| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
a Departments of Animal Sciences and
b Biochemistry and Child Health, University of Missouri at Columbia, Columbia, Missouri 65211
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
(ER), and that upon ligand binding, the hormone-receptor complex is capable of regulating specific gene expression. The discovery of another estrogen receptor, estrogen receptor-ß (ERß) [1, 2], has augmented the potential permutations and mechanisms of regulation of estrogen action in the ovary. Despite the well-characterized role of estrogens in uterine function, there is a paucity of information defining the local role of estrogens within the ovary. Estrogen has been reported to play the following roles within the ovary, including 1) stimulating development and maturation of rat ovarian follicles [3]; 2) increasing expression of FSH receptor and LH receptor by granulosa cells in rats [4, 5]; 3) modulating steroid production by granulosa and theca cells, as demonstrated in cattle [6] and rats [7, 8]; and 4) stimulating the development of gap junctions between rat granulosa cells [9]. It remains to be determined whether these estrogen-mediated actions are occurring via ER, ERß, or other novel estrogen receptors [10–13].
ER mRNA and/or protein have been localized within the ovaries of rodents [11, 14], sheep [15], nonhuman primates [16, 17], and humans [18, 19]. Among these studies, there is discrepancy in the cellular localization and stage of ovarian follicles that express ER mRNA or protein. This discordance may be attributed to the various methodologies used to detect ER mRNA and/or protein within the ovary. Since past studies of ER expression were based on the premise of one estrogen receptor, either ER and/or ERß may have been detected, depending on the method used. Additionally, there may be species differences in ER mRNA and protein expression within the ovary.
As evidenced by mRNA and protein analysis, ER and ERß appear to colocalize in certain tissues such as the ovary, uterus [20, 21], and testes [22], but there may be a differential expression of the two receptors depending on tissue cell type. The uterus appears to have greater expression of ER than ERß, whereas, ERß appears to be in greater concentrations than ER within the ovary [20, 21]. ER has been localized in granulosa cells of human antral follicles [18]. To date, only rat ovarian granulosa cells have been reported to contain ERß mRNA [1, 20] and protein [23].
We were interested in cloning and localizing bovine ERß (bERß) within the bovine ovary to better understand its possible local role in estrogen regulation of ovarian follicular development. Additionally, as it has been demonstrated in cattle [24], humans [25], and rodents [26, 27] that either estrogen or estrogen receptor imbalances/disturbances may result in ovarian follicular cysts, future studies will examine the role of bERß in the development of ovarian follicular cysts in cattle. Studies in cattle with ovarian follicular cysts [24] may also help in understanding and treating human polycystic ovarian syndrome [28].
In this report, the complete protein coding sequence of bERß is characterized. In addition, in situ hybridization and immunohistochemistry were used to localize bERß mRNA and protein, respectively, at various stages of antral ovarian follicular development.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Holstein dairy cows used for these experiments were initially housed on a dry feedlot, and from the onset of estrus they were housed inside the Animal Science Research Center large-animal facility. Ovarian activity was monitored by transrectal ultrasound examination daily. In accordance with institutional animal care protocols, ovaries were removed by flank laparotomy during the first wave of the estrous cycle. Small (1–5 mm), medium (6–9 mm), and large (> 9 mm), viable antral follicles were dissected from the ovarian stroma. Ovarian follicles used for immunohistochemistry were fixed in Bouin's (Sigma Chemical Company, St. Louis, MO) for 24–48 h and then routinely processed and embedded in paraffin, and 4- to 5-µm sections were cut. Tissues used for RNA isolation and in situ hybridization were rapidly frozen over liquid nitrogen within 30 min of collection and stored at -80°C until RNA was isolated or 14-µm sections were cut [29].
Total RNA Isolation
Total ovarian follicular RNA was isolated using guanidine thiocyanate and phenol/chloroform extraction (Tri Reagent; Sigma). The RNA was reconstituted in 50 µl of diethyl pyrocarbonate-treated water and then stored at -80°C.
Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Amplification and Gel-Purification Protocol
Total RNA (1–2 µg) isolated from bovine ovarian follicles was reverse transcribed to cDNA. The N-terminal outermost primer (5'GTGCCTCTTCTTGCAAGGTG3') was created based on human ERß (base pair numbers 55–74 in [30]). The C-terminal outermost primer (5'TTCACCTCAGGGCCAGGCGTCA3') was designed based on human ERß (base pair numbers 1471–1450 in [2] and 1710–1699 in [30]). RT-PCR amplification was achieved using the Titan one-tube RT-PCR system kit (Boehringer-Mannheim, Indianapolis, IN). Each reaction tube contained a final concentration of 0.2 mM dNTPs (Promega, Madison, WI), 5 mM dithiothreitol (Boehringer-Mannheim), 1.6 U RNasin (Promega), single-strength RT-PCR buffer with 1.5 mM Mg2+ mix (Boehringer-Mannheim), and enzyme mix of avian myeloblastosis virus reverse transcriptase and Expand High Fidelity PCR system (Boehringer-Mannheim). The reverse transcriptase reaction was done at 42°C for 30 min. Touchdown PCR, which spanned from 68° to 50°C for 20–41 cycles, was used [31]. A second generation of PCR was performed with nested and hemi-nested primers that had an initial dwell at 94°C for 1 min, followed by 15–24 cycles of 94°C for 40 sec, 58°C for 40 sec, and 72°C for 1.5 min, and ending with a prolonged extension at 72°C for 5 min. The amplified DNA was fractionated electrophoretically on a 2% agarose gel, stained with ethidium bromide, and visualized under UV light. The amplified bands were excised and gel purified using either electroelution with potassium acetate followed by ethanol precipitation or the Qiax II gel-purification kit (Qiagen, Valencia, CA).
DNA Sequencing and Analysis
RT-PCR-amplified bERß cDNA fragments were cloned into the pCR-Script AMP (SK[+]) (Stratagene, La Jolla, CA) vector system. Gel purified-cDNA and plasmid DNA were sequenced using the cycle sequencing fluorometric method (PE Applied Biosystems, Foster City CA). In total, 6 overlapping regions were sequenced. Two overlapping, independent clones of each of these regions were sequenced off both strands. Determination of the cDNA sequence was performed using the ABI 377 sequencer at the DNA Core Facility, University of Missouri, Columbia. Sequences were analyzed and homologies to other species ERß sequences determined using the Genetics Computer Group (Madison, WI) software analysis program [32].
In Situ Hybridization
The two probes used for in situ hybridization were generated from the RT-PCR-amplified cDNA from bovine ovarian follicular RNA. The first probe for bERß was 787 base pairs (bp) and extended from bp 142 to 919 (Fig. 1). The second probe was 198 bp and extended from bp 1406 (Fig. 1) through the C-terminal outer primer described above. The clones used for generating the probes were ligated into pCR-Script SK(+) vector (Stratagene). Restriction digest and subsequent in vitro transcription, using purified linearized cDNA templates, were performed to generate both antisense and sense probes. BsgI restriction enzyme and T3 polymerase were used to generate the first antisense bERß probe, which spanned exons 2–5 [33], and XcmI restriction enzyme and T7 polymerase were used to generate the sense probe from this bERß clone. The second antisense probe from bERß exon 9 [33] clone was generated using BstAP1 restriction enzyme and T7 polymerase, and the sense probe from this clone was generated using EcoNI restriction enzyme and T3 polymerase.
|
To verify 35S-labeled transcription, aliquots of cRNA probes were electrophoretically fractionated on a 6% polyacrylamide gel and then exposed to Kodak X-Omat XAR-5 film (Eastman Kodak, Rochester, NY) for 12 h. In situ hybridization was performed as previously described [29]. The probes were diluted to 1 x 107 cpm/ml in hybridization buffer. Sections of bovine ovarian follicles were incubated with either antisense or sense bERß probes overnight in a 55°C oven in a humidified chamber. Autoradiography was done for 2 wk at 4°C, and the slides were then developed and lightly stained with hematoxylin and eosin. In total, 53 healthy ovarian antral follicles [34] from 20 different cows were examined using in situ hybridization with both probes. The 53 ovarian antral follicles included 32 small, 9 medium, and 12 large antral follicles.
Immunohistochemistry
Immunohistochemistry for ERß was performed as previously described [22]. Briefly, paraffin-embedded bovine ovarian follicle sections (4–5 µm) were placed in a microwave for 5–10 min to expose the cellular antigens and increase binding affinity of the antibody to the antigen [35]. Endogenous peroxidase activity and nonspecific binding were blocked by hydrogen peroxide and goat serum, respectively. An N-terminal anti-rat polyclonal ERß antibody (Affinity BioReagents, Golden, CO) generated in rabbits against a peptide from amino acids 119–134 of the rat ERß sequence (AEPQKSPWCEARSLEH) ([1], GenBank accession no. AJ002603) was incubated with tissues overnight at 4°C in a moist chamber [22]. In this region, there was 87.5% homology between rat and bovine ERß with 2 of 16 amino acid mismatches (see underlined sequence in Fig. 2b). Serial tissue sections incubated with anti-ERß antibody preabsorbed with the ERß peptide, rabbit preimmune sera, or no primary antibody served as negative controls. Anti-rabbit IgG was used as the secondary antibody, and then tissue was incubated with avidin and biotin (Dako Corp., Carpinteria, CA). A positive reaction was visualized using diaminobenzidine (DAB; Dako Corp.). All sections were examined immediately after DAB staining. After examination, negative control sections (sections used for peptide competition experiments and sections using preimmune serum or no primary antibody) and some of the primary antibody-only sections were counterstained with hematoxylin for 15–20 sec for better visualization of the cellular architecture of the ovarian follicles. Photomicrographs were digitalized using Image I software (NIH, Bethesda, MD). They were compiled using Adobe Photoshop 4.0 for Macintosh (Adobe Systems Incorporated, Buffalo, NY) and printed with a Fuji Pictography 3000 printer (Fuji Photo Film, Tokyo, Japan). In total, 26 healthy ovarian antral follicles [34], collected from 10 cows during the first wave of the estrous cycle, were immunohistochemically examined. The 26 ovarian antral follicles included 7 small, 8 medium, and 11 large antral follicles.
|
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
As evidenced by sequence analysis, bERß mRNA spanned an open reading frame of 1584 nucleotides encoding a protein of 527 amino acids (Fig. 1). Comparison of the derived bERß amino acid sequence with rat ([1], GenBank accession no. AJ002603), human [2, 30], and mouse ([36, 37], GenBank accession no. AF067422) sequences revealed that bERß was similar in size and more closely related to human ERß than to mouse or rat ERß (Fig. 2, a and b). Among the three species, the greatest variability was within the N-terminal region, with bERß having 80% amino acid homology to human and mouse ERß and 79% homology to rat ERß (Fig. 2, a and b). In the DNA-binding region, bERß protein was found to be 100% homologous to human, mouse, and rat ERß (Fig. 2, a and b). In the C-terminal/ligand-binding region, bERß protein was 89%, 86%, and 88% homologous to human, mouse, and rat ERß, respectively (Fig. 2, a and b).
Bovine ERß mRNA Localization within Ovarian Follicles
Using two antisense probes from two different regions of bERß mRNA for in situ hybridization, bERß mRNA was localized to granulosa cells of small (1–5 mm; Fig. 3, A and C), medium (6–9 mm; Fig. 3, D and F), and large (> 9 mm; Fig. 3, G and I) antral follicles. No specific hybridization was observed in theca cells of small, medium, or large antral follicles. Only background, nonspecific hybridization was present in control serial sections of small (Fig. 3B), medium (Fig. 3E), and large (Fig. 3H) antral follicles incubated with the sense probes for bERß. All small, medium, and large antral follicles examined demonstrated similar hybridization localization with both probes.
|
Bovine ERß Protein Localization within Ovarian Follicles
Immunohistochemical localization of ERß within the bovine ovary detected ERß protein within the granulosa cells of small (Fig. 4A), medium (Fig. 4C), and large (Fig. 4E) antral follicles. Positive staining for ERß was present in the corona radiata, cumulus oophorus, and mural granulosa cells (Fig. 4E). Slight staining was present within theca interna and externa cells, and little to no staining was present within ovarian stroma cells. Control serial sections of ovarian follicles from small (Fig. 4B), medium (Fig. 4D), and large (Fig. 4F) antral follicles, incubated with a mixture of the competing N-terminal ERß peptide (1 µg/ml) and antibody, did not show staining within the granulosa or theca cells after incubation with DAB. All sections except those shown in Figure 4, A and C, were briefly counterstained with hematoxylin to better visualize the morphology. In control sections, no competition was observed with nonspecific peptides (data not shown). No staining was present in sections incubated with rabbit preimmune sera or when the primary antibody was omitted (data not shown). All small, medium, and large antral follicles that were immunohistochemically examined produced similar results.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Bovine and human [30] ERß are longer in the N-terminal region than previously reported for the initial rat ERß-coding DNA sequence [1]. It has been recently reported that rat (GenBank accession no. AJ002603) and mouse (GenBank accession no. AF067422) ERß are longer than initially published [1], and the derived rodent ERß sequences (GenBank accession no. AJ002603 and no. AF067422) may encode 19 more amino acids in the N-terminal region compared to human and bovine ERß. The derived human and bovine ERß sequences have an in-frame stop codon 5' of the identified methionine, and thus human and bovine ERß coding sequences cannot extend to the same initiation methionine as reported for rat and mouse ERß. Additional evidence that the identified methionine is the start codon for human and bovine ERß lies in the fact that it includes a good Kozak consensus region [38]. The initiation methionine identified for human and bovine ERß has better Kozak consensus sequences than the recently identified initiation methionine farther 5' for rat and mouse ERß (GenBank accession no. AJ002603 and no. AF067422). Finally, the initially reported rat ERß start codon [1] corresponds to bERß amino acid #46, a valine, and thus it cannot be the initiation codon for bERß (Fig. 2, a and b).
Overall, bERß protein is most homologous to human ERß followed by mouse and rat ERß. The amino acid sequence within the DNA-binding domain of bERß is 100% homologous to human, mouse, and rat ERß. The strong sequence homology within the ERß DNA-binding domain suggests a conservation of ERß DNA-binding specificity throughout mammalian evolution. The relatively strong amino acid sequence homology within the C-terminal/ligand-binding region is not surprising, as significant variability within this region would result in an inability of estrogen to bind to ERß. Additionally, within this region, dimerization between members of the nuclear receptor superfamily has been reported to occur [39, 40]. Most of the amino acid differences within this region are conservative changes or ones that vary among all characterized mammalian ERß sequences.
Bovine ERß mRNA and protein were present within the granulosa cells of small, medium, and large antral follicles (Figs. 3 and 4). Therefore, ERß may play an important role in ovarian follicular growth, development, and subsequent ovulation. Immunohistochemistry for ERß revealed that there may be a slight amount of ERß protein expression within the theca cells of bovine antral follicles, whereas on the basis of in situ hybridization, theca cells of bovine ovarian follicles do not appear to express ERß mRNA. The disparity in these findings may be due to the low concentration of ERß mRNA within theca cells relative to a higher protein expression of ERß within these cells. Immunohistochemistry in the rat ovary seems to demonstrate a scant amount of positive staining within the theca cells [23], but in situ hybridization in rat and human ovaries does not demonstrate specific expression for ERß within theca cells [1, 20, 33].
ERß mRNA has been identified in the fetal mouse ovary [41, 42] and in adult rat [1, 20], mouse [21], and human [33] ovaries. Several of these studies used RNA isolated from whole tissue [21, 42], and thus determination of specific cellular localization was not possible. In species examined to date, only rat [23] and bovine (in these experiments) ovaries have been shown to have ERß protein expression in granulosa cells of antral follicles. Aside from the current study, no other single study has localized both ERß mRNA and protein to antral ovarian follicles.
Regulation of ERß mRNA and protein expression within the ovary is incompletely characterized. Human CG has been shown to down-regulate ERß mRNA expression within the rat ovary [20]. It remains to be determined whether there are quantifiable differences in bERß mRNA and protein expression within ovarian follicles at various stages throughout the estrous cycle and within ovarian follicular cysts. With the cloning and localization of bERß within the ovarian follicle, future studies can quantitate ovarian bERß in order to examine its role in follicular recruitment, selection, and dominance.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Correspondence: Dennis B. Lubahn, University of Missouri, 163 ASRC, 920 East Campus Drive, Columbia, MO 65211. FAX: 573 882 6827; lubahnd{at}missouri.edu
Accepted: October 14, 1998.
Received: July 8, 1998.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
(ER) and estrogen receptor-ß (ERß) messenger ribonucleic acid in the wild-type and ER-knockout mouse. Endocrinology 1997; 138:4613–4621. knockout and wild type mice. Endocrinology 1998; 139:2982–2987. in vivo and in vitro. Biochem Biophys Res Commun 1998; 243:122–126.[CrossRef][Medline]-hydroxylase, and cytochrome P450 aromatase in bovine follicles during the first follicular wave. Endocrinology 1995; 136:981–989.[Abstract]. Mol Endocrinol 1997; 11:1486–1496. and ß in the developing reproductive tract of male and female mice. In: Program of the 80th meeting of the Endocrine Society; 1998; New Orleans, LA. Abstract P1–570.) and beta (ER-ß) mRNA in the midgestational human fetus. J Clin Endocrinol Metab 1997; 82:3509–3512.This article has been cited by other articles:
|
|
 |
|
  W. Luo and M. C. Wiltbank Distinct Regulation by Steroids of Messenger RNAs for FSHR and CYP19A1 in Bovine Granulosa Cells Biol Reprod, August 1, 2006; 75(2): 217 - 225. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M Quirk, R. G Cowan, and R. M Harman The susceptibility of granulosa cells to apoptosis is influenced by oestradiol and the cell cycle. J. Endocrinol., June 1, 2006; 189(3): 441 - 453. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. J. Spicer Effects of Estradiol on Bovine Thecal Cell Function In Vitro: Dependence on Insulin and Gonadotropins J Dairy Sci, July 1, 2005; 88(7): 2412 - 2421. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.C.O. Evans, J.L.H. Ireland, M.E. Winn, P. Lonergan, G.W. Smith, P.M. Coussens, and J.J. Ireland Identification of Genes Involved in Apoptosis and Dominant Follicle Development During Follicular Waves in Cattle Biol Reprod, May 1, 2004; 70(5): 1475 - 1484. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L. Hardy, G. M. Anderson, M. Valent, J. M. Connors, and R. L. Goodman Evidence That Estrogen Receptor Alpha, but Not Beta, Mediates Seasonal Changes in the Response of the Ovine Retrochiasmatic Area to Estradiol Biol Reprod, March 1, 2003; 68(3): 846 - 852. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. Jakimiuk, S. R. Weitsman, H.-W. Yen, M. Bogusiewicz, and D. A. Magoffin Estrogen Receptor {alpha} and {beta} Expression in Theca and Granulosa Cells from Women with Polycystic Ovary Syndrome J. Clin. Endocrinol. Metab., December 1, 2002; 87(12): 5532 - 5538. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. N. Jefferson, J. F. Couse, E. Padilla-Banks, K. S. Korach, and R. R. Newbold Neonatal Exposure to Genistein Induces Estrogen Receptor (ER){alpha} Expression and Multioocyte Follicles in the Maturing Mouse Ovary: Evidence for ER{beta}-Mediated and Nonestrogenic Actions Biol Reprod, October 1, 2002; 67(4): 1285 - 1296. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. Rosenfeld, C.-S. Han, A. P. Alexenko, T. E. Spencer, and R. M. Roberts Expression of Interferon Receptor Subunits, IFNAR1 and IFNAR2, in the Ovine Uterus Biol Reprod, September 1, 2002; 67(3): 847 - 853. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Yang, A. Kriatchko, and S. K. Roy Expression of ER-{alpha} and ER-{beta} in the Hamster Ovary: Differential Regulation by Gonadotropins and Ovarian Steroid Hormones Endocrinology, June 1, 2002; 143(6): 2385 - 2398. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Schuler, C. Wirth, U. Teichmann, K. Failing, R. Leiser, H. Thole, and B. Hoffmann Occurrence of Estrogen Receptor {alpha} in Bovine Placentomes Throughout Mid and Late Gestation and at Parturition Biol Reprod, April 1, 2002; 66(4): 976 - 982. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. A. LaVoie, D. C. DeSimone, C. Gillio-Meina, and Y. Y. Hui Cloning and Characterization of Porcine Ovarian Estrogen Receptor {beta} Isoforms Biol Reprod, March 1, 2002; 66(3): 616 - 623. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. A. Kowalski, L. G. Graddy, D. S. Vale-Cruz, I. Choi, B. S. Katzenellenbogen, F. A. Simmen, and R. C.M. Simmen Molecular Cloning of Porcine Estrogen Receptor-{beta} Complementary DNAs and Developmental Expression in Periimplantation Embryos Biol Reprod, March 1, 2002; 66(3): 760 - 769. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Cheng, Z. Weihua, S. Makinen, S. Makela, S. Saji, M. Warner, J.-A. Gustafsson, and O. Hovatta A Role for the Androgen Receptor in Follicular Atresia of Estrogen Receptor Beta Knockout Mouse Ovary Biol Reprod, January 1, 2002; 66(1): 77 - 84. [Abstract] [Full Text]
|
|
|
|
|
|
X. Chen, C. S. Rosenfeld, R. M. Roberts, and J. A. Green An Aspartic Proteinase Expressed in the Yolk Sac and Neonatal Stomach of the Mouse Biol Reprod, October 1, 2001; 65(4): 1092 - 1101. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. T. Jansen, C. West, M. N. Lehman, and V. Padmanabhan Ovarian Estrogen Receptor-{beta} (ER{beta}) Regulation: I. Changes in ER{beta} Messenger RNA Expression Prior to Ovulation in the Ewe Biol Reprod, September 1, 2001; 65(3): 866 - 872. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. D. Calder, M. Manikkam, B. E. Salfen, R. S. Youngquist, D. B. Lubahn, W. R. Lamberson, and H. Allen Garverick Dominant Bovine Ovarian Follicular Cysts Express Increased Levels of Messenger RNAs for Luteinizing Hormone Receptor and 3{beta}-Hydroxysteroid Dehydrogenase {Delta}4,{Delta}5 Isomerase Compared to Normal Dominant Follicles Biol Reprod, August 1, 2001; 65(2): 471 - 476. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Cardenas, K.A. Burke, R.M. Bigsby, W.F. Pope, and K.P. Nephew Estrogen Receptor {beta} in the Sheep Ovary During the Estrous Cycle and Early Pregnancy Biol Reprod, July 1, 2001; 65(1): 128 - 134. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. F. Palter, A. B. Tavares, A. Hourvitz, J. D. Veldhuis, and E. Y. Adashi Are Estrogens of Import to Primate/Human Ovarian Folliculogenesis? Endocr. Rev., June 1, 2001; 22(3): 389 - 424. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Mansour, M. R. Machen, B. J. Tarleton, A. A. Wiley, J. Wower, F. F. Bartol, and H. O. Goyal Expression and Molecular Characterization of Estrogen Receptor Alpha Messenger RNA in Male Reproductive Organs of Adult Goats Biol Reprod, May 1, 2001; 64(5): 1432 - 1438. [Abstract] [Full Text]
|
|
|
|
|
|
C.-H. Chiang, K. W. Cheng, S. Igarashi, P. S. Nathwani, and P. C. K. Leung Hormonal Regulation of Estrogen Receptor {alpha} and {beta} Gene Expression in Human Granulosa-Luteal Cells in Vitro J. Clin. Endocrinol. Metab., October 1, 2000; 85(10): 3828 - 3839. [Abstract] [Full Text]
|
|
|
|
|
|
P. T.K. Saunders, M. R. Millar, K. Williams, S. Macpherson, D. Harkiss, R. A. Anderson, B. Orr, N. P. Groome, G. Scobie, and H. M. Fraser Differential Expression of Estrogen Receptor-{alpha} and -{beta} and Androgen Receptor in the Ovaries of Marmosets and Humans Biol Reprod, October 1, 2000; 63(4): 1098 - 1105. [Abstract] [Full Text]
|
|
|
|
|
|
C. J. Scott, A. J. Tilbrook, D. M. Simmons, J. A. Rawson, S. Chu, P. J. Fuller, N. H. Ing, and I. J. Clarke The Distribution of Cells Containing Estrogen Receptor-{alpha} (ER{alpha}) and ER{beta} Messenger Ribonucleic Acid in the Preoptic Area and Hypothalamus of the Sheep: Comparison of Males and Females Endocrinology, August 1, 2000; 141(8): 2951 - 2962. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Duffy, C. L. Chaffin, and R. L. Stouffer Expression of Estrogen Receptor {alpha} and {beta} in the Rhesus Monkey Corpus Luteum during the Menstrual Cycle: Regulation by Luteinizing Hormone and Progesterone Endocrinology, May 1, 2000; 141(5): 1711 - 1717. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. Rosenfeld, A. A. Murray, G. Simmer, M. G. Hufford, M. F. Smith, N. Spears, and D. B. Lubahn Gonadotropin Induction of Ovulation and Corpus Luteum Formation in Young Estrogen Receptor-{alpha} Knockout Mice Biol Reprod, March 1, 2000; 62(3): 599 - 605. [Abstract] [Full Text]
|
|
|
|
|
|
W. N. Jefferson, J. F. Couse, E. P. Banks, K. S. Korach, and R. R. Newbold Expression of Estrogen Receptor {beta} Is Developmentally Regulated in Reproductive Tissues of Male and Female Mice Biol Reprod, February 1, 2000; 62(2): 310 - 317. [Abstract] [Full Text]
|
|
|
|
