2, we did not have samples after midcycle (Fig. 4). There was no apparent correlation between mucin mRNA and blood estradiol levels (data not shown).
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The identification of MUC4 and MUC5B as major mucins in the endocervix raises questions regarding the physiologic roles of each of these mucins. While it is clear that MUC5B is a large, secreted, gel-forming mucin [24, 27], the role and character of MUC4 mucin is unknown. In contrast to the situation for mucins (MUC2, 5AC, 5B, and 6) of the 11p15.5 cluster, in which cysteine-rich D-domains occur within or adjacent to tandem repeat sequence [10, 24, 25, 27, 28], no similarities to the D-domain regions were found in the MUC4 nontandem repeat sequence reported here. The presence of message to MUC4 in the stratified epithelium of the ectocervix, vagina [13], and conjunctiva [29], not generally considered to be secretory epithelia, raises the possibility that MUC4 is not a secreted gel-forming mucin. Further data suggesting that MUC4 is not a secreted mucin come from results we have reported on expression cloning of a human cervix secretory mucin cDNA using antibodies against deglycosylated, secreted endocervical mucins (unpublished results). These results show unequivocally that MUC5B is the major secreted mucin, since sequencing of the clones obtained by screening of an endocervical library identified predominantly MUC5B. No MUC4 clones were obtained by this method despite the isolation of MUC4 clones from the library by tandem repeat probe hybridization (unpublished results). Thus, the lack of representation of MUC4 within the expression cloning positives cannot be due to decreased stability of the message. Clues to the structure and possible function of MUC4 will undoubtedly be forthcoming as the complete sequence becomes known.
While this paper was under review, Nollet et al. [30] reported the sequence of the 5' region of MUC4. Their coding sequence extends 86 AA 5' to that reported in this paper. There is, however, a large intervening intron between the first 27 AA of the C-terminus and the sequence reported herein. Our sequence differs from that reported by Nollet et al. [30] in one important aspect—particularly relevant to the data reported here. That difference is within the 236-bp cDNA we used for semiquantitative RT-PCR to measure cycle variance of MUC4 mRNA. The sequence we obtained for this region is uniformly rich in serine and threonine and is consistent with sequence 5' and 3' to it. The sequence reported by Nollet et al. [30] inserts a guanidine at their bp 2436 and deletes a cytosine at bp 2515, leading to an unusual 26 AA sequence with an RKRR tetrabasic AA site. We have confirmed the genomic sequence reported in this paper by sequencing PCR products from four different tissue samples, three endocervix derived and one trachea derived.
A major conclusion that can be drawn from the data is that expression of both MUC4 and 5B is inversely proportional to progesterone levels, with no apparent correlation to estradiol levels. Increased MUC4 and 5B expression in the first half of the menstrual cycle followed by lower mRNA in the latter half, when progesterone levels increase, suggests that alteration of mucin gene expression is not responsible for the midcycle change in mucin character from viscous to watery [1, 3, 4]. However, samples collected were not clustered around the midcycle ovulatory phase, perhaps reflecting the lack of precise enough time points to capture abrupt changes in gene expression. Although we did have two samples obtained during the time of high progesterone levels in which MUC4 and 5B were at very low levels or were not detected, this was at the far end of the menstrual cycle rather than midcycle, during which mucin character changes.
In contrast to our data demonstrating an inverse relationship between MUC4 and 5B expression and progesterone levels in human endocervix, Audie et al. [15] found, using in situ hybridization with tandem repeat probes, the most intense labeling to MUC4 during the luteal phase, when progesterone levels are highest [15]. They found no variation in the other mucins they surveyed by in situ hybridization (MUCs 2, 3, 4, 5AC, 5B, and 6). These differences may be related to use of the nonquantitative assay, in situ hybridization using tandem repeat probes, and the variability in RNA preservation that may occur between different tissue preparations [10].
Although considerable information is available on the estradiol/progesterone regulation of expression of the membrane-spanning mucin MUC1 in uterine or mammary epithelium of several species [31–33], little information is available on effects of these hormones on expression of the large secreted mucins. Histochemical and histological studies in rodent species indicate that progesterone induces "mucification" of the cervical/vaginal epithelia [34, 35]. However, these rodent species have different patterns of cervical and vaginal epithelial differentiation with estrus as compared to cycling primates and humans. Sequence analysis of promoter regions of the human mucin genes will undoubtedly yield information relevant to these observations. Additionally, studies of promoters of endocervical epithelium mucin genes may also be useful, since tissue-specific regulation may occur.
|
FOOTNOTES |
|---|
2 Correspondence: Ilene K. Gipson, Schepens Eye Research Institute, 20 Staniford Street, Boston, MA 02114. FAX: 617 912 0126; gipson{at}vision.eri.harvard.edu
Accepted: August 25, 1998.
Received: June 19, 1998.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  P. Vigil, M. E. Cortes, A. Zuniga, J. Riquelme, and F. Ceric Scanning electron and light microscopy study of the cervical mucus in women with polycystic ovary syndrome J. Electron Microsc. (Tokyo), January 12, 2009; (2009) dfn032v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Brunelli, M. Papi, G. Arcovito, A. Bompiani, M. Castagnola, T. Parasassi, B. Sampaolese, F. Vincenzoni, and M. De Spirito Globular structure of human ovulatory cervical mucus FASEB J, December 1, 2007; 21(14): 3872 - 3876. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Andersch-Bjorkman, K. A. Thomsson, J. M. Holmen Larsson, E. Ekerhovd, and G. C. Hansson Large Scale Identification of Proteins, Mucins, and Their O-Glycosylation in the Endocervical Mucus during the Menstrual Cycle Mol. Cell. Proteomics, April 1, 2007; 6(4): 708 - 716. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. K. Lai, D. E. O'Hanlon, S. Harrold, S. T. Man, Y.-Y. Wang, R. Cone, and J. Hanes Rapid transport of large polymeric nanoparticles in fresh undiluted human mucus PNAS, January 30, 2007; 104(5): 1482 - 1487. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. L. Russo, S. Spurr-Michaud, A. Tisdale, J. Pudney, D. Anderson, and I. K. Gipson Mucin gene expression in human male urogenital tract epithelia Hum. Reprod., November 1, 2006; 21(11): 2783 - 2793. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Tamada, H. Shibahara, M. Higashi, M. Goto, S. K. Batra, K. Imai, and S. Yonezawa MUC4 Is a Novel Prognostic Factor of Extrahepatic Bile Duct Carcinoma. Clin. Cancer Res., July 15, 2006; 12(14): 4257 - 4264. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Sonora, D. Mazal, N. Berois, M.-P. Buisine, L. Ubillos, M. Varangot, E. Barrios, J. Carzoglio, J.-P. Aubert, and E. Osinaga Immunohistochemical Analysis of MUC5B Apomucin Expression in Breast Cancer and Non-malignant Breast Tissues J. Histochem. Cytochem., March 1, 2006; 54(3): 289 - 299. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Hori, S. J. Spurr-Michaud, C. L. Russo, P. Argueso, and I. K. Gipson Effect of Retinoic Acid on Gene Expression in Human Conjunctival Epithelium: Secretory Phospholipase A2 Mediates Retinoic Acid Induction of MUC16 Invest. Ophthalmol. Vis. Sci., November 1, 2005; 46(11): 4050 - 4061. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Ceric, D. Silva, and P. Vigil Ultrastructure of the human periovulatory cervical mucus J. Electron Microsc. (Tokyo), October 1, 2005; 54(5): 479 - 484. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M Saitou, M Goto, M Horinouchi, S Tamada, K Nagata, T Hamada, M Osako, S Takao, S K Batra, T Aikou, et al. MUC4 expression is a novel prognostic factor in patients with invasive ductal carcinoma of the pancreas J. Clin. Pathol., August 1, 2005; 58(8): 845 - 852. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. K. Gipson, S. Spurr-Michaud, P. Argueso, A. Tisdale, T. F. Ng, and C. L. Russo Mucin Gene Expression in Immortalized Human Corneal-Limbal and Conjunctival Epithelial Cell Lines Invest. Ophthalmol. Vis. Sci., June 1, 2003; 44(6): 2496 - 2506. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Argueso, S. Spurr-Michaud, A. Tisdale, and I. K. Gipson Variation in the Amount of T Antigen and N-Acetyllactosamine Oligosaccharides in Human Cervical Mucus Secretions with the Menstrual Cycle J. Clin. Endocrinol. Metab., December 1, 2002; 87(12): 5641 - 5648. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Espinosa, G. Noe, C. Troncoso, S.B. Ho, and M. Villalon Acidic pH and increasing [Ca2+] reduce the swelling of mucins in primary cultures of human cervical cells Hum. Reprod., August 1, 2002; 17(8): 1964 - 1972. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R Wiggins, S J Hicks, P W Soothill, M R Millar, and A P Corfield Mucinases and sialidases: their role in the pathogenesis of sexually transmitted infections in the female genital tract Sex Transm Inf, December 1, 2001; 77(6): 402 - 408. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. K. Gipson, R. Moccia, S. Spurr-Michaud, P. Argüeso, A. R. Gargiulo, J. A. Hill III, G. D. Offner, and H. T. Keutmann The Amount of MUC5B Mucin in Cervical Mucus Peaks at Midcycle J. Clin. Endocrinol. Metab., February 1, 2001; 86(2): 594 - 600. [Abstract] [Full Text]
|
|
|
|
 |
|
 G.D. Offner and R.F. Troxler Heterogeneity of High-molecular-weight Human Salivary Mucins Advances in Dental Research, December 1, 2000; 14(1): 69 - 75. [Abstract] [PDF]
|
|
|
|
|
|
M. Tei, S. J. Spurr–Michaud, A. S. Tisdale, and I. K. Gipson Vitamin A Deficiency Alters the Expression of Mucin Genes by the Rat Ocular Surface Epithelium Invest. Ophthalmol. Vis. Sci., January 1, 2000; 41(1): 82 - 88. [Abstract] [Full Text]
|
|
|
|
 |
|
 N. Idris and K. L. Carraway Sialomucin Complex (Muc4) Expression in the Rat Female Reproductive Tract Biol Reprod, December 1, 1999; 61(6): 1431 - 1438. [Abstract] [Full Text]
|
|
|
|
|
|
M. Tei, R. Moccia, and I. K. Gipson Developmental Expression Of Mucin Genes ASGP (rMuc4) and rMuc5ac by the Rat Ocular Surface Epithelium Invest. Ophthalmol. Vis. Sci., August 1, 1999; 40(9): 1944 - 1951. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Choudhury, R. K. Singh, N. Moniaux, T. H. El-Metwally, J.-P. Aubert, and S. K. Batra Retinoic Acid-dependent Transforming Growth Factor-beta 2-mediated Induction of MUC4 Mucin Expression in Human Pancreatic Tumor Cells Follows Retinoic Acid Receptor-alpha Signaling Pathway J. Biol. Chem., October 20, 2000; 275(43): 33929 - 33936. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
