Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fuchs, A.-R.
Right arrow Articles by Fields, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fuchs, A.-R.
Right arrow Articles by Fields, M. J.
Agricola
Right arrow Articles by Fuchs, A.-R.
Right arrow Articles by Fields, M. J.
Biology of Reproduction 60, 341-348 (1999)
©Copyright 1999 Society for the Study of Reproduction, Inc.

Accumulation of Cyclooxygenase-2 Gene Transcripts in Uterine Tissues of Pregnant and Parturient Cows: Stimulation by Oxytocin1

Anna-Riitta Fuchs2,a, Werner Rustb, and Michael J. Fieldsc

a Department of Obstetrics and Gynecology, Cornell University Medical College, New York, New York 10021 b Institute for Hormone and Fertility Research, University of Hamburg, 22529 Hamburg, Germany c Animal Science Department, University of Florida, Gainesville, Florida 32601


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cyclooxygenase 1 and 2 (COX-1 and COX-2) mRNA were measured by ribonuclease protection assays in total RNA extracted from intercaruncular and caruncular endometrium, myometrium, cotyledons, and cervical mucosa of pregnant cows. Tissues were obtained at gestational ages of 150 days and 275 days and at term not in labor, at term in labor, and 6–12 h postpartum. Additionally, the effect of oxytocin (OT) on COX-2 expression was determined in intercaruncular endometrium of six third-trimester cows (between 230 and 270 days of pregnancy), three of which were injected with OT (200 IU) and three with saline 2 h before tissues were harvested. Prostaglandin F2{alpha} (PGF2{alpha}) metabolite was measured in plasma samples taken at 15-min intervals before and after the injections. Results showed that COX-2 mRNA was expressed in every type of tissue examined, although in different concentrations and beginning at different stages. Other than in seminal vesicular and prostate glands used as positive controls, low concentrations of COX-1 mRNA were detected only in myometrium and caruncles. Cotyledons had the highest concentration of COX-2 transcripts at all stages studied. Caruncles had about half the concentration of COX-2 transcripts that was seen in cotyledons, and on Day 150 even less. COX-2 mRNA expression in both tissues increased with advancing gestation, but there was no difference between samples from term-no-labor and term-in-labor cows. COX-2 mRNA concentrations in endometrium and myometrium were low; they varied randomly during pregnancy with no significant increase until postpartum, when COX-2 transcripts in endometrium had increased severalfold whereas those in myometrium were similar to values before parturition. Cervical mucosa expressed COX-2 mRNA weakly until term but had increased markedly at parturition. Injection of 200 IU of OT induced a substantial increase in endometrial COX-2 mRNA concentration within 2 h; this was associated with linearly increasing plasma concentrations of 13,14-hydroxy-15-keto-prostaglandin F2{alpha}, which were still rising at termination of the experiment. The results suggest that endogenous OT is a major factor in induction of COX-2 expression and PGF2{alpha} release at term and during parturition in cows.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Two isoforms of cyclooxygenase enzyme, also known as prostaglandin endoperoxide H synthase, have been identified: cyclooxygenases 1 and 2 (COX-1, COX-2) [1–3]. The two isoforms generate the same prostanoids but are encoded by different genes, which are mapped on different chromosomes and are differently regulated. The genes for each isoform show considerable sequence homology between species (around 90%), whereas the genes for the two isoforms show only about 60% sequence homology within any one species [1, 4]. The COX-1 isoform of the enzyme is presumed to be ubiquitously present, albeit in low concentrations, and to function as a "housekeeping" enzyme that is constitutively expressed. COX-1 isoform of the enzyme can produce prostanoids rapidly from both endogenous and exogenous precursors when need for prostanoids arises in the tissue. The gene for the COX-2 isoform is an immediate early gene, the transcription of which is induced by specific ligands that activate the normally quiescent gene. Mitogens, cytokines, and tumor promoters are such ligands [5, 6]. Except in the brain and kidney, which seem to express COX-2 constitutively, the concentration of COX-2 gene transcripts is normally below detection limit, and production of prostanoids by this isoform usually occurs with a certain delay [2].

Prostanoid production in tissues of the reproductive tract is regulated by steroid hormones, but the roles of the individual steroids are not fully understood and seem to vary among species and tissues. In the female, both estrogen and progesterone are involved, apparently in a tissue- and species-specific manner. In the past an association was found with increasing plasma estrogen levels and prostaglandin (PG) production in endometrium and decidua of rats, guinea pigs, rhesus monkeys, and women ([7], and references therein). Estrogen was associated with increased PG production, immunoreactive COX-2 enzyme concentration, and/or COX-2 transcription in endometrial cell cultures from nonpregnant guinea pigs [8] and cows [9], as well as in rat uterine tissues in vivo [10]. On the other hand, ovarian steroids had no effect on COX-2 gene expression in the mouse uterus in early pregnancy [11]. Progesterone was found to increase COX-2 transcription severalfold and to have no effect on COX-1 mRNA in ovariectomized ewes; administration of estradiol enhanced COX-1 gene expression somewhat [12, 13].

In endometrium of prepubertal heifers, progesterone pretreatment was necessary for COX-2 transcription and oxytocin (OT)-induced prostaglandin F2{alpha} (PGF2{alpha}) release in spite of significant reduction of OT receptor concentrations by progesterone [14]. Estrogen treatment had no effect on either parameter, but in combination with progesterone, estradiol caused substantial enhancement of COX-2 mRNA accumulation and PGF2{alpha} release [14]. During bovine pregnancy, secretion of estrogen and progesterone increases markedly, potentially leading to induction of COX-2 mRNA expression and PG release. Indeed, from Day 50 onward, OT elicits release of PGF2{alpha} in pregnant cows in increasing amounts as gestational age advances [15]. PGF2{alpha} is luteolytic in cows; therefore increased production of PGF2{alpha} could be detrimental for the maintenance of pregnancy. The purpose of this study was to explore this apparent paradox and determine COX-2 gene expression in various bovine uterine tissues during the second half of gestation and parturition. We have reported previously that a characteristic feature of OT-induced release of PGF2{alpha} in pregnant cows is the long duration of the response, which continues beyond the time during which any OT remains in the circulation or occupies endometrial oxytocin receptors (OTR) [15]. The COX enzyme self-destructs during activity [1]; therefore the long duration of OT-induced PGF2{alpha} release suggests continuous synthesis of the COX enzyme under the influence of OT. Another purpose was therefore to test the hypothesis that OT-induced PG synthesis is associated with transcription of COX-2 gene.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Animals

Tissues were obtained from 16 Angus and Hereford cows from the US Subtropical Agricultural Research Station, Brooksville, FL. Breeding dates were known for some of the cows; in the others, length of gestation was determined from fetal crown-rump length. Samples were obtained at the following gestational ages: 150 days, 275 days, at term not in labor (designated 280- days), at term in labor (designated 280+ days), and 6–12 h postpartum. Additionally, six third-trimester Angus-Brahman crossbred cows were obtained from the Beef Research Unit, Animal Science Department, Gainesville, FL, for study of the effect of OT on COX-2 expression in intercaruncular endometrium. The gestational ages of these cows were between 230 and 270 days at the time of the experiment. Tissues were collected at the Meats Laboratory of the University of Florida after exsanguination. All tissues were placed on ice, cut free from adnexa as quickly as possible, frozen in liquid nitrogen, and stored at -75°C until processed for total RNA extraction. All procedures were approved by the Institutional Animal Care and Use Committee.

OT Challenges

The six cows used for this experiment were paired according to gestation length; one cow in each pair was injected i.v. with 200 IU OT and the other with saline i.v. Two hours after OT injection the cows were exsanguinated, and a sample of intercaruncular endometrium was removed, frozen in liquid nitrogen, and stored at -75°C until processed for total RNA extraction and ribonuclease protection assay for COX-2 mRNA. Blood samples were collected at 15-min intervals for 30 or 45 min before and 90 min after the injection for measurement of plasma concentration of 13,14-hydroxy-15-keto-prostaglandin F2{alpha} (PGFM). The RIA for PGFM was performed with unextracted plasma as described and validated previously [15]. The experimental protocol was approved by the Institutional Animal Care and Use Committee.

RNA Extraction

In the course of these studies, total RNA was prepared by two methods: 1) tissues were pulverized in liquid N2 and homogenized in guanidium thiocyanate followed by ultracentrifugation through cesium chloride cushion as previously described [16, 17] or 2) tissues were processed according to Chomczynski and Sacchi [18] using RNA-Clean kits (AGS, Heidelberg, Germany). All RNA samples were subjected to phenol/chloroform purification steps. Better yields were obtained with the former, more elaborate method, but the RNA quality, determined on electrophoresis on 1.2% agarose gels and optical density measurements at 260 nm and 280 nm, was equivalent with the two methods. Repeat experiments indicated virtually no within-sample variation, confirming the reproducibility of the data.

Detection of Specific Gene Transcripts by RNase Protection Assay (RPA)

Preparation of polymerase chain reaction-amplified cDNA fragments for bovine COX-1 and -2 and the corresponding cRNA probes The sequence of bovine COX-1 mRNA and COX-2 mRNA had not been described at the time this study was begun. Oligonucleotides suitable for use in PCR assay were therefore designed based on the published guinea pig COX-1 and -2 sequences [8], which in turn were based on ovine [19, 20], murine [20,21], human [22, 23], and rat [6] sequences. Regions were chosen that have low homology between isoforms but are highly conserved between species: COX-1 5'-primer—GTGTGACCTGCTGAAGGCTGAGCAC [944–968]; COX-1 3'-primer—CTTGCGGTACTCATTGAAGGGCTGC [1388–1412]; COX-2 5'-primer—GACCAGAGCAGG-CAGATGAAATAC [1412–1435]; COX-2 3'-primer—CTGTGGGATTGATATCATCTAGTC [1813–1836]. Numbers in square brackets indicate nucleotide positions relative to the human cDNAs. Using a standard reverse transcription-polymerase chain reaction (RT-PCR) protocol and Superscript RNase H-reverse transcriptase (Gibco BRL, Life Technologies Inc., Gaithersburg, MD), bovine intercaruncular endometrium from parturient cow uteri was used to program the synthesis of single-stranded cDNAs, and the resulting RT-PCR product was cloned into plasmid vector pGEM-T (Promega, Madison, WI). Double-stranded sequencing was performed using TF Sequencing kit (Pharmacia, Piscataway, NJ). The cDNA fragments of bovine COX-1 and COX-2 genes exhibited 89.0% and 90.2% homologies to the corresponding regions of human COX-1 and -2 (Align; DNASTAR Inc., Madison, WI).

For bovine COX-1, the antisense probe was prepared by in vitro transcription from the Sp6 RNA polymerase promoter out of the PCR fragment. The probe for COX-1 had a length of 301 bases, which included the multiple cloning site of 82 bases and protected an RNA sequence of 219 bases. COX-2 fragment was inserted into Bluescript (Invitrogen, Carlsbad, CA) vector and was prepared by in vitro transcription with T3 polymerase after linearization of the plasmid with HindIII. The antisense cDNA probe for bovine COX-2 had a length of 376 bases, which included the multiple cloning site of 102 bases and protected an RNA sequence of 274 bases. The method of preparation was similar to that for the bovine cCOX-1 probe. As control probe for the RPAs, a fragment of the cDNA for bovine glyceraldehyde phosphate dehydrogenase (GAPDH) was prepared as previously described [16]. The probe had a length of 305 bases, including the multiple cloning site of 56 bases. It was inserted into the pGEM-T-Easy vector and was prepared by transcription from the Sp6 polymerase promoter after the plasmid was linearized with NcoI. It protected a cRNA sequence of 249 bases. All probes were prepared in the presence of [{alpha}-32P]dCTP as described in the instructions to the commercial RPA kit and were subsequently purified by polyacrylamide electrophoresis on 5% gels. The labeled compound, [{alpha}-32P]dCTP, was obtained from New England Nuclear (Bad Hamburg, Germany).

Ribonuclease protection assay (RPA) The RPAs were performed using a commercial kit (Ambion, Austin, TX) according to the instructions for the kit. Ten or twenty micrograms of total RNA of each sample was hybridized with the COX-2-specific or COX-1-specific cRNA probes and, as control for equal loading on the gel, bovine GAPDH-specific cRNA in the same vial. The differences in size of the protected fragments of COX-2 mRNA and GAPDH mRNA were sufficient to permit ready separation on a polyacrylamide gel. On the other hand, multiple bands in the protected fragments of both COX-2 mRNA and GAPDH mRNA would obscure the shorter COX-1 mRNA bands, which had to be done separately. The intensity of the protected fragments was quantified by densitometry (Advanced American Biotech Imaging, Fullerton, CA), and the results were expressed as a percentage of the intensity of COX-2 mRNA signal of the corresponding GAPDH mRNA.

Statistical Analysis

The results of RPA assays, quantified by densitometry, were subjected to one-way ANOVA, followed by Newman-Keuls test. Differences in plasma PGFM concentrations between OT- and saline-treated cows were analyzed by two-way ANOVA for repeated measurements after logarithmic transformation of the data; they were also analyzed by linear regression and assessment of differences between slopes; p < 0.05 was considered significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
COX-1 Expression in Tissues of Pregnant Cows

No signals for COX-1 mRNA were detected by RPA in 20 µg of total RNA from tissues of pregnant cows after exposure on XOMAT-AR (Eastman Kodak, Rochester, NY) films for 1 wk. After exposure for 3–7 days on BioMax (Eastman Kodak, Rochester, NY) film, which is three times as sensitive as XOMAT-AR, signals for COX-1 mRNA were sporadically present in RNA from caruncles, endometrium, and myometrium; the relative intensity vs. GAPDH mRNA at parturition was about 3.5% in caruncles, less than 0.1% (trace) in intercaruncular endometrium, and 7.3% in myometrium. Signals for COX-1 mRNA were not detected in RNA from cotyledon, cervical mucosa, and chorioallantois. COX-1 mRNA signals in 20 µg total RNA from seminal vesicular and prostate glands from a fertile bull, used as positive controls, were also weak; the relative intensities vs. GAPDH mRNA were 8.3 + 1.0% and 2.6 ± 0.5%, respectively, in three separate assays. Using RT-PCR, COX-1 cDNA was detected in seminal vesicular and prostate glands, myometrium, and caruncle from parturient cows, as well as in the fetal uterus but not the fetal cervix. No further RPAs were performed for COX-1 in bovine tissues.

COX-2 Expression in Tissues of Pregnant Cows

Total RNA was prepared from myometrium, endometrium, caruncles, fetal cotyledons, and cervical mucosa (n = 3). Amnion and chorioallantoic membranes were examined only from term pregnant animals. It was necessary to use 20 µg of total RNA for each hybridization reaction to obtain detectable signals from tissues other than cotyledons and caruncles. Autoradiography was performed on BioMax films with enhancing screens with 3- to 7-day exposure times.

Figure 1 shows a representative gel for COX-2 mRNA and GAPDH mRNA measurements by RPA in tissues from the placentomes. On Day 150, distinct signals for COX-2 mRNA were detected in RNA from fetal cotyledons, whereas signals for COX-2 mRNA in caruncles were very weak. On Day 275, expression of COX-2 mRNA was clearly detectable also in caruncles. Concentrations of COX-2 mRNA in both the cotyledons and caruncles increased with advancing gestation and were greatest at term, but there was no demonstrable difference between samples from cows in labor (Day 280+) and those not in labor (Day 280-). COX-2 mRNA expression in caruncles declined rapidly after parturition; in samples taken at 6–12 h postpartum, the signals were considerably weaker than at parturition. Cotyledons from postpartum cows were not available for assay. The fetal membranes, chorioallantois, and amnion from cows at term expressed COX-2 mRNA, but the signals were weaker than in cotyledons (not shown).



View larger version (96K):
[in this window]
[in a new window]
  		FIG. 1. RPA for COX-2 mRNA in samples of bovine caruncles and cotyledons obtained at Days 150, 275, 280- (term, no labor), and 280+ (term, labor) of gestation, and of caruncles at postpartum Day 1. Tissues from two animals are shown for each day. Length of protected fragment for COX-2 was 274 bases and for GAPDH was 198 bases. Messenger RNA from caruncles is in lanes 1–10; that from cotyledons is in lanes 11–18; stage of gestation is indicated on the figure. The remaining lanes show undigested and digested probes and molecular size marker.

Figure 2 shows a representative gel for the protected fragments of COX-2 mRNA and GAPDH in intercaruncular endometrium, myometrium, and cervical mucosa. COX-2 mRNA expression in endometrium was variable and rather weak during pregnancy and parturition, but increased dramatically postpartum. The patterns of COX-2 mRNA expression in myometrium and endometrium were similar with no specific trend during pregnancy; but postpartum, no increase in the concentration of COX-2 transcripts was observed in the myometrium. One of the three cows in active labor showed a more robust signal for COX-2 mRNA in myometrium than during pregnancy. In cervical mucosa the concentration of COX-2 mRNA was very weak on Days 150 and 275, but at term the signal for COX-2 transcripts had increased before the onset of labor and was strong in parturient cows. The expression of COX-2 mRNA in cervical mucosa declined after delivery; at 6–12 h postpartum, levels of transcripts were similar to those at term before the onset of labor. Figure 3, A and B, shows the results expressed as the intensity of COX-2 mRNA signals in percentage of the corresponding GAPDH mRNA signal.



View larger version (59K):
[in this window]
[in a new window]
  		FIG. 2. RPA for COX-2 mRNA in samples of endometrium, myometrium, and cervical mucosa obtained from the same cows as the placental tissues shown in Figure 1. Messenger RNA from endometrium is in lanes 1–12, mRNA from myometrium in lanes 13–23, and mRNA from cervical mucosa in lanes 24–29; stage of gestation as indicated. For comparison, endometrium from two cows at estrus was also assayed (d 0).



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 3. Quantification of protected fragments for COX-2 mRNA and GAPDH mRNA shown in Figures 1 and 2 performed using a Laser Densitometer (Advanced American Biotech Imaging) to measure areas of the protected fragments on the films. Values shown are mean ± SE for relative intensities of COX-2 mRNA as percentage of corresponding GAPDH mRNA; n = 2 except for cervix on Days 0, 275, 280-, 280+ (n = 1). RPA using RNA from the remaining cows, one or two each day, was performed separately with essentially the same results. A) Endometrium, myometrium, and cervical mucosa: concentrations of mRNA for COX-2 in endometrium from postpartum cows and cervical mucosa from cows in labor had increased significantly from initial values (on Day 150 and Day 275, respectively [ANOVA, p < 0.05]); no significant changes occurred in COX mRNA concentrations in samples from myometrium. Endometrium from two estrous cows were analyzed for comparison (Day 0). B) Caruncles and cotyledons: COX-2 mRNA concentrations on Days 280- and 280+ were significantly greater in both tissues than on Day 150 or postpartum; concentration of COX-2 mRNA in cotyledons on Day 275 was also greater than on Day 150 (ANOVA, p < 0.01).

OT Challenge

Mean log normal concentrations of PGFM in the plasma of OT- and saline-injected cows are shown in Figure 4. After injection of OT, the concentration of plasma PGFM increased linearly over the 90-min experimental period (r = 0.849, p < 0.0001), whereas after saline injection, mean plasma PGFM did not increase (r = 0.154, p = 0.5). In one of the saline-injected controls (gestational age 230 days), plasma PGFM increased somewhat but much less than after OT injection. We attribute the rise in this control cow to stress during the injection and blood-sampling procedures. The individuals conducting the experiments had noted that this particular cow was exceptionally wild and uncooperative during the blood-sampling period.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 4. Plasma concentrations of PGFM in midpregnant cows injected with 200 IU OT (squares) or saline (circles). Values are log normal means ± SE. A single asterisk indicates significant difference from basal levels, and two asterisks indicate significant difference between OT- and saline-injected cows (two-way ANOVA followed by least significant difference test, p < 0.05). PGFM concentrations increased linearly during the 90-min collection period in the OT-injected cows (r = 0.854, p < 0.005); no significant change occurred in saline-injected cows (r = 0.150, p < 0.5).

Expression of COX-2 mRNA in OT- and Saline-Injected Cows

RPA was performed twice using 20 µg total RNA from endometrium from each cow. One of the gels is shown in Figure 5. The results were quantified as described above, and the mean relative intensities are shown in Figure 6. The protected fragment for COX-2 mRNA was present in RNA of all three OT-injected cows, whereas only one of the saline-treated cows showed a signal for COX-2 mRNA, which was much weaker than in the OT-treated cows. This cow was the same cow in which plasma PGFM levels were somewhat increased.



View larger version (92K):
[in this window]
[in a new window]
  		FIG. 5. RPA for COX-2 mRNA and GAPDH mRNA using total RNA from intercaruncular endometrium of six pregnant cows (230–270 days gestational age) paired according to gestational age; one in each pair was treated with OT (200 IU) and the other with saline i.v., and cows were exsanguinated 2 h after each injection. Lanes 1–3 are from OT-treated cows, lanes 4–6 from saline-treated cows. All OT-injected cows showed signals for the protected fragment of COX-2 mRNA; only one of the saline-injected cows showed a weak signal for COX-2 mRNA.



View larger version (13K):
[in this window]
[in a new window]
  		FIG. 6. Relative intensity of COX-2 mRNA in percentage of corresponding GAPDH mRNA in ribonuclease protection shown in Figure 5; each sample was collected 2 h after the injection. Values are means from two separate gels; mean ± SE.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
We have demonstrated that COX-2 gene is the dominant isoform expressed in uterine tissues of advanced-pregnant cows and have provided evidence for the capacity of OT to induce expression of COX-2 mRNA in bovine endometrium in vivo. While this work was in progress, stimulation of COX-2 mRNA expression by OT in bovine endometrial cells in vitro and in the nonpregnant sheep uterus in vivo was reported [24, 25]. Together, these results implicate OT as a ligand that, similarly to several mitogens and cytokines, induces COX-2 gene transcription and mRNA accumulation in bovine and ovine endometrium. Previous results in prepubertal heifers have shown that the influence of progesterone is a prerequisite for OT-induced COX-2 gene expression [14].

COX-1 gene transcripts were rare and were detectable by RPA only sporadically in myometrium and caruncles, but not in the other tissues studied. The basal levels of COX-1 transcripts in the reproductive tissues of pregnant cows are apparently very low. Interestingly, the fetal uterus expressed COX-1 but not COX-2 mRNA, suggesting a developmental role for this isoform.

COX-2 mRNA was most highly expressed in cotyledons and caruncles, in which transcripts accumulated during the latter part of gestation without any exogenous stimulation. Mitogens and cytokines are known inducers of COX-2 transcription, and cotyledons and fetal membranes have the capacity to produce growth factors and other mitogens [26–28]; therefore such fetal factors may be responsible for the accumulation of COX-2 transcripts in cotyledons. They may also regulate COX-2 gene transcription in the maternal compartment of the bovine placenta. Directional transport of cytokines from uterine epithelial cells into underlying stromal cells to induce COX-2 expression has been demonstrated in pregnant mice [29]. In accordance with this hypothesis, fetal cotyledons accumulated COX-2 transcripts earlier in gestation than maternal caruncles. Contamination with villous tissue from cotyledons possibly accounts for some of the COX-2 mRNA found in caruncles, because some fetal tissue remained attached to the caruncle when the fetal and maternal sides of the placentome were torn apart; however, the proportion of fetal tissue remaining in caruncles was small and could not account for almost equal concentration of COX-2 mRNA in total RNA from the two tissues at term.

In contrast to endometrium in vivo, bovine endometrial epithelial cells, obtained from nonpregnant cows in early luteal phase and kept in culture for several days, express COX-1 mRNA in addition to COX-2 mRNA [24]. This discrepancy between the in vitro and our in vivo results may be due to the morphological differences between the two sets of tissues. The in vitro experiments were done with purified epithelial cells, which are the COX-2 gene-expressing cells, whereas intact endometrium used in the in vivo experiments consists of several cell types in addition to epithelial cells. The proportion of both COX-1 and COX-2 mRNA was consequently greater in total RNA from the purified COX-expressing cells than from intact endometrial tissue, and COX-1 mRNA was therefore measurable in RNA from the purified cells. An alternative explanation is that, similarly to expression of OTR gene in bovine endometrial epithelial cells [9], transcripts of the constitutively expressed COX-1 gene increased spontaneously under the in vitro conditions.

Considerable species variation in COX-1 and -2 gene expression in uterine tissues exists. Unlike pregnant cows, pregnant sheep have been found to express COX-1 gene transcripts in relatively high concentrations in endometrium, myometrium, cotyledons, and amnion [30, 31].

Nevertheless, only COX-2 mRNA concentrations in endometrium and myometrium increased during labor, suggesting that COX-2 is more important than COX-1 for prostanoid production during labor also in sheep [32]. As in cows, COX-2 mRNA expression in ewes was most pronounced in cotyledons, with no difference between tissue from ewes in labor and not in labor. COX-2 seems to be the dominant isoform expressed during parturition in human uterine tissues [33–35]. Guinea pig endometrium resembles bovine endometrium in expressing mainly COX-2 mRNA and protein; COX-1 mRNA expression is very weak and is not affected by ovarian hormones [8]. In rats, on the other hand, uterine expression of COX-1 isoform of the enzyme equals that of the COX-2 isoform, and the two isoforms increase in parallel during pregnancy [10, 36]. In isolated myometrium of pregnant rats, only the COX-1 isoform of the enzyme has been found [37]. Species variations apparently exist also in the male reproductive tissues. Seminal vesicular gland of rams contains prostaglandins in great abundance and is a rich source of COX-1 isoenzyme, whereas seminal fluid of bulls contains little if any prostaglandins [38]. Our findings of relatively low expression of COX-1 mRNA in the seminal vesicular gland and prostate of bulls are in agreement with this report.

COX-1 and -2 gene expression can be regulated at both the transcriptional and the posttranscriptional levels, and species differences may exist at both levels [39–42]. Transcription induced in murine or chicken embryo fibroblasts by mitogens or by oncogene-induced transformation occurs rapidly, and maximal levels are seen at 15–30 min, followed shortly by COX-2 mRNA and protein accumulation, indicating transcriptional regulation in these instances [39, 40]. In a human cell line and in cultured human endometrial and granulosa cells, interleukin-1ß or hCG induces rapid and transient COX-2 gene transcription as well as prolongation of the half-life of the mRNA [41–43]. In sheep injected with 10 IU of OT, COX-2 mRNA expression can be demonstrated after a delay of 7–8 min; it reaches maximal levels in 25 min, and declines to baseline by 60–90 min after the injection [25]. In the present experiments COX-2 mRNA was still detectable 2 h after the injection—probably because a larger dose of OT was administered, since the ligand-induced COX-2 transcription has been shown to be dose dependent.

The finding of relatively low concentrations of COX-2 mRNA in endometrium and myometrium of cows at term and during labor was unexpected in view of the present findings and considering that significant amounts of OT are released from the posterior pituitary during parturition [44–46]. The reason for the observed low COX-2 transcript levels may be the long time, 2–3 h, that elapsed between observation of a cow in labor out in the fields (followed by transportation to the Meats Laboratory) and the removal of the tissues. Transportation of the cow and other procedures associated with harvesting the tissues caused a great deal of disturbance and stress for the parturient cows. Both conditions are known to interrupt the process of parturition in various species ([47, 48] and references therein), and inhibit the release of OT [49]. Because of its short half-life, COX-2 mRNA was probably no longer detectable when the samples from the cows in labor were collected. We were not aware of how critical this aspect was at the time experiment 1 was conducted. In the present study, a pharmacologic dose of OT was intentionally used to assure detection of the putative effect on COX-2 expression; amounts released in response to physiological stimuli are generally considerably smaller, even at parturition.

Epithelial cells of cervical mucosa express both the OTR gene and COX-2 mRNA. We have recently shown that OT induces PGE2 release from the cervical mucosa in estrous cows in vivo [50]. The concentrations of OTR in cervical mucosa are very low during pregnancy, but they increase at term and reach twice the levels in estrous cows during parturition [17, 51]. According to the results of the present study, cervical COX-2 mRNA levels were significantly increased at parturition. The results obtained in cervical tissue in vitro [51] and in estrous cows in vivo [50] support the assumption that the increase may be induced by endogenous OT resulting in release of PGE2 from the parturient cervix. Macrophages that invade the cervix in other species around the time of parturition may also be present in the bovine cervix; when activated, macrophages secrete cytokines that induce COX-2 gene expression. Moreover, cooperation between multiple ligands that activate COX-2 transcription may possibly be required for optimal functioning, as suggested by Darnell [52].

The high concentration of COX-2 transcripts found in bovine endometrium postpartum explains the fact that plasma PGFM concentrations in parturient cows are maximal on the day after delivery [53, 54]. At that stage, the stimulus for COX-2 expression probably derives from cytokines released from macrophages and other cells of the immune system that invade the uterus in response to the trauma inflicted on the tissues by fetal expulsion and placental separation. Moreover, a recent study demonstrated that PGE2, which is present in high concentrations in the uterine vasculature at birth, stimulates cytokine production in macrophages [55].

In summary, bovine uterine tissues express predominantly the COX-2 isoform during pregnancy. COX-1 mRNA was detectable only in myometrium and caruncles. Placentomes had the highest concentrations of COX-2 transcripts among the tissues examined. Fetal cotyledons expressed COX-2 mRNA in significant amounts from Day 150 onward when maternal caruncles expressed COX-2 mRNA only very weakly. COX-2 transcripts in both tissues increased with advancing gestation and were strongly expressed at term but showed no significant difference before and after the onset of labor. Concentrations of COX-2 transcripts in endometrium, myometrium, and cervical mucosa were much lower than in the placentomes during the second half of gestation. A significant labor-associated increase in COX-2 mRNA concentration was observed in cervical mucosa; endometrium showed a marked increase on the day after parturition, and myometrial COX mRNA levels were variable both before and during parturition. Injection of OT induced a significant accumulation of COX-2 transcripts in endometrium, and it also induced significant release of PGE2 from cervical mucosa in vivo. Endogenous OT may therefore be responsible for the observed increase in endometrial PGF2{alpha} production during parturition, alone or in combination with cytokines of fetal or maternal origin; OT may also contribute significantly to release of PGE2 from cervical mucosa at parturition.


   ACKNOWLEDGMENTS
 
The authors want to express their gratitude to Prof. Freimut Leidenberger, MD, Director of the Institute for Hormone and Fertility Research (IHF) at the University of Hamburg, Germany; and Prof. Richard Ivell, PhD, Director of the Division of Molecular Biology at IHF, for generously providing the facilities that made this work possible. The authors also thank Dr. William W. Thatcher for providing the PGFM antibody; Mr. Larry Eubanks at the University Meats Laboratory, Gainesville, for processing animals for tissue collection. The assistance of the following students in collection of blood and tissue samples is acknowledged: Andres Kowalski, Logan Graddy, Cara Ervin, and Andrew Majewski.


   FOOTNOTES
 
1 This work was supported in part by grant #93-2333 from BARD, U.S.-Israel Binational Agricultural Research and Development Fund; and by Deutsche Forschungsgemeinschaft, grant No. Iv7-8. Florida Agricultural Experiment Station, Journal Series No. R-06620. Back

2 Correspondence: Anna-Riitta Fuchs, Dept. OB/GYN, Cornell University Medical College, 515 East 71 St., Room S-412, New York, NY 10021. FAX: 212 860 1134; annariitta{at}aol.com Back

Accepted: September 16, 1998.

Received: October 30, 1997.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Smith WL, DeWitt DL. Biochemistry of prostaglandin endoperoxide H synthase-1 and synthase-2 and their differential susceptibility to nonsteroidal anti-inflammatory drugs. Semin Nephrol 1995; 15:179–194.[Medline]
  2. Smith WL, DeWitt DL. Prostaglandin endoperoxide H synthase-1 and -2. Adv Immunol 1996; 62:167–214.[Medline]
  3. Herschman HR. Prostaglandin synthase-2. Biochim Biophys Acta 1996; 1299:125–141.[Medline]
  4. Reddy ST, Herschman HR. Ligand-induced prostaglandin synthesis requires expression of the TS10 prostaglandin synthase gene in murine fibroblasts and macrophages. J Biol Chem 1994; 269:15473–15480.[Abstract/Free Full Text]
  5. Xie W, Chipman JG, Robertson DL, Erikson RL, Simmons DL. Expression of mitogen-responsive gene encoding prostaglandin synthase is regulated by mRNA splicing. Proc Soc Natl Acad Sci USA 1991; 88:26922–26926.
  6. Feng L, Sun W, Xia Y, Tang WW, Chanmugam P, Soyoola E, Wilson CB, Hwang D. Cloning two isoforms of rat cyclooxygenase: differential regulation of their expression. Arch Biochem Biophys 1993; 307:361–368.[CrossRef][Medline]
  7. Poyser NL. The control of prostaglandin production by the endometrium in relation to luteolysis and menstruation. Prostaglandins Leukot Essent Fatty Acids 1995; 53:147–195.[CrossRef][Medline]
  8. Bracken KE, Elger W, Jantke I, Nanninga A, Gellersen B. Cloning of guinea pig cyclooxygenase-2 and 15-hydroxyprostaglandin dehydrogenase complementary deoxyribonucleic acids: steroid-modulated gene expression correlates to prostaglandin F2{alpha} secretion in cultured endometrial cells. Endocrinology 1997; 138:237–247.[Abstract/Free Full Text]
  9. Asselin E, Goff AK, Bergeron H, Fortier MA. Influence of sex steroids on the production of prostaglandin F2{alpha} and E2 and response to oxytocin in cultured epithelial and stromal cells of the bovine endometrium. Biol Reprod 1997; 54:371–379.[Abstract]
  10. Dong Y-L, Gangula PRR, Fang L, Yallampalli CH. Differential expression of cyclo-oxygenase-1 and -2 proteins in rat uterus and cervix during the estrous cycle, pregnancy, labor and in myometrial cells. Prostaglandins 1996; 52:13–34.[CrossRef][Medline]
  11. Chakraborty I, Das SK, Wang J, Dey SK. Developmental expression of the cyclooxygenase-1 and cyclooxygenase-2 genes in the peri-implantation mouse uterus and their differential regulation by the blastocyst and ovarian steroids. J Mol Endocrinol 1996; 16:107–122.[Abstract/Free Full Text]
  12. Charpigny G, Reinaud P, Tamby J-P, Créminon C, Martal J, Maclouf J, Guillomot M. Expression of cyclooxygenase-1 and -2 in ovine endometrium during the estrous cycle and early pregnancy. Endocrinology 1997; 138:2163–2171.[Abstract/Free Full Text]
  13. Wu WX, Ma XH, Zhang Q, Buchwalder L, Nathanielzs PW. Regulation of prostaglandin endoperoxide H synthase-1 and -2 by estradiol and progesterone in nonpregnant ovine myometrium and endometrium. Endocrinology 1997; 138:4005–4012.[Abstract/Free Full Text]
  14. Fuchs A-R, Drost M, Morissey P, Chang S-M, Fields MJ. Steroid effects on oxytocin and PGF2{alpha} interaction in endometrium of prepuberal heifers. Biol Reprod 1997; 56(suppl 1):187A.
  15. Fuchs A-R, Rollyson MK, Meyer M, Fields MJ, Minix J, Randel RD. Oxytocin induces prostaglandin F2{alpha} release in pregnant cows: influence of gestational age and oxytocin receptor concentrations. Biol Reprod 1996; 54:647–653.[Abstract]
  16. Ivell R, Rust W, Einspanier A, Hartung S, Fields M, Fuchs A-R. Oxytocin and oxytocin receptor gene expression in the reproductive tract of the pregnant cow: rescue of luteal oxytocin production at term. Biol Reprod 1995; 53:553–560.[Abstract]
  17. Fuchs A-R, Ivell R, Balvers M, Chang S-M, Fields MJ. Oxytocin receptors in bovine cervix during pregnancy and parturition: gene expression and cellular localization. Am J Obstet Gynecol 1996; 175:1654–1660.[CrossRef][Medline]
  18. Chomczynski P, Sacchi N. Single step method of mRNA isolation by the acid guanidium thiocyanate-phenol-chloroform method. Anal Biochem 1987; 162:156–159.[Medline]
  19. Merlie JP, Fagan D, Mudd J, Needleman P. Isolation and characterization of the complementary DNA for sheep seminal vesicle prostaglandin endoperoxide synthase (cyclooxygenase). J Biol Chem 1988; 273:3550–3553.
  20. DeWitt DL, Smith WL. Cloning of mouse and sheep prostaglandin endoperoxide synthases. Methods Enzymol 1990; 187:469–479.[Medline]
  21. Kujubu DA, Fletcher BS, Varnum BC, Lim RW, Herschman HR. TIS10, a phorbol ester tumor promoter-inducible mRNA from Swiss 373 cells, encodes a novel prostaglandin synthase/cyclooxygenase homologue. J Biol Chem 1991; 276:12866–12877.
  22. Funk CD, Funk LB, Kennedy MB, Pong AS, Fitzgerald GA. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment. FASEB J 1991; 5:2304–2312.[Abstract]
  23. Hla T, Nelson K. Human cyclooxygenase-2 cDNA. Proc Natl Acad Sci USA 1992; 89:7384–7388.[Abstract/Free Full Text]
  24. Asselin E, Drolet P, Fortier MA. Cellular mechanisms involved during oxytocin-induced prostaglandin F2{alpha} production in endometrial epithelial cells in vitro: role of cyclooxygenase-2. Endocrinology 1997; 138:4798–4805.[Abstract/Free Full Text]
  25. Burns PD, Tsai S-L, Wiltbank MC, Hayesa SH, Graf GA, Silvia WJ. Effect of oxytocin on concentrations of prostaglandin endoperoxide H synthase-2 mRNA in ovine endometrial tissue in vivo. Endocrinology 1997; 138:5637–5640.[Abstract/Free Full Text]
  26. Hunt JS, Chen H-L, Miller L. Minireview. Tumor necrosis factors: pivotal components of pregnancy? Biol Reprod 1996; 54:554–562.[Abstract]
  27. Bry K, Hallman M, Lappalainen U. Cytokines released by granulocytes and mononuclear cells stimulate amnion cell prostaglandin E2 production. Prostaglandins 1994; 48:389–399.[CrossRef][Medline]
  28. Lonsdale LB, Elder MC, Sullivan MH. A comparison of cytokine and hormone production by decidual cells and tissue explants. J Endocrinol (Lond) 1996; 151:309–313.
  29. Jacobs AL, Hwang D, Julian J-A, Carson DD. Regulated expression of prostaglandin endoperoxide synthase-2 by uterine stroma. Endocrinology 1994; 135:1807–1815.[Abstract]
  30. Zhang Q, Wu WX, Brenna JT, Nathanielsz PW. The expression of cytosolic phospholipase A2 and prostaglandin endoperoxide synthase in ovine maternal uterine and fetal tissues during late gestation and labor. Endocrinology 1996; 137:4010–4017.[Abstract]
  31. McLaren WJ, Young IR, Wong MH, Rice GE. Expression of prostaglandin G/H synthase I and II in ovine amnion and placenta following glucocorticoid-induced labour onset. J Endocrinol 1996; 151:125–135.[Abstract/Free Full Text]
  32. Wimsatt J, Nathanielcz PW, Sirois J. Induction of prostaglandin endoperoxide synthase isoform-2 in ovine cotyledonary tissues during late gestation. Endocrinology 1993; 133:1068–1073.[Abstract/Free Full Text]
  33. Hirst JJ, Teixeira FJ, Zakar T, Olson DM. Prostaglandin endoperoxide H synthase-1 and -2 messenger ribonucleic acid levels in human amnion with spontaneous labor onset. J Clin Endocrinol Metab 1995; 80:517–523.[Abstract]
  34. Fuentes A, Spaziani EP, O'Brien WF. The expression of cyclooxygenase-2 (COX-2) in amnion and decidua following spontaneous labor. Prostaglandins 1995; 52:261–267.
  35. Slater DM, Berger LC, Newton R, Moore GE, Bennett PR. Expression of cyclooxygenase types 1 and 2 in human fetal membranes at term. Am J Obstet Gynecol 1995; 172:77–82.[CrossRef][Medline]
  36. Arslan A, Zingg HH. Regulation of COX-2 gene expression in rat uterus in vivo and in vitro. Prostaglandins 1996; 52:463–481.[CrossRef][Medline]
  37. Myatt L, Langdon G, Brockman MS. Identification and changes in concentrations of prostaglandin H synthase (PGHS) isoforms in rat myometrium at parturition. Prostaglandins 1994; 48:285–296.[CrossRef][Medline]
  38. Eliasson R. Studies on prostaglandin: occurrence, formation and biological actions. Acta Physiol Scand 1959; 46(suppl 158):1–75.
  39. DeWitt DL, Meade EA. Serum and glucocorticoid regulation of gene transcription and expression of the prostaglandin H synthase-1 and prostaglandin H synthase-2 isozymes. Arch Biochem Biophys 1993; 306:94–102.[CrossRef][Medline]
  40. Evett GE, Xie W, Jeffrey GC, Robertson DL, Simmons DL. Prostaglandin G/H synthase isoenzyme 2 expression in fibroblasts: regulation by dexamethasone, mitogens, and oncogenes. Arch Biochem Biophys 1993; 306:169–177.[CrossRef][Medline]
  41. Ristimäki A, Garfinkel S, Wessendorf J, Maciag T, Hla T. Induction of cyclooxygenase-2 by interleukin-1{alpha}. Evidence for post-transcriptional regulation. J Biol Chem 1994; 269:11769–11775.[Abstract/Free Full Text]
  42. Han SW, Lei ZM, Rao ChV. Up-regulation of cyclooxygenase gene expression by chorionic gonadotropin during the differentiation of human endometrial stromal cells into decidua. Endocrinology 1996; 137:1791–1797.[Abstract]
  43. Narko K, Ritvos O, Ristimäki A. Induction of cyclooxygenase-2 and prostaglandin F2{alpha} receptor expression by interleukin-1ß in cultured human granulosa-luteal cells. Endocrinology 1997; 138:3638–3644.[Abstract/Free Full Text]
  44. Schams D, Schmidt-Polex B, Kruse V. Oxytocin determination by radioimmunoassay in cattle. Acta Endocrinol (Kph) 1979; 92:393–496.
  45. Landgraf R, Schulz J, Eulenberger K, Wilhelm J. Plasma levels of oxytocin and vasopressin before, during, and after parturition in cows. Exp Clin Endocrinol 1983; 81:321–328.[Medline]
  46. Fuchs A-R. Oxytocin in animal parturition. In: Amico JA, Robinson AG (eds.), Oxytocin: Clinical and Laboratory Studies. Exerpta Med Int Congr Ser 1985; 666:207–235.
  47. Newton N, Foshee D, Newton M. Experimental inhibition of labor through environmental disturbance. Obstet Gynecol 1966; 27:371–377.[Medline]
  48. Newton N, Peeler D, Newton M. Effect of disturbance on labor. Am J Obstet Gynecol 1968; 101:1096–1102.[Medline]
  49. Bicknell RJ, Leng G, Russell JA, Dyer RG, Mansfield S, Zhao B-G. Hypothalamic opioid mechanisms controlling oxytocin neurons during parturition. Brain Res Bull 1988; 20:743–749.[CrossRef][Medline]
  50. Graddy LG, Kowalski AM, Fields MJ, Fuchs A-R. Effects of oxytocin on bovine cervix at estrus. In: Prog Soc Study Reprod Ann Meet; August 8–11, 1998; College Point, TX. Abstract 327.
  51. Fuchs A-R, Fields MJ, Freidman S, Shemesh M, Ivell R. Oxytocin and the timing of parturition. Influence of oxytocin receptor gene expression, oxytocin secretion, and oxytocin-induced prostaglandin F2{alpha} and E2 release. In: Ivell R, Russell JS (eds.), Oxytocin. Cellular and Molecular Mechanisms in Medicine and Research. Adv Exp Med Biol 1995; 395:405–420.[Medline]
  52. Darnell JE Jr. STATs and gene regulation. Science 1997; 277:1630–1635.[Abstract/Free Full Text]
  53. Edquist L-E, Kindahl H, Stabenfeldt G. Release of prostaglandin F2{alpha} during the peripartal period in the bovine. Prostaglandins 1978; 16:111–119.[CrossRef][Medline]
  54. Guilbault LA, Thatcher WW, Drost M, Hopkins SM. Source of F series prostaglandins during the early postpartum period in cattle. Biol Reprod 1984; 31:879–887.[Abstract]
  55. Williams JA, Shachter E. Regulation of macrophage cytokine production by prostaglandin E2. J Biol Chem 1997; 272:25693–25699.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
W. X. Wu, X. H. Ma, T. Coksaygan, K. Chakrabarty, V. Collins, J. Rose, and P. W. Nathanielsz
Prostaglandin Mediates Premature Delivery in Pregnant Sheep Induced by Estradiol at 121 Days of Gestational Age
Endocrinology, March 1, 2004; 145(3): 1444 - 1452.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
J. A. Arosh, S. K. Banu, P. Chapdelaine, and M. A. Fortier
Temporal and Tissue-Specific Expression of Prostaglandin Receptors EP2, EP3, EP4, FP, and Cyclooxygenases 1 and 2 in Uterus and Fetal Membranes during Bovine Pregnancy
Endocrinology, January 1, 2004; 145(1): 407 - 417.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
V. Emond, L. A. MacLaren, S. Kimmins, J. A. Arosh, M. A. Fortier, and R. D. Lambert
Expression of Cyclooxygenase-2 and Granulocyte-Macrophage Colony-Stimulating Factor in the Endometrial Epithelium of the Cow Is Up-Regulated During Early Pregnancy and in Response to Intrauterine Infusions of Interferon-{tau}
Biol Reprod, January 1, 2004; 70(1): 54 - 64.
[Abstract] [Full Text] [PDF]

Home page
 J ANIM SCIHome page
P. D. Burns, T. E. Engle, M. A. Harris, R. M. Enns, and J. C. Whittier
Effect of fish meal supplementation on plasma and endometrial fatty acid composition in nonlactating beef cows
J Anim Sci, November 1, 2003; 81(11): 2840 - 2846.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
R. Telgmann, R. A.D. Bathgate, S. Jaeger, G. Tillmann, and R. Ivell
Transcriptional Regulation of the Bovine Oxytocin Receptor Gene
Biol Reprod, March 1, 2003; 68(3): 1015 - 1026.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
L. Koumas and R. P. Phipps
Differential COX localization and PG release in Thy-1+ and Thy-1- human female reproductive tract fibroblasts
Am J Physiol Cell Physiol, August 1, 2002; 283(2): C599 - C608.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
J. A. Arosh, J. Parent, P. Chapdelaine, J. Sirois, and M. A. Fortier
Expression of Cyclooxygenases 1 and 2 and Prostaglandin E Synthase in Bovine Endometrial Tissue During the Estrous Cycle
Biol Reprod, July 1, 2002; 67(1): 161 - 169.
[Abstract] [Full Text] [PDF]

Home page
 Reproductive SciencesHome page
D. M. Slater, S. Zervou, and S. Thornton
Prostaglandins and Prostanoid Receptors in Human Pregnancy and Parturition
Reproductive Sciences, May 1, 2002; 9(3): 118 - 124.
[Abstract] [PDF]

Home page
 Physiol. Rev.Home page
G. Gimpl and F. Fahrenholz
The Oxytocin Receptor System: Structure, Function, and Regulation
Physiol Rev, April 1, 2001; 81(2): 629 - 683.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
T. Engstrøm, P. Bratholm, N. J. Christensen, and H. Vilhardt
Effect of Oxytocin Receptor Blockade on Rat Myometrial Responsiveness to Prostaglandin F2{alpha}
Biol Reprod, November 1, 2000; 63(5): 1443 - 1449.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fuchs, A.-R.
Right arrow Articles by Fields, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fuchs, A.-R.
Right arrow Articles by Fields, M. J.
Agricola
Right arrow Articles by Fuchs, A.-R.
Right arrow Articles by Fields, M. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS