Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nasu, K.
Right arrow Articles by Miyakawa, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nasu, K.
Right arrow Articles by Miyakawa, I.
Agricola
Right arrow Articles by Nasu, K.
Right arrow Articles by Miyakawa, I.
Biology of Reproduction 60, 1183-1187 (1999)
©Copyright 1999 Society for the Study of Reproduction, Inc.

Expression of Hepatocyte Growth Factor in Cultured Human Endometrial Stromal Cells Is Induced through a Protein Kinase C-Dependent Pathway

Kaei Nasu1,a, Terumasa Suganoa, Naohiko Matsuia, Hisashi Naraharaa, Yasushi Kawanoa, and Isao Miyakawaa

a Department of Obstetrics and Gynecology, Oita Medical University, Hasama-machi, Oita 879-5593, Japan


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To examine the production of hepatocyte growth factor (HGF) by human endometrial stromal cells (ESC) in vitro, concentrations of HGF in the culture media of ESC were measured after the addition of various amounts of 12-O-tetradecanoylphorbol 13-acetate (TPA), forskolin, lipopolysaccharide (LPS), interleukin (IL)-1ß, IL-6, IL-8, tumor necrosis factor {alpha} (TNF{alpha}), interferon-{gamma} (IFN{gamma}), or ethynylestradiol-17{alpha} using an ELISA. The expression of HGF mRNA was also assayed by a reverse transcription-polymerase chain reaction. The concentration of HGF in the culture media of unstimulated ESC was below the detection level of the assay. TPA stimulated the secretion of HGF by ESC in a dose-dependent manner. TPA also induced the transcription of HGF mRNA by ESC. Forskolin, LPS, IL-1ß, IL-6, IL-8, TNF{alpha}, IFN{gamma}, or ethynylestradiol-17{alpha} did not alter HGF mRNA or protein levels. TPA-stimulated production of HGF was partially inhibited by the addition of 1-(5-isoquinolinylsulfonyl)-2-methylpiperazine or sphingosine. These results suggest that a protein kinase C-dependent pathway may play an important role in the regulation of HGF production by ESC. HGF secreted by ESC may be involved in the regeneration of the endometrium during the normal menstrual cycle.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Human endometrial stromal cells (ESC) have the ability to produce and secrete various cytokines and growth factors, including interleukin (IL)-6 [1–3], IL-8 [2–5], macrophage colony-stimulating factor [2, 6], and macrophage chemoattractant protein-1 (MCP-1) [2, 3]. The expression of these cytokines is an important event in menstruation, bacterial infection, and implantation, since they play a key role in the attraction and activation of immune effector cells in the endometrium, as well as in the regulation of tissue regeneration of the endometrium [7, 8].

Hepatocyte growth factor (HGF), also called scatter factor, is a pleiotropic growth factor originally isolated from human and rat plasma on the basis of its ability to stimulate mitogenesis in hepatocytes [9]. It is now known to be a mesenchymal-derived multifunctional cytokine that mediates mesenchymal-epithelial interactions, acting as a mitogen, motogen, and morphogen of various epithelial cells [10–12]. HGF is reported to be produced in numerous cells of mesenchymal origin, including fibroblasts [10] and smooth muscle cells [13]. Large amounts of HGF also can be detected in the human placenta [14] and amniotic fluid [15, 16]. The relationship between HGF and its high-affinity receptor, encoded by the c-met protooncogene product [17], has been evaluated [18, 19].

IL-6 response elements, transforming growth factor ß inhibitory element and binding sites for helix-loop-helix transcription factors, nuclear factor-1, IL-6-dependent transcription factor, and AP-1 transcription factor were detected in the promoter region of HGF gene [20, 21]. It has been shown that in other cell types, IL-1ß, tumor necrosis factor {alpha}, interferon-{gamma}, tetradecanoylphorbol 13-acetate, and forskolin stimulate HGF production [22–25].

In the endometrium, HGF production is detected in ESC [26], and HGF acts on endometrial epithelial cells as a mitogen, morphogen, and motogen [27, 28]. However, the factors that control HGF production by ESC have yet to be characterized. This study used an established cell culture method [2–4] to investigate the effects of known modulators of endometrial function on HGF production by ESC in vitro.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture Conditions

Normal endometrial specimens were obtained from six premenopausal patients who had undergone hysterectomies for intramural leiomyomas. All the specimens were diagnosed as being in the late proliferative stage (11th to 13th day of the menstrual cycle) on the basis of standard histologic criteria. Normal ESC were separated from the epithelial glands by digesting the tissue fragments with collagenase as previously described [2–4]. Briefly, the tissue was cut into 2- to 3-mm pieces and incubated with collagenase (200 U/ml; Gibco-BRL, Gaithersburg, MD) in RPMI 1640 (Gibco-BRL) with stirring for 2 h at 37°C. The suspension was then filtered through a 150-µm wire sieve to remove mucus and undigested tissue. The filtrate was then passed through an 80-µm wire sieve, which allowed the stromal cells to pass through while the intact glands were retained. After washing three times with 40 ml of serum-free RPMI 1640, the cells were transferred to culture flasks (Corning, New York, NY) at a density of 106 cells/ml in RPMI 1640 supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco-BRL), streptomycin (100 U/ml; Gibco-BRL), and penicillin (100 U/ml; Gibco-BRL). The culture medium was replaced every 4 days. After three passages (15–20 days after isolation) using standard methods of trypsinization, the cells, which were > 98% pure as analyzed by immunocytochemical staining with antibodies to vimentin (V9; Dako, Glostrup, Denmark), keratin (Dako), factor VIII (Dako), and leukocyte common antigen (2B11+PD7/26; Dako), were used for the experiments. These cells were capable of decidualization.

Detection of HGF

To study the secretion of HGF protein by ESC, 1 x 106 cells were plated on 6-well culture plates (Corning) in 1 ml of culture medium with 10% FBS and cultured until they were fully confluent. The supernatants were replaced with fresh culture medium containing 12-O-tetradecanoylphorbol 13-acetate (TPA, 0.1–100 nM; Sigma, St. Louis, MO), forskolin (1–100 nM; Sigma), lipopolysaccharide (LPS; 0.01–10 µg/ml; Sigma), interleukin-1ß (IL-1ß, 1–500 pM; R&D Systems, Minneapolis, MN), IL-6 (0.1–100 ng/ml; R&D Systems), IL-8 (0.1–100 ng/ml; R&D Systems), tumor necrosis factor {alpha} (TNF{alpha}, 0.1–10 nM; R&D Systems), interferon-{gamma} (IFN{gamma}, 0.01–100 U/ml; R&D Systems), or ethynylestradiol-17{alpha} (0.1–10 nM; Sigma). To examine the involvement of protein kinase C (PKC), the inhibitory effect of 1-(5-isoquinolinylsulfonyl)-2-methylpiperazine (H-7; Sigma) or sphingosine (Sigma) on TPA-induced HGF production was measured. Under these conditions, the supernatant was collected at 12, 24, and 48 h after stimulation and stored at -70°C until assayed. The isolated cells from one patient were used for each experiment at a time, and each experiment was performed in triplicate and repeated four times. All the experiments were performed in the presence of 10% FBS.

The concentration of HGF was determined in the supernatants with a commercially available ELISA (DHG00; R&D Systems). The sensitivity of the assay for HGF was 40 pg/ml.

Reverse Transcription-Polymerase Chain Reaction (RT-PCR) for Detection of HGF mRNA

To assay the expression of HGF mRNA in ESC, 1 x 106 cells were plated on 75-cm2 culture flasks (Corning) in 15 ml of culture medium with 10% FBS and cultured until they were fully confluent. The supernatants were replaced with fresh culture medium with 10% FBS containing TPA (10 nM), forskolin (10 nM), LPS (1 µg/ml), IL-1ß (100 pM), TNF{alpha} (1 nM), or IFN{gamma} (100 U/ml) and cultured for an additional 4 h. Total RNA was extracted as previously described [29]. The cells were disrupted with 2 ml of Isogen solution (Nippon Gene, Tokyo, Japan), stored at room temperature for 5 min, and shaken vigorously for 15 sec after the addition of 0.4 ml of chloroform. The homogenates were centrifuged at 12 000 x g at 4°C for 15 min; then 0.5 ml of isopropanol was added to the aqueous phase. Each aliquot was stored at room temperature for 10 min and centrifuged at 12 000 x g at 4°C for 10 min. One milliliter of 75% ethanol (Wako, Osaka, Japan) was added to the precipitate. The aliquot was shaken vigorously and centrifuged at 12 000 x g at 4°C for 15 min. The precipitate was then dried briefly and dissolved in 30 µl of diethyl pyrocarbonate-treated water. HGF gene expression was analyzed by a an RT-PCR method using an RNA PCR kit with avian myeloblastosis virus RTase (Takara, Tokyo, Japan) as previously described [29]. RNA was reverse-transcribed into cDNA. In brief, the reaction mixture (5 mM MgCl2, single-strength RNA PCR buffer [10 mM Tris-HCl, 50 mM KCl, pH 8.3], 1 mM dNTP mixture [dATP, dCTP, dGTP, dTTP; Takara], 1 U/µl RNase inhibitor [Takara], 0.25 U/µl reverse transcriptase [Takara], and 2.5 µM random 9 mers [Takara]) was added to the RNA solution containing 1 µg of total RNA quantified by UV spectrophotometry (Gene Quant II; Pharmacia LKB Biotechnology, Uppsala, Sweden), and the mixture was incubated at 30°C for 10 min. After incubation at 42°C for 25 min, the mixture was heated to 99°C for 5 min, then chilled on ice.

To perform the PCR assay, primer sets for HGF (sense primer: 5'-191 GGACAAAGGAAAAGAAG 208 and antisense primer: 3'-681 GATTGCTTGTGAAACACC 664) [30] were synthesized by the phosphoamide method on a DNA synthesizer (Model 8700; Biosearch, San Rafael, CA), and purified on Sephadex G50 columns (Pharmacia LKB Biotechnology) and by HPLC. The predicted size of the PCR product was 490 base pairs (bp). The size of the RT-PCR product is different from that of the PCR product of genomic DNA. Primer sets for glyceraldehyde 3-phosphate dehydrogenase (G3PDH) (sense primer: 5'-71 TGAAGGTCGGAGTCAACGGATTTGGT 96 and antisense primer: 3'-1053 CATGTGGGCCATGAGGTCCACCAC 1030; Clontech Laboratories, Palo Alto, CA) were also used as internal controls. The predicted size of the PCR product was 983 bp.

The cDNA transcribed from 1 µg of total RNA was amplified using a thermal cycler (Model PJ2000; Perkin Elmer, Norwalk, CT) in a total volume of 80 µl containing 4 mM MgCl2, single-strength RNA PCR buffer, 0.2 µM of each primer, and 2.5 U of Taq DNA polymerase (Takara). We also added the samples without cDNA, Taq polymerase, or primer sets as negative controls. The PCR with primer pairs for HGF was performed for 40 cycles, with each cycle consisting of a denaturation step of 94°C for 1 min, an annealing step of 53°C for 1 min, and an extension step of 72°C for 2 min. The PCR with primer pairs for G3PDH was performed for 35 cycles with each cycle consisting of a denaturation step of 94°C for 1 min, an annealing step of 55°C for 1 min, and an extension step of 72°C for 2 min. The PCR products were separated by 1.5% agarose gel (Takara) electrophoresis and visualized by ethidium bromide (Takara) staining.

To validate that the amplified cDNA were HGF, the PCR products were cloned with TA cloning kit (Invitrogen, Leek, Netherlands) at the start. Then direct sequence analysis of the PCR products was performed.

Statistical Analysis

Data are presented as mean ± SD of triplicate samples from four separate representative experiments and were analyzed by Student's t-test and the Bonferroni/Dunn test with StatView 4.5 (Abacus Concepts, Berkeley, CA), when appropriate. A level of p < 0.05 was accepted as statistically significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
The concentration of HGF in the culture media of unstimulated ESC after 24 h of incubation was below the detection limit of the assay. HGF secretion by ESC was induced with the addition of TPA (2.5–100 nM). In contrast, forskolin (1–100 nM), LPS (0.01–10 µg/ml), IL-1ß (1–500 nM), IL-6 (0.1–100 ng/ml), IL-8 (0.1–100 ng/ml), TNF{alpha} (0.1–10 nM), IFN{gamma} (0.01–100 U/ml), and ethynylestradiol-17{alpha} (0.1–10 nM) did not stimulate HGF production by ESC in vitro within 48 h. Table 1 shows representative results for each reagent tested.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Effects of incubation with various agents for 24 h on the secretion of HGF by ESC.a

Next, we examined the secretion of HGF after 24 h of stimulation with various amounts of TPA (Fig. 1). HGF secretion was undetectable after stimulation with TPA concentrations less than 1 nM. TPA stimulated HGF production in a dose-dependent manner with the maximum effect at 10 nM. As shown in Figure 2, HGF concentrations after the addition of TPA (10 nM) increased in a time-dependent manner, with peak levels at 24 h. The effect of TPA on HGF production was partially inhibited by H-7 or sphingosine (Fig. 3).



View larger version (12K):
[in this window]
[in a new window]
  		FIG. 1. Concentrations of HGF in the culture media of ESC stimulated with various amounts of TPA: 1) 0 nM (control); 2) 1 nM; 3) 2.5 nM; 4) 5 nM; 5) 10 nM; 6) 25 nM. *p < 0.001 vs. control. The data are expressed as mean ± SD of triplicate samples from four separate representative experiments.



View larger version (11K):
[in this window]
[in a new window]
  		FIG. 2. Time course of HGF concentrations after the addition of TPA (10 nM). A time-dependent increase in the HGF concentration was observed, with peak levels at 24 h. The data are expressed as mean ± SD of triplicate samples from four separate representative experiments.



View larger version (10K):
[in this window]
[in a new window]
  		FIG. 3. Inhibitory effect of H-7 and sphingosine on HGF production by ESC. 1) TPA (10 nM; control); 2) TPA (10 nM) and H7 (10 µM); 3) TPA (10 nM) and sphingosine (10 µM). *p < 0.025 vs. control. The data are expressed as mean ± SD of triplicate samples from four separate representative experiments.

As shown in Figure 4, HGF mRNA expression was detected in the placenta (positive control), as previously described [30]. The expression of HGF mRNA was observed in ESC only after TPA (10 nM) stimulation. HGF mRNA expression was below the detection level in unstimulated ESC and in ESC stimulated with forskolin (10 nM), LPS (1 µg/ml), IL-1ß (100 nM), TNF{alpha} (1 nM), or IFN{gamma} (100 U/ml). Expression of G3PDH mRNA was detected in all these samples. Complementary DNA for HGF or G3PDH were not amplified in samples without cDNA, Taq polymerase, or primer sets (negative controls; data not shown).



View larger version (36K):
[in this window]
[in a new window]
  		FIG. 4. Electrophoresis of the RT-PCR products. 1) Normal placental tissue; 2) unstimulated ESC; 3) TPA (10 nM)-stimulated ESC; 4) forskolin (10 nM)-stimulated ESC; 5) LPS (1 µg/ml)-stimulated ESC; 6) IL-1ß (100 nM)-stimulated ESC; 7) TNF{alpha} (1 nM)-stimulated ESC; 8) IFN{gamma} (100 U/ml)-stimulated ESC.

The cDNA sequence of the amplified cDNA with primer sets for HGF was consistent with the previously reported sequence of human HGF [31, 32].


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
HGF, a cytokine derived from the mesenchyme, mediates interactions between the mesenchyme and epithelium. Negami et al. [27] reported that HGF stimulates the proliferation of cultured endometrial epithelial cells and the superficial epithelialization of epithelial cells cultured on Matrigel. Sugawara et al. [28] also demonstrated that HGF stimulates the proliferation, migration, and lumen formation of endometrial epithelial cells in vitro. Sugawara et al. [26] also were able to detect the constitutive secretion of HGF by cultured ESC from normal women and patients with endometriosis. HGF production by ESC was up-regulated in the patients with endometriosis. The discrepancy between their results and ours may be due to the difference in culture conditions. The serum concentrations of HGF also vary significantly during the menstrual cycle (with the highest concentrations during menses) and may correlate with endometrial thickness [27]. We failed to detect HGF expression by ESC in vivo throughout the menstrual cycle and during pregnancy by immunohistochemistry (data not shown); however, these data suggest that HGF production by ESC is not merely an in vitro phenomenon and that HGF may be involved in the reconstruction and growth of the endometrium during the menstrual cycle and in the pathogenesis of endometriosis.

Recent studies have shown that HGF stimulates the migration and proliferation of gastric epithelial cells and contributes to the healing of gastric mucosa [33]. The processes involved in endometrial regeneration are similar to those seen during the healing of mucosal wounds, in that migration and cellular proliferation originate at the edge of the denuded area. HGF may also promote the regeneration and repair of the human endometrium during the proliferative phase.

Because of its distinctive ability to act as a mitogen, a motogen, and a morphogen, HGF is an ideal candidate to orchestrate the biologic processes leading to the development of normal complex structures (organs). In the process of organ development and regeneration, the formation of new blood vessels is required. Several studies have shown that HGF elicits mitogenic, motogenic, and morphogenic activities in endothelial cells, and also that HGF is a potent angiogenic factor [12, 34–36]. It seems likely that the activation of HGF production may be involved in neovascularization and in maintenance of the integrity of the endometrial vasculature.

IL-1- and IL-6-responsive elements are present in the human HGF gene [20], and the HGF gene is activated transcriptionally by these cytokines [22]. In skin fibroblasts, IL-1ß, TNF{alpha}, IFN{gamma}, and forskolin are known to stimulate the production of HGF mRNA and protein [22, 23]. HGF expression is also induced by estrogen in the murine ovary [37]. However, we could not detect a stimulatory effect on HGF production by these agents. Epidermal growth factor, platelet-derived growth factor, basic fibroblast growth factor, acidic fibroblast growth factor, and transforming growth factor {alpha} also have been reported to stimulate HGF secretion by these cells [38], whereas transforming growth factor ß1 and dexamethasone inhibit HGF production in lung fibroblasts and leukemic cells [38–40].

PKC is a family of protein kinases that undergoes translocation from one intracellular component to another when activated by neurotransmitters, hormones, and growth factors and is an integral part of the cell signaling machinery [41]. PKC comprises a protein family of at least 11 members that can be divided into three distinct classes: classical PKC comprising PKC{alpha}, ßI, ßII, and {gamma}; novel PKC comprising PKC {delta}, {epsilon}, {eta}, {theta}, and µ/PKD; and atypical PKC comprising aPKC{zeta} and aPKC{iota}/{lambda} [41]. Classical PKC and novel PKC members are activated by phorbol esters such as TPA in vitro and in vivo and are likely receptors for these agents in cells [42]. Tamura et al. [24] demonstrated that TPA stimulates HGF production by human gingival and embryonic lung fibroblasts. Nishino et al. [25] also reported that TPA stimulated the production of HGF in a promyelocytic leukemia cell line, HL-60. These data suggest that HGF expression is stimulated by the activation of both protein kinase A- and PKC-mediated pathway in these cell types. AP-1 site on the HGF promoter region may be involved in the PKC-mediated pathway [20, 21]. However, the regulatory factor for HGF production in the endometrium is still unknown.

We have previously demonstrated that cultured ESC synthesize large quantities of IL-6 and IL-8 in response to TPA, and that TPA inhibited MCP-1 production by ESC in vitro [3]. In this report, we demonstrated that TPA stimulated mRNA expression and protein secretion of HGF by ESC. In contrast to previous findings on other cell types, forskolin, IL-1ß, TNF{alpha}, and IFN{gamma} did not induce HGF production by ESC. IL-6 and IL-8 did not affect HGF production. It is suggested that a PKC-dependent pathway may be involved in the regulation of HGF production by ESC. The factors regulating HGF in ESC may differ from those in other cell types. Further studies are required to confirm a link between these in vitro experimental data and clinical phenomena in vivo.


   FOOTNOTES
 
1 Correspondence. FAX: 81 97 549 5087; nasuk{at}fat.coara.or.jp Back

Accepted: December 17, 1998.

Received: August 24, 1998.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Tabibzadeh SS, Santhanam U, Sehgal PB, May LT. Cytokine-induced production of IFN-ß2/IL-6 by freshly explanted human endometrial stromal cells. Modulation by estradiol-17ß. J Immunol 1989; 142:3134–3139.[Abstract]
  2. Nasu K, Matsui N, Narahara H, Tanaka Y, Miyakawa I. Effects of interferon-{gamma} on cytokine productions of endometrial stromal cells. Hum Reprod 1998; 13:2598–2601.[Abstract/Free Full Text]
  3. Nasu K, Matsui N, Narahara H, Tanaka Y, Takai N, Miyakawa I, Higuchi Y. MaMi, a human endometrial stromal sarcoma cell line that constitutively produces interleukin (IL)-6, IL-8, and monocyte chemoattractant protein-1. Arch Pathol Lab Med 1998; 122:836–841.[Medline]
  4. Arici A, Head JR, MacDonald PC, Casey ML. Regulation of interleukin-8 gene expression in human endometrial cells in culture. Mol Cell Endocrinol 1993; 94:195–204.[CrossRef][Medline]
  5. Dudley DJ, Trautman MS, Mitchell MD. Inflammatory mediators regulate interleukin-8 production by cultured gestational tissues: evidence for a cytokine network at the chorio-decidual interface. J Clin Endocrinol Metab 1993; 76:404–410.[Abstract]
  6. Hatayama H, Kanzaki H, Iwai M, Kariya M, Fujimoto M, Higuchi T, Kojima K, Nakayama H, Mori T, Fujita J. Progesterone enhances macrophage colony-stimulating factor production in human endometrial stromal cells in vitro. Endocrinology 1994; 135:1921–1927.[Abstract]
  7. Smith SK. Growth factors in the human endometrium. Hum Reprod Update 1994; 9:936–946.
  8. Tabibzadeh S. Cytokines and the hypothalamic-pituitary-ovarian-endometrial axis. Hum Reprod Update 1994; 9:947–967.
  9. Gohda E, Tsubouchi H, Nakayama H, Hirono S, Sakiyama O, Takahashi K, Miyazaki H, Hashimoto S, Daikuhara Y. Purification and partial characterization of hepatocyte growth factor from the plasma of patients with hepatic failure. J Clin Invest 1988; 81:414–419.
  10. Stoker M, Gherardi E, Perryman M, Gray J. Scatter factor is a fibroblast derived modulator of epithelial cell mobility. Nature 1987; 327:239–242.[CrossRef][Medline]
  11. Strain AJ, Ismail T, Arakaki N, Hishida T, Kitamura Y, Daikuhara Y, McMaster P. Native and recombinant human hepatocyte growth factors are highly potent promoters of DNA synthesis in both human and rat hepatocytes. J Clin Invest 1991; 87:1853–1857.
  12. Bussolino F, Di Renzo MF, Ziche M, Bocchietto E, Olivero M, Naldini L, Guadino G, Tamagnone L, Coffer A, Comoglio PM. Hepatocyte growth factor is a potent angiogenic factor which stimulates endothelial cell motility and growth. J Cell Biol 1992; 119:629–641.[Abstract/Free Full Text]
  13. Rosen EM, Meromsky L, Setter E, Vinter DW, Goldberg ID. Smooth muscle-derived factor stimulates mobility of human tumor cells. Invasion Metastasis 1990; 10:49–64.[Medline]
  14. Hernandez J, Zarnegar R, Michalopoulos GK. Characterization of the effects of human placental HGF on rat hepatocytes. J Cell Physiol 1992; 150:116–121.[CrossRef][Medline]
  15. Kurauchi O, Itakura A, Ando H, Kuno N, Mizutani S, Tomoda Y. The concentration of hepatocyte growth factor (HGF) in human amniotic fluid at second trimester: relation to fetal birth weight. Horm Metab Res 1995; 27:335–338.[Medline]
  16. Okamura M, Kurauchi O, Itakura A, Morikawa S, Suganuma N, Mizutani S, Tomoda Y. Hepatocyte growth factor in human amniotic fluid promotes the migration of fetal small intestinal epithelial cells. Am J Obstet Gynecol 1998; 178:175–179.[CrossRef][Medline]
  17. Cooper CS, Park M, Blair DG, Tainsky MA, Huebner K, Croce CM, Vande Wounde GF. Molecular cloning of a new transforming gene from a chemically transformed human cell line. Nature 1984; 311:29–33.[CrossRef][Medline]
  18. Bottaro DP, Rubin JS, Faletto DL, Chan AML, Kmiecik TE, Vande Woude GF, Aaronson SA. Identification of the hepatocyte growth factor receptor as the c-MET proto-oncogene product. Science 1991; 251:802–804.[Abstract/Free Full Text]
  19. Weidner KM, Sachs M, Birchmeier W. The MET receptor tyrosine kinase transduces motility, proliferation, and morphogenic signals of scatter factor/hepatocyte growth factor in epithelial cells. J Cell Biol 1993; 121:145–154.[Abstract/Free Full Text]
  20. Miyazawa K, Kitamura A, Kitamura N. Structural organization and the transcription initiation site of the human hepatocyte growth factor gene. Biochemistry 1991; 30:9170–9176.[CrossRef][Medline]
  21. Plaschke-Schlütter A, Behrens J, Gherardi E, Birchmeier W. Characterization of the scatter factor/hepatocyte growth factor gene promoter. Positive and negative regulatory elements direct gene expression to mesenchymal cells. J Biol Chem 1995; 270:830–836.[Abstract/Free Full Text]
  22. Matsumoto K, Okazaki H, Nakamura T. Up-regulation of hepatocyte growth factor gene expression by interleukin-1 in human skin fibroblasts. Biochem Biophys Res Commun 1992; 188:235–243.[CrossRef][Medline]
  23. Matsunaga T, Gohda E, Takebe T, Wu YL, Iwao M, Kataoka H, Yamamoto I. Expression of hepatocyte growth factor is up-regulated through activation of a cAMP-mediated pathway. Exp Cell Res 1994; 210:326–335.[CrossRef][Medline]
  24. Tamura M, Arakaki N, Tsubouchi H, Takada H, Daikuhara Y. Enhancement of human hepatocyte growth factor production by interleukin-1{alpha} and-1ß and tumor necrosis factor-{alpha} by fibroblasts in culture. J Biol Chem 1993; 268:8140–8145.[Abstract/Free Full Text]
  25. Nishino T, Kaise N, Sindo Y, Nishino N, Nishida T, Yasuda S, Masui Y. Promyelocytic leukemia cell line, HL-60, produces human hepatocyte growth factor. Biochem Biophys Res Commun 1991; 181:323–330.[CrossRef][Medline]
  26. Sugawara J, Fukaya T, Murakami T, Yoshida H, Yajima A. Increased secretion of hepatocyte growth factor by eutopic endometrial stromal cells in women with endometriosis. Fertil Steril 1997; 68:468–472.[CrossRef][Medline]
  27. Negami AI, Sasaki H, Kawakami Y, Kamitani N, Kotsuji F, Tominaga T, Nakamura T. Serum human hepatocyte growth factor in human menstrual cycle and pregnancy: a novel serum marker of regeneration and reconstruction of human endometrium. Horm Res 1995; 44(suppl 2):42–46.
  28. Sugawara J, Fukaya T, Murakami T, Yoshida H, Yajima A. Hepatocyte growth factor stimulates proliferation, migration, and lumen formation of human endometrial epithelial cells in vitro. Biol Reprod 1997; 57:936–942.[Abstract]
  29. Nasu K, Narahara H, Etoh Y, Kawano Y, Hirota Y, Miyakawa I. Serum levels of soluble intercellular adhesion molecule-1 (ICAM-1) and the expression of ICAM-1 mRNA in uterine cervical cancer. Gynecol Oncol 1997; 65:304–308.[CrossRef][Medline]
  30. Kauma S, Hayes N, Weatherford S. The differential expression of hepatocyte growth factor and MET in human placenta. J Clin Endocrinol Metab 1997; 82:949–954.[Abstract/Free Full Text]
  31. Miyazawa K, Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiyama O, Takahashi K, Gohda E, Daikuhara Y, Kitamura N. Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. Biochem Biophys Res Commun 1989; 163:967–973.[CrossRef][Medline]
  32. Nakamura T, Nishizawa T, Hagiya M, Seki T, Shimonishi M, Sugimura A, Tashiro K, Shimizu S. Molecular cloning and expression of human hepatocyte growth factor. Nature 1989; 342:440–443.[CrossRef][Medline]
  33. Tsuji S, Kawano S, Tsujii M, Fusamoto H, Kamada T. Roles of hepatocyte growth factor and its receptor in gastric mucosa. A cell biological and molecular biological study. Dig Dis Sci 1995; 40:1132–1139.[CrossRef][Medline]
  34. Morimoto AK, Okamura K, Hamanaka T, Sato Y, Shima N, Higashio K, Kuwano M. Hepatocyte growth factor modulates migration and proliferation of human microvascular endothelial cells in culture. Biochem Biophys Res Commun 1991; 179:1042–1049.[CrossRef][Medline]
  35. Grant DS, Kleinman HK, Goldberg ID, Bhargava MM, Nickoloff BJ, Kinsella JL, Polverini P. Scatter factor induces blood vessel formation in vivo. Proc Natl Acad Sci USA 1993; 90:1937–1941.[Abstract/Free Full Text]
  36. Naidu YM, Rosen EM, Zitnik R, Goldberg I, Park M, Naujokas M, Polverini PJ, Nickoloff BJ. Role of scatter factor in the pathogenesis of AIDS-related Kaposi's sarcoma. Proc Natl Acad Sci USA 1994; 91:5282–5285.
  37. Liu Y, Lin L, Zarnegar R. Modulation of hepatocyte growth factor gene expression by estrogen in mouse ovary. Mol Cell Endocrinol 1994; 104:173–181.[CrossRef][Medline]
  38. Gohda E, Matsunaga T, Kataoka H, Takabe T, Yamamoto I. Induction of hepatocyte growth factor in human skin fibroblasts by epidermal growth factor, platelet-derived growth factor and fibroblast growth factor. Cytokine 1994; 6:633–640.[CrossRef][Medline]
  39. Matsumoto K, Tajima H, Okazaki H, Nakamura T. Negative regulation of hepatocyte growth factor gene expression in human lung fibroblasts and leukemic cells by transforming growth factor-ß1 and glucocorticoids. J Biol Chem 1992; 267:24917–24920.[Abstract/Free Full Text]
  40. Gohda E, Matsunaga T, Kataoka H, Yamamoto I. TGF-ß is a potent inhibitor of hepatocyte growth factor secretion by human fibroblasts. Cell Biol Int Rep 1992; 16:917–926.[Medline]
  41. Nishizuka Y. Protein kinase C and lipid signaling for sustained cellular responses. FASEB J 1995; 9:484–496.[Abstract]
  42. Akimoto K, Takahashi R, Moriya S, Nishioka N, Takayanagi J, Kimura K, Fukui Y, Osada S, Mizuno K, Hirai S, Kazlauskas A, Ohno S. EGF or PDGF receptors activate atypical PKC{lambda} through phosphatidylinositol 3-kinase. EMBO J 1996; 15:788–798.[Medline]



This article has been cited by other articles:


Home page
 Biol. Reprod.Home page
K. S. Grant-Tschudy and C. R. Wira
Hepatocyte Growth Factor Regulation of Uterine Epithelial Cell Transepithelial Resistance and Tumor Necrosis Factor {alpha} Release in Culture
Biol Reprod, April 1, 2005; 72(4): 814 - 821.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
S. Yoshida, T. Harada, T. Iwabe, F. Taniguchi, A. Fujii, Y. Sakamoto, N. Yamauchi, G. Shiota, and N. Terakawa
Induction of Hepatocyte Growth Factor in Stromal Cells by Tumor-Derived Basic Fibroblast Growth Factor Enhances Growth and Invasion of Endometrial Cancer
J. Clin. Endocrinol. Metab., May 1, 2002; 87(5): 2376 - 2383.
[Abstract] [Full Text] [PDF]

Home page
 Mol Hum ReprodHome page
K. Kai, K. Nasu, S. Nakamura, J. Fukuda, M. Nishida, and I. Miyakawa
Expression of interferon-{gamma}-inducible protein-10 in human endometrial stromal cells
Mol. Hum. Reprod., February 1, 2002; 8(2): 176 - 180.
[Abstract] [Full Text] [PDF]

Home page
 NEJMHome page
E. R. Norwitz, D. J. Schust, and S. J. Fisher
Implantation and the Survival of Early Pregnancy
N. Engl. J. Med., November 8, 2001; 345(19): 1400 - 1408.
[Full Text] [PDF]

Home page
 Mol Hum ReprodHome page
K. Nasu, K. Fujisawa, K. Arima, K. Kai, T. Sugano, and I. Miyakawa
Expression and regulation of growth-regulated oncogene {alpha} in human endometrial stromal cells
Mol. Hum. Reprod., August 1, 2001; 7(8): 741 - 746.
[Abstract] [Full Text] [PDF]

Home page
 Mol Hum ReprodHome page
K. Nasu, T. Sugano, K. Fujisawa, K. Arima, H. Narahara, and I. Miyakawa
Effects of interleukin-4 on the in-vitro production of cytokines by human endometrial stromal cells
Mol. Hum. Reprod., March 1, 2001; 7(3): 265 - 270.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nasu, K.
Right arrow Articles by Miyakawa, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nasu, K.
Right arrow Articles by Miyakawa, I.
Agricola
Right arrow Articles by Nasu, K.
Right arrow Articles by Miyakawa, I.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS