Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reznikov, L. L.
Right arrow Articles by Dinarello, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reznikov, L. L.
Right arrow Articles by Dinarello, C. A.
Agricola
Right arrow Articles by Reznikov, L. L.
Right arrow Articles by Dinarello, C. A.
Biology of Reproduction 60, 1231-1238 (1999)
©Copyright 1999 Society for the Study of Reproduction, Inc.

Utilization of Endoscopic Inoculation in a Mouse Model of Intrauterine Infection-Induced Preterm Birth: Role of Interleukin 1ß1

Leonid L. Reznikov2,a, Giamila Fantuzzia, Craig H. Selzmanb, Brian D. Shamesb, Hazel A. Bartonb, Hobart Bellc, James A. McGregord, and Charles A. Dinarelloa

a Division of Infectious Diseases and b Department of Surgery, University of Colorado Health Sciences Center, Denver, Colorado 80262 c Embryology Associates, Inc., Boulder, Colorado 80303 d Department of Obstetrics and Gynecology, Denver General Hospital, Denver, Colorado 80204


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A novel murine model of intrauterine infection/inflammation-induced preterm birth based on direct endoscopic intracervical inoculation is described. Using this model, we investigated infection-induced premature pregnancy loss in normal and interleukin (IL) 1ß-deficient mice. Seventy-four CD-1, HS, C57BL/6J wild type (IL-1ß+/+), and C57BL/6J IL-1ß-deficient (IL-1ß-/-) mice were inoculated intracervically using a micro-endoscope, at a time corresponding to 70% of average gestation. Intracervical injection of lipopolysaccharide (LPS) or Escherichia coli reliably induced premature birth: 100% of mice intracervically injected with LPS and 92% of mice with a positive endometrial E. coli culture delivered prematurely within 36 h after inoculation. No losses were observed in mice inoculated with saline. Pregnancy loss was associated with increased uterine tissue cyclooxygenase-2 gene expression and uterine content of IL-1ß, tumor necrosis factor {alpha}, macrophage inflammatory protein-1{alpha}, and IL-6, as well as elevation of nuclear factor-{kappa}B activity in uterine tissues. Although IL-1ß-/- mice exhibited decreased uterine cytokine production in response to bacteria and LPS, IL-1ß deficiency did not affect the rate of pregnancy loss. This model using direct intracervical bacterial or LPS inoculation is useful for studying preterm pregnancy loss in genetically altered mice in order to develop novel interventions for infection-associated preterm labor.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Increasing evidence suggests that interleukin (IL) 1 plays an important role in cytokine network functioning in pregnancy [1–4]. Cytokines are involved in implantation, decidualization, steroid secretion, and embryo development, and play roles in the physiology of both normal and abnormal parturition. In normal pregnancy, IL-1 levels increase in both amniotic fluid and gestational tissues towards parturition and are significantly elevated during labor [5–7]. Furthermore, administration of IL-1{alpha} or IL-1ß induces preterm delivery in mice, rabbits, and monkeys [8–10]; blocking of IL-1 activity using the IL-1 receptor antagonist (IL-1Ra) reduces stress-triggered or IL-1{alpha}-induced abortion in mice [11, 12].

Untimely elevation of proinflammatory cytokines including IL-1 in the feto-maternal environment may be an important step in the pathogenesis of preterm pregnancy loss or labor associated with intra-amniotic infection. Numerous animal studies and clinical reports demonstrate elevation of IL-1ß and IL-1{alpha} as well as IL-1Ra in the amniotic fluid or gestational tissues from cases of intra-amniotic infection or after exposure to bacterial products [13–20]. However, other investigators show that administration of IL-1Ra has no effect on endotoxin-induced preterm parturition in mice [20] and that treatment of isolated murine myometrial tissue with IL-1ß does not acutely increase contractile activity [21]. These observations prompt the question whether the increase in IL-1 production precedes, or is simply a consequence of, parturition [22].

The role of IL-1 in preterm pregnancy loss associated with infection remains untested in mice that have been generated deficient in IL-1ß, IL-1{alpha}, IL-1 receptor type I, IL-1ß-converting enzyme (ICE), or IL-1Ra. Experimentation with uterine tissue explants in vitro [16, 23] has certain limitations. Further, isolated gestational tissue cultured in vitro may not accurately reflect its role in vivo [24]; in fact, cultured cells are likely to develop phenotypic changes relevant to in vitro stress [25].

A more complete study of the pathophysiology of infection-associated preterm birth requires a well-characterized animal model. Established rabbit [26] and monkey [17] models are technically difficult and expensive, whereas a murine model is more accessible and would have the advantage of offering a variety of genetically defined mice.

We report a novel murine model of intrauterine infection and premature pregnancy loss using an endoscopically performed transcervical intrauterine inoculation. Using this model, we studied whether IL-1ß deficiency affects rates of infection-induced premature pregnancy loss.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Bacterial Culture and Other Materials

E. coli (ATCC 12014) were kindly provided by the Colorado University Hospital Microbiology Laboratory, cultured, and diluted as previously described by Hirsch et al. [27]. Briefly, E. coli were grown in Luria broth medium (Life Technologies, Gaithersburg, MD) overnight at 37°C, and diluted to 105 colony-forming units (cfu)/ml for injection. The bacterial suspension was drawn into a 1.0-ml syringe with a 23-gauge needle (Becton Dickinson, Franklin Lakes, NJ) just before intrauterine inoculation. After injection, the remaining bacterial suspension was plated to confirm bacterial density. Lyophilized lipopolysaccharide (LPS) (a phenol-extracted preparation from E. coli 055:B5) was purchased from Sigma Chemical Co. (St. Louis, MO), dissolved in saline to a concentration of 1 mg/ml, aliquoted, and stored at -20°C.

Animals

CD-1-timed pregnant females were purchased from Harlan Sprague Dawley, Inc. (Indianapolis, IN); HS-timed pregnant females were kindly provided by Embryology Associates, Inc. (Boulder, CO). IL-1ß-deficient (IL-1ß-/-) and wild-type (IL-1ß+/+) mice of mixed C57BL/6 and 129Sv(ev) background were obtained from Dr. H. Zheng (Merck Inc., Rahway, NJ) [28] and bred in the University of Colorado Health Sciences Center (UCHSC) animal facility. Copulation (using one male per three females) was verified by the presence of a vaginal plug. All mice were allowed free access to food and water, and exposed to 12L:12D cycles before and after experimentation was initiated.

Intracervical Inoculation

Protocols were approved by the Animal Use and Care Committee of the UCHSC. On Day 14 or 15 of pregnancy (approximately 70% gestation, corresponding in humans to 28 wk), mice (CD-1, HS, and both C57BL/6 IL-1ß+/+ and IL-1ß-/-) were subjected to inhalation anesthesia with Metofane (Methoxyflurane; Mallinckrodt Veterinary, Inc., Mundelein, IL) using an inhalation chamber and subsequent nasal anesthetic cone. Mice were placed in a dorsal supine position and restrained with paper tape, and the perineal area was washed with 70% isopropanol. The endoscope (arthroscope; angle, 0°; diameter, 1.7 mm; length, 90 mm; Comeg Endoscopy, Inc., Aurora, CO) was inserted approximately 6–8 mm into the vagina until the cervix was visualized. A needle, attached to the syringe and bent to an angle of 30°, was guided through the vagina and visually advanced 3 mm into the cervix (Fig. 1). One hundred microliters of saline containing Escherichia coli (104 cfu), LPS (5 or 7.5 mg/kg), or sterile saline (vehicle), was injected intracervically, and the needle with the endoscope was removed. Saline used in the present studies contained a concentration of endotoxin of less than detectable by the Limulus assay (< 10 pg/ml).



View larger version (100K):
[in this window]
[in a new window]
  		FIG. 1. Schematic drawing of the endoscope with needle inserted into the vagina. The endoscope approaches the cervix, and the needle is visually introduced into the cervix for the injection. The syringe attached to the needle is not shown.

After inoculation, animals were placed in individual microisolators and observed at least every 6 h for visual signs of delivery. Pregnancy loss was considered to occur if deposited fetuses were observed. Animals were killed by cervical dislocation at the time when pregnancy loss had occurred or 48 h after intracervical injection. Four out of 14 mice injected with saline were killed 24 h after intracervical injection to serve as an appropriate control for those mice that lost pregnancy within the 24-h period. Peritoneal and endometrial swabs were inoculated onto MacConkey's agar to confirm the presence of an E. coli infection. The number of remaining fetuses in the case of incomplete delivery was noted. Uterine tissue (myometrium and decidua) was separated from placenta, weighed, frozen in liquid nitrogen, and stored at -70°C before use as described below.

Reverse Transcription (RT) Polymerase Chain Reaction (PCR)

Semiquantitative RT-PCR was used to assess IL-1ß and cyclooxygenase-2 (COX-2) gene expression in the uteri of mice treated with LPS or saline. Briefly, total RNA was extracted from uterine tissue by homogenization in Tri-Reagent (MRC, Inc., Cincinnati, OH) with Tissue Tearor 985–370 (Biospec Products, Inc., Racine, WI) at 30 000 rpm. RNA was isolated by precipitation with chloroform and isopropanol. Thereafter, 2 µg of isolated RNA was subjected to RT-PCR with AMV reverse transcriptase and random hexaoligonucleotides as primers (Perkin Elmer, Norwalk, CT). RT-PCR was carried out at 42°C for 30 min followed by enzyme inactivation at 99°C for 5 min. PCR SuperMix containing Taq DNA Polymerase (Life Technologies) was used to amplify the cDNA obtained from RT-PCR. Previously described [29–31] primers for detection of IL-1ß (sense CTCCATGAGCTTTGTACAAAGG; antisense TGCTGATGTACCAGTTGGGG; 253-base pair (bp) product), COX-2 (sense ACACTCTATCACTGGCATCC; antisense GAAGGGACACCCTTTCACAT; 584-bp product), and glyceraldehyde phosphodehydrogenase (GAPDH) gene expression (sense ACCACAGTCCATGCCATCAC; antisense TCCACCACCCTGTTGCTGGTA; 475-bp product) were used all with annealing temperature at 55°C. The reaction was monitored to ensure that DNA amplification was maintained in the exponential range.

The amplified products were separated in a 1.5% agarose (Sigma) gel containing 0.5-strength Tris-borate-EDTA (TBE), pH 8.3 (Fisher Scientific, Fair Lawn, NJ). PCR amplification products were quantified using a Bio-Rad Image Analysis System (Bio-Rad Laboratories, Hercules, CA) and Multi-Analyst/PC software. The data are presented as the ratio of densitometric units of the bands corresponding to IL-1ß or COX-2 over the densitometric units of the bands corresponding to GAPDH for each tested condition.

Cytokine Assays

Tissue extracts were obtained by the modified method of Nishiyama et al. [32]. Tissue samples were homogenized using Tissue Tearor model 985–370 at 30 000 rpm in 10 volumes of 0.1% Tween 20 in 0.01 M PBS (pH 7.4) for 1 min on ice. After centrifugation at 13 000 x g for 15 min at 4°C, supernatants were assayed for cytokine determinations.

IL-1ß, IL-1{alpha}, and IL-6 levels were measured using ELISA kits specific for murine cytokines (Endogen, Inc., Woburn, MA). The concentration of tumor necrosis factor {alpha} (TNF{alpha}) and macrophage inflammatory protein-1{alpha} (MIP-1{alpha}) in tissue extracts were measured by the electrochemoluminescence (ECL) method, as previously described [33]. The limit of detection of the assays was 5 pg/ml for IL-1ß and IL-1{alpha}, 10 pg/ml for MIP-1{alpha}, and 30 pg/ml for IL-6 and TNF{alpha}.

Detection of Active Nuclear Factor-{kappa}B (NF-{kappa}B) by Electrophoretic Mobility Shift Assay (EMSA)

Tissues (approximately 100 mg) were thawed and washed with ice-cold PBS before homogenization in 500 µl lysis buffer containing 10 mM HEPES (pH 7.9), 10 mM KCl, 1 mM EGTA, 1 mM dithiothreitol (DTT), and a commercial preparation of a mixture of PMSF, aprotinin, leupeptin, and EDTA, which was purchased and used according to the manufacturer's instructions (Complete Protease-Inhibitor-Cocktail; Boehringer Mannheim GmbH, Indianapolis, IN). The concentration of each protease inhibitor is adjusted by the manufacturer so that pronase, thermolysin, chymotrypsin, trypsin, and papain are inhibited between 88 and 99%. However, the concentration of each inhibitor is proprietary. Nuclear proteins were then extracted as previously described [34]. Briefly, homogenized tissue was incubated for 15 min on ice, and NP-40 (Sigma) was added to a final concentration of 0.5% followed by vortexing for 10 sec. Samples were centrifuged at 8000 x g for 15 min at 4°C, and the nuclear pellet was resuspended in 50 ml of nuclear extraction buffer (20 mM HEPES [pH 7.9], 0.4 M NaCl, 1 mM EGTA, 1 mM DTT, and a Complete Protease-Inhibitor-Cocktail used according to the manufacturer's instructions) and incubated on ice for 30 min with gentle vortexing every 10 min. The nuclear extract was then clarified by centrifugation at 12 000 x g for 5 min at 4°C. The supernatant containing the nuclear proteins was quantified with the Coomassie Plus protein assay (Pierce, Rockford, IL).

NF-{kappa}B consensus oligonucleotide (AGTTGAGCCCAGGC, binding site underlined; Promega, Madison, WI) was 5' end-labeled with ;ob{gamma}-32P;cbATP (NEN, Boston, MA) using T4 polynucleotide kinase. Unincorporated nucleotide was removed using a NucTrap Probe purification column (Stratagene, La Jolla, CA). Two micrograms of nuclear protein was incubated with labeled oligonucleotide (200 000 dpm/µl) in binding buffer (10 mM Tris-HCl [pH 7.5], 50 mM NaCl, 0.5 mM EDTA, 1 mM MgCl2, 0.5 mg poly [dI-dC], 1% NP-40, and 4% glycerol) for 25 min at room temperature in a final volume of 25 µl. Subsequently, the products were separated by electrophoresis on a 4% polyacrylamide/0.5-strength TBE gel. The gel was then dried onto Whatman paper and exposed to an x-ray film overnight at -70°C with an intensifying screen.

Statistical Analysis

Cytokine concentrations are presented as mean (± SEM) in pg/100 mg of tissue. The Mann Whitney-U test was used to analyze differences between experimental groups. Values were considered to be significantly different from control group when p < 0.05. Categoric data were analyzed with Fisher's exact test or chi-square test with {alpha} set at 0.05.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Pregnancy Loss and Bacterial Cultures

Fifty-four out of 60 mice (90%) injected intracervically with either E. coli (11 of 17; 64.7%) or LPS (43 of 43; 100%) experienced premature loss of pregnancy within 36 h from the time of inoculation (Fig. 2). Conversely, none of the 14 mice injected with vehicle (saline) developed signs of pregnancy loss. In addition, no difference (p = 0.8) in occurrence of pregnancy loss in response to live bacterial or LPS injection was found between the different strains of mice (Table 1). Unexpectedly, IL-1ß+/+ and IL-1ß-/- mice exhibited similar rates of pregnancy loss following intrauterine E. coli or LPS (Table 1).



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 2. Mice maintaining pregnancy after intracervical injection of saline, E. coli, or LPS. The percentages of A) IL-1ß+/+ and B) IL-1ß-/- mice without fetal loss for each treatment group are shown over a 48-h time course (horizontal axis). See Table 1 for the total numbers in each group.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Effect of intracervical injection of E. coli, LPS, or saline on murine pregnancy loss.

Intracervical injection of LPS resulted in abortion in all (43 of 43) CD-1, HS, and C57BL/6 IL-1ß+/+ or IL-1ß-/- mice. The majority of animals (82.2%) injected with 5 mg/kg of LPS aborted within 24 h, and the remaining animals treated with LPS aborted within the next 6 h. An increased dose of LPS (7.5 mg/kg) resulted in earlier delivery: 100% of mice delivered by 24 h, with 80% delivering by 12 h after the injection of LPS (Fig. 2).

Sixty-five percent (11 of 17) of mice inoculated with E. coli experienced pregnancy loss. Seventy-one percent of mice inoculated with E. coli had a positive endometrial culture at the time of delivery (Table 2). Of these mice with a positive endometrial culture, 91.7% (11 of 12) experienced pregnancy loss. In mice not delivering within 48 h after bacterial inoculation, a positive culture was detected in only 16.7% (1 of 6; p < 0.05).


View this table:
[in this window]
[in a new window]
  		TABLE 2. Endometrial and peritoneal bacterial culture results from animals at the time of abortion or at 48 h after intracervical E. coli injection.

None of the mice with positive E. coli endometrial cultures had positive peritoneal cultures (Table 2). In mice injected with saline or LPS, no positive peritoneal or endometrial cultures were found.

Cytokine and COX-2 Gene Expression

Semiquantitative RT-PCR was performed with RNA isolated from the uteri of C57BL/6 IL-1ß+/+ and IL-1ß-/- mice at the time of abortion. As shown in Figure 3, an increase to over 2-fold in IL-1ß gene expression was observed in the uteri of IL-1ß+/+ mice that experienced pregnancy loss compared to pregnant mice intracervically injected with saline. As expected, IL-1ß mRNA was not detected in IL-1ß-/- mice regardless of the experimental conditions. Steady-state mRNA for COX-2 was detected in the unchallenged pregnant uterus in both IL-1ß+/+ and IL-1ß-/- mice, whereas pregnancy loss was associated with a 3-fold increase in COX-2 gene expression (Fig. 4).



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 3. Steady-state levels of gene expression for IL-1ß in uterine tissue from pregnant mice. Semi-quantitative RT-PCR from RNA isolated from the uteri of IL-1ß+/+ and IL-1ß-/- mice 24 h after either saline or LPS injection (5 mg/kg). The vertical axis indicates the ratio of densitometric readings between IL-1ß and GAPDH for the same samples. The inset depicts the bands of IL-1ß and GAPDH from which the densitometric readings were made. In RNA samples from IL-1ß-/- mice, bands corresponding to IL-1ß were not detected (N.D.). Data represent one of three similar experiments. In this experiment, a single animal was used for each treatment.



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 4. Steady-state levels of gene expression for COX-2 in uterine tissue from pregnant mice. Semi-quantitative RT-PCR from the uteri of IL-1ß+/+ and IL-1ß-/- mice 24 h after either saline or LPS (5 mg/kg). The vertical axis indicates the ratio of densitometric readings between COX-2 and GAPDH. The inset depicts the bands of COX-2 and GAPDH from which the densitometric readings were made. Data represent one of three similar experiments. In this experiment, a single animal was used for each treatment.

Cytokine Levels

As anticipated, there was no detectable IL-1ß in the uterus of IL-1ß-/- mice injected with saline or induced to premature delivery. However, the concentration of IL-1ß in the uterus obtained from IL-1ß+/+ mice 24 h after LPS injection increased to 16-fold compared with that in animals injected with saline (Fig. 5A). High variability was observed in this experiment, but the least increase of IL-1ß after LPS administration was 5-fold. A similar elevation of uterine cytokine levels compared with those in mice receiving saline was detected for TNF{alpha}, MIP-1{alpha}, and IL-6 (Fig. 5, B–D). Importantly, in IL-1ß-/- mice, the elevations of TNF{alpha}, MIP-1{alpha}, and IL-6 were less than those observed in IL-1ß+/+ mice; however, this difference was not statistically significant.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 5. Cytokine concentrations in uterine tissue. Uterine tissues were obtained 24 h after LPS (5 mg/kg) or saline injection. After homogenization, clarified extracts were assayed for A) IL-1ß, B) TNF{alpha}, C) MIP-1{alpha}, and D) IL-6. Data represent the mean ± SEM; n = 3 for saline-injected IL-1ß-deficient and IL-1ß+/+ mice; n = 3 for LPS-injected IL-1ß+/+ mice; n = 5 for LPS-injected IL-1ß-deficient mice.

Compared with that of IL-1ß-/- mice, the uterine content of IL-1{alpha} was higher in IL-1ß+/+ mice given either saline or LPS (Fig. 6). As opposed to reported increases in amniotic fluid IL-1{alpha} in preterm labor in humans, rabbits, and mice [13–15], the uterine content of IL-1{alpha} in this study was decreased in both IL-1ß+/+ and IL-1ß-/- mice given LPS compared with saline.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 6. The content of IL-1{alpha} in uterine tissue. Uterine tissues were obtained 24 h after LPS (5 mg/kg) or saline injection. After homogenization, clarified extracts were assayed for IL-1{alpha}. Data represent the mean ± SEM; n = 3 for saline-injected IL-1ß-deficient and IL-1ß+/+ mice; n = 3 for LPS-injected IL-1ß+/+ mice; n = 5 for LPS-injected IL-1ß-deficient mice.

NF-{kappa}B EMSA in Extracts from Uterine Tissues

Uterine tissue from C57BL/6 IL-1ß+/+ and IL-1ß-/- mice were obtained 24 h after either saline or LPS injection (5 mg/kg). Nuclear extracts were reacted with labeled NF-{kappa}B probe, and the mixtures were separated by polyacrylamide electrophoresis. As shown in Figure 7, compared with saline, LPS resulted in NF-{kappa}B activation within the nucleus. There was, however, no strong difference in the response to LPS between the IL-1ß+/+ and IL-1ß-/- mice.



View larger version (75K):
[in this window]
[in a new window]
  		FIG. 7. EMSA detection of active NF-{kappa}B. PAGE of nuclear extracts after binding to labeled NF-{kappa}B probe. Nuclear extracts were made 24 h after either LPS (5 mg/kg) or saline injection. The density of the upper band reflects the nuclear NF-{kappa}B activity in uteri obtained from a saline-treated IL-1ß+/+ mouse (lane 1), a saline-treated IL-1ß-/- mouse (lane 2), an LPS-treated IL-1ß+/+ mouse (lane 3), and an LPS-treated IL-1ß-/- mouse (lane 4). Lane 5 represents labeled probe plus excess cold probe, plus tissue. Data represent one of three similar experiments.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
We have developed a reliable model of infection/inflammation-induced pregnancy loss that allows us to take advantage of the availability of genetically defined cytokine-knockout mice to study the role of cytokine networks in the pathogenesis of infection-induced premature birth. The absence of bacterial infection in the peritonea of animals with a positive endometrial culture demonstrates that, in contrast to extrauterine bacterial inoculation, this method allows researchers to establish a local endometrial pathogenic site. Intracervical inoculation of E. coli or LPS reliably resulted in pregnancy losses that were associated with elevation of pro-inflammatory cytokines, COX-2 gene expression, and NF-{kappa}B activation. Absence of IL-1ß was associated with reduced cytokine production but did not reduce rates of pregnancy loss.

Improving reported animal models based on extrauterine inoculation, Hirsch and colleagues [27] previously described a model of intrauterine infection and preterm delivery in which CD-1 mice were inoculated with live E. coli directly into the uterus by way of laparotomy. Intraperitoneal bacterial inoculation in their study [27] did not result in preterm delivery. We also failed to induce preterm pregnancy loss using intraperitoneal injection of E. coli in HS mice [35]. These findings suggest that cases of extrauterine infection or inflammation, which are also important in induction of preterm parturition in both humans and animal models, probably involve pathways that differ from those of intrauterine infection and inflammation. Similarly, in other murine models utilizing systemic administration of bacterial products such as intraperitoneal injection [15, 16, 19, 36] or i.v. injection [37], pregnancy loss is not necessarily due to the local (uterine) stimuli [27].

An important benefit of the present endoscopic model is that there are no requirements for laparotomy or other surgical intervention in order to access the pregnant uterus. This results in minimal trauma and decreases the rate of abortion in mice given the vehicle (0% vs. 7.1% [27]). This model also exhibits several of the inflammatory processes that are thought to play roles in the pathogenesis of infection-mediated preterm pregnancy loss in humans [4, 38,39].

Previously reported studies and the present findings suggest that microorganisms, or their products, may enter the feto-maternal compartment and recruit decidual macrophages that produce inflammatory cytokines, most notably IL-1ß [4]. IL-1ß-mediated signaling results in activation of NF-{kappa}B and production of a variety of cytokines, growth factors, adhesion molecules, cytokine receptors, and acute-phase proteins [40]. Specifically, NF-{kappa}B enhances transcription and production of TNF{alpha}, IL-1, IL-6, IL-8, MIP-1{alpha}, and other cytokines, important in the generation of acute inflammation. Increased production and release of TNF{alpha} and IL-1ß in turn further activate NF-{kappa}B [40, 41]. This positive autoregulatory loop may contribute to the excessive cytokine-mediated inflammation thought to play a critical role in the pathogenesis of preterm pregnancy loss [4, 42]. Furthermore, NF-{kappa}B regulates COX-2 gene transcription, which is essential for prostaglandin production [43, 44].

An unexpected finding in this study was a failure to detect differences in rates of pregnancy loss or COX-2 gene expression following intrauterine LPS injection in IL-1ß-/- mice. IL-1 is involved in inducing COX-2 gene expression and prostaglandin synthesis in a variety of cultured cells and gestational tissue explants [45, 46]. In our experiments, IL-1ß-/- mice did not exhibit a reduced susceptibility to the intracervical inoculation of bacteria or LPS. Failure to demonstrate differences in the IL-1ß-/- mice may be due to the overwhelmingly large doses of E. coli or LPS that were employed in order to induce a high rate of pregnancy loss. We speculate that reducing the challenge doses would reveal a difference between IL-1ß+/+ and IL-1ß-/- mice, but also reduce the rate of pregnancy loss.

The role of IL-1ß in the cytokine-related components of pregnancy maintenance and/or parturition requires continued investigation. Previously described elevation of IL-1ß and other cytokines in both term and preterm labor [5, 6, 47–49] does not determine whether this increased cytokine production is a cause or is a consequence of parturition [7, 22]. Implantation, pregnancy, and parturition appear to be unaffected in mice deficient in IL-1ß, IL-1{alpha}, or ICE [28, 50, 51]. A null mutation in IL-1 receptor type I is associated with only a smaller litter size than in wild-type controls [51]. However, mice homozygous for a deficiency in the secreted form of IL-1Ra do not become pregnant [52].

In this study, we observed reductions in TNF{alpha}, MIP-1{alpha}, and IL-6 levels in IL-1ß-/- compared to IL-1ß+/+ mice. Reported differences lack statistical significance because of the small number of mice evaluated and the high variation of cytokine levels in individual animals. At the same time, we observed trends suggesting that the role of IL-1ß in the development of inflammation-associated preterm pregnancy loss remains unclear.

Interestingly, IL-1ß-/- mice are relatively deficient in the production of IL-1{alpha}. As shown in Figure 6, there is an over two-thirds reduction in content of uterine IL-1{alpha} in either saline- or the LPS-treated IL-1ß-/- mice compared with correspondingly treated IL-1ß+/+ mice. These findings in pregnant mice also agree with a previously reported decrease in IL-1{alpha} production by in vitro-LPS-treated peritoneal macrophages from nonpregnant IL-1ß-/- mice compared with macrophages from IL-1ß+/+ animals [53]. These findings may also be explained by the induction of IL-1{alpha} by IL-1ß [54]. Uterine levels of IL-1{alpha} are 1000-fold greater than those for IL-1ß. IL-1{alpha} is primarily a cell-associated cytokine whereas IL-1ß is secreted via an ICE-dependent pathway (reviewed in [55]). Therefore, tissue levels of IL-1{alpha} are usually higher than tissue levels of IL-1ß [56]. Correspondingly, amniotic fluid levels of IL-1ß at the time of human vaginal delivery are significantly higher than those of IL-1{alpha} [5, 57]. The decrease in IL-1{alpha} levels following LPS (Fig. 6) most likely reflects LPS-induced processing of IL-1{alpha} by calpain and the release of IL-1{alpha} into the extracellular environment [58, 59]. A similar release of IL-1{alpha} was previously demonstrated on explants of mouse placenta exposed to LPS in vitro [60]. It is therefore notable that, when the level of IL-1{alpha} in amniotic fluid increases towards parturition [5], the uterine content of IL-1{alpha} decreases [61].


   ACKNOWLEDGMENTS
 
We thank Dr. H. Zhang for the initial gift of IL-1ß-deficient mice, Ms. J.S. Monahan for assistance in microbiological procedures, Dr. P. Skavlen for instruction in murine anatomy and physiology, Dr. Janice French and Ms. S.M. Johnson for assistance, and Endogen, Inc., for the mouse reagents. Some of the concepts in this manuscript were initiated in the laboratory of Dr. Kimberly K. Leslie, to whom the present authors are grateful.


   FOOTNOTES
 
1 This work was supported by grants from the NIH (AI-15614 to C.A.D. and AI-2532359 to L.L.R.) and Colorado Cancer Center (CA-46943 to C.A.D.). Back

2 Correspondence: Leonid L. Reznikov, Univ. Colorado Health Sciences Center, Division Infectious Diseases, Campus Box B-168, 4200 East Ninth Ave., BRB 401, Denver, CO 80220. FAX: 303 315 8054; leonid.reznikov{at}uchsc.edu Back

Accepted: December 29, 1998.

Received: September 30, 1998.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Yang ZM, Chen DB, Le SP, Harper MJ. Interleukin-1{alpha} in the rabbit uterus during early pregnancy. Early Pregnancy 1995; 1:201–205.
  2. Robertson SA, Seamark RF, Guilbert LJ, Wegmann TG. The role of cytokines in gestation. Crit Rev Immunol 1994; 14:239–292.[Medline]
  3. Frank GR, Brar AK, Jikihara H, Cedars MI, Handwerger S. Interleukin-1ß and the endometrium: an inhibitor of stromal cell differentiation and possible autoregulator of decidualization in humans. Biol Reprod 1995; 52:184–191.[Abstract]
  4. Dudley DJ. Pre-term labor: an intra-uterine inflammatory response syndrome? J Reprod Immunol 1997; 36:93–109.[CrossRef][Medline]
  5. Tsunoda H, Tamatani T, Oomoto Y, Hirai Y, Kasahara T, Iwasaki H, Onozaki K. Changes in interleukin 1 levels in human amniotic fluid with gestational ages and delivery. Microbiol Immunol 1990; 34:377–385.[Medline]
  6. Opsjln SL, Wathen NC, Tingulstad S, Wiedswang G, Sundan A, Waage A, Austgulen R. Tumor necrosis factor, interleukin-1, and interleukin-6 in normal human pregnancy. Am J Obstet Gynecol 1993; 169:397–404.[Medline]
  7. Cox SM, Casey ML, MacDonald PC. Accumulation of interleukin-1ß and interleukin-6 in amniotic fluid: a sequela of labour at term and preterm. Hum Reprod Update 1997; 3:517–527.[Abstract/Free Full Text]
  8. Romero R, Mazor M, Tartakovsky B. Systemic administration of interleukin-1 induces preterm parturition in mice. Am J Obstet Gynecol 1991; 165:969–971.[Medline]
  9. Bry K, Hallman M. Transforming growth factor-ß2 prevents preterm delivery induced by interleukin-1{alpha} and tumor necrosis factor-{alpha} in the rabbit. Am J Obstet Gynecol 1993; 168:1318–1322.[Medline]
  10. Baggia S, Gravett MG, Witkin SS, Haluska GJ, Novy MJ. Interleukin-1ß intra-amniotic infusion induces tumor necrosis factor-{alpha}, prostaglandin production, and preterm contractions in pregnant rhesus monkeys. J Soc Gynecol Invest 1996; 3:121–126.[CrossRef][Medline]
  11. Arck PC, Troutt AB, Clark DA. Soluble receptors neutralizing TNF-{alpha} and IL-1 block stress-triggered murine abortion. Am J Reprod Immunol 1997; 37:262–266.
  12. Romero R, Tartakovsky B. The natural interleukin-1 receptor antagonist prevents interleukin-1-induced preterm delivery in mice. Am J Obstet Gynecol 1992; 167:1041–1045.[Medline]
  13. Romero R, Mazor M, Brandt F, Sepulveda W, Avila C, Cotton DB, Dinarello CA. Interleukin-1{alpha} and interleukin-1ß in preterm and term human parturition. Am J Reprod Immunol 1992; 27:117–123.
  14. McDuffie RSJ, Sherman MP, Gibbs RS. Amniotic fluid tumor necrosis factor-{alpha} and interleukin-1 in a rabbit model of bacterially induced preterm pregnancy loss. Am J Obstet Gynecol 1992; 167:1583–1588.[Medline]
  15. Fidel PLJ, Romero R, Wolf N, Cutright J, Ramirez M, Araneda H, Cotton DB. Systemic and local cytokine profiles in endotoxin-induced preterm parturition in mice. Am J Obstet Gynecol 1994; 170:1467–1475.[Medline]
  16. Oshiro B, Silver RM, Dudley DJ, Mitchell MD, Branch DW. The mouse as an investigational model for pre-term labor. Semin Reprod Endocrinol 1994; 12:240–245.
  17. Gravett MG, Witkin SS, Haluska GJ, Edwards JL. An experimental model for intraamniotic infection and preterm labor in rhesus monkeys. Am J Obstet Gynecol 1994; 171:1660–1667.[Medline]
  18. Liang L, Kover K, Dey SK, Andrews GK. Regulation of interleukin-6 and interleukin-1ß gene expression in the mouse deciduum. J Reprod Immunol 1996; 30:29–52.[CrossRef][Medline]
  19. Silver RM, Edwin SS, Umar F, Dudley DJ, Branch DW, Mitchell MD. Bacterial lipopolysaccharide-mediated murine fetal death: the role of interleukin-1. Am J Obstet Gynecol 1997; 176:544–549.[CrossRef][Medline]
  20. Fidel PLJ, Romero R, Cutright J, Wolf N, Gomez R, Areneda H, Ramirez M, Yoon BH. Treatment with the interleukin-1 receptor antagonist and soluble tumor necrosis factor Fc fusion protein does not prevent endotoxin-induced preterm parturition in mice. J Soc Gynecol Invest 1997; 4:22–26.[CrossRef][Medline]
  21. Oshiro BT, Monga M, Eriksen NL, Graham JM, Weisbrodt NW, Blanco JD. Endotoxin, interleukin-1ß, interleukin-6, or tumor necrosis factor-{alpha} do not acutely stimulate isolated murine myometrial contractile activity. Am J Obstet Gynecol 1993; 169:1424–1427.[Medline]
  22. Ammala M, Nyman T, Salmi A, Rutanen EM. The interleukin-1 system in gestational tissues at term: effect of labour. Placenta 1997; 18:717–723.[CrossRef][Medline]
  23. Dudley DJ, Chen CL, Branch DW, Hammond E, Mitchell MD. A murine model of preterm labor: inflammatory mediators regulate the production of prostaglandin E2 and interleukin-6 by murine decidua. Biol Reprod 1993; 48:33–39.[Abstract]
  24. Lonsdale LB, Elder MG, Sullivan MH. A comparison of cytokine and hormone production by decidual cells and tissue explants. J Endocrinol 1996; 151:309–313.[Abstract/Free Full Text]
  25. Kauma SW, Walsh SW, Nestler JE, Turner TT. Interleukin-1 is induced in the human placenta by endotoxin and isolation procedures for trophoblasts. J Clin Endocrinol Metab 1992; 75:951–955.[Abstract]
  26. Dombroski RA, Woodard DS, Harper MJK, Gibbs RS. A rabbit model for bacteria-induced preterm pregnancy loss. Am J Obstet Gynecol 1990; 163:1938–1943.[Medline]
  27. Hirsch E, Saotome I, Hirsh D. A model of intrauterine infection and preterm delivery in mice. Am J Obstet Gynecol 1995; 172:1598–1603.[CrossRef][Medline]
  28. Zheng H, Fletcher D, Kozak W, Jiang M, Hofmann K, Conn CC, Siszynski D, Grabiec C, Trumbauer MA, Shaw AR, Kostura MJ, Stevens K, Rosen H, North RJ, Chen HY, Tocci MJ, Kluger MJ, Van der Ploeg LHT. Resistance to fever induction and impaired acute-phase response in interleukin-1ß deficient mice. Immunity 1995; 3:9–19.[CrossRef][Medline]
  29. Alheim K, Chai Z, Fantuzzi G, Hasanvan H, Malinowsky D, Di Santo E, Ghezzi P, Dinarello CA, Bartfai T. Hyperresponsive febrile reactions to interleukin (IL) 1{alpha} and IL-1ß, and altered brain cytokine mRNA and serum cytokine levels, in IL-1ß-deficient mice. Proc Natl Acad Sci USA 1997; 94:2681–2686.[Abstract/Free Full Text]
  30. Park JM, Yang T, Arend LJ, Smart AM, Schnermann JB, Briggs JP. Cyclooxygenase-2 is expressed in bladder during fetal development and stimulated by outlet obstruction. Am J Physiol 1997; 273:F538-F544.
  31. Fantuzzi G, Puren AJ, Harding MW, Livingston DJ, Dinarello CA. IL-18 regulation of IFN-g production and cell proliferation as revealed in interleukin-1ß converting enzyme-deficient mice. Blood 1998; 91:2118–2125.[Abstract/Free Full Text]
  32. Nishiyama T, Mitsuyama K, Toyonaga A, Sasaki E, Tanikawa K. Colonic mucosal interleukin 1 receptor antagonist in inflammatory bowel disease. Digestion 1994; 55:368–373.[Medline]
  33. Fantuzzi G, Ku G, Harding MW, Livingston DL, Sipe JD, Kuida K, Flavell RA, Dinarello CA. Response to local inflammation of IL-1ß converting enzyme-deficient mice. J Immunol 1997; 158:1818–1824.[Abstract]
  34. Schreiber E, Matthias P, Muller MM, Schaffner W. Rapid detection of octamer binding proteins with "mini-extracts," prepared from a small number of cells. Nucleic Acids Res 1989; 17:6419.[Free Full Text]
  35. Reznikov LL, Fantuzzi G, Bell H, McGregor JA, Dinarello CA. A new model of infection induced cytokine-mediated premature pregnancy loss. Cytokine 1997; 9:911 (abstract 985).
  36. Kaga N, Katsuki Y, Obata M, Shibutani Y. Repeated administration of low-dose lipopolysaccharide induces preterm delivery in mice. A model for human preterm parturition and for assessment of the therapeutic ability of drugs against preterm delivery. Am J Obstet Gynecol 1996; 174:754–759.[CrossRef][Medline]
  37. Rieder RF, Thomas L. Studies on the mechanisms involved in the production of abortion by endotoxin. J Immunol 1960; 84:189–193.
  38. Witkin S, McGregor JA. Infection-induced activation of cell-mediated immunity: possible mechanism for preterm birth. Clin Obstet Gynecol 1991; 34:112–121.[CrossRef][Medline]
  39. Mitchell MD, Romero RJ, Edwin SS, Trautman MS. Prostaglandins and parturition. Reprod Fertil Dev 1995; 7:623–632.[CrossRef][Medline]
  40. Blackwell TS, Christman JW. The role of nuclear factor-kappa B in cytokine gene regulation. Am J Respir Cell Mol Biol 1997; 17:3–9.[Abstract/Free Full Text]
  41. Hiscott J, Marois J, Garoufalis J, D'Addario M, Roulston A, Kwan I, Pepin N, Lacoste J, Nguyen H, Bensi G. Characterization of a functional NF-kappa B site in the human interleukin-1ß promoter: evidence for a positive autoregulatory loop. Mol Cell Biol 1993; 13:6231–6240.[Abstract/Free Full Text]
  42. Lockwood CJ. Recent advances in elucidating the pathogenesis of preterm delivery, the detection of patients at risk, and preventative therapies. Curr Opin Obstet Gynecol 1994; 6:7–18.[Medline]
  43. Newton R, Stevens DA, Hart LA, Lindsay M, Adcock IM, Barnes PJ. Superinduction of COX-2 mRNA by cycloheximide and interleukin-1ß involves increased transcription and correlates with increased NF-kappaB and JNK activation. FEBS Lett 1997; 418:135–138.[CrossRef][Medline]
  44. Newton R, Kuitert LM, Bergmann M, Adcock IM, Barnes PJ. Evidence for involvement of NF-kappaB in the transcriptional control of COX-2 gene expression by IL-1ß. Biochem Biophys Res Commun 1997; 237:28–32.[CrossRef][Medline]
  45. Arslan A, Zingg HH. Regulation of COX-2 gene expression in rat uterus in vivo and in vitro. Prostaglandins 1996; 52:463–481.[CrossRef][Medline]
  46. Ishihara O, Numari H, Saitoh M, Arai Y, Takanashi H, Kitagawa H, Kinoshita K. Prostaglandin E2 production by endogenous secretion of interleukin-1 in decidual cells obtained before and after the labor. Prostaglandins 1996; 52:199–208.[CrossRef][Medline]
  47. Dudley DJ, Collmer D, Mitchell MD, Trautman MS. Inflammatory cytokine mRNA in human gestational tissues: implications for term and preterm labor. J Soc Gynecol Invest 1996; 3:328–335.[CrossRef][Medline]
  48. Gunn L, Hardiman P, Tharmaratnam S, Lowe D, Chard T. Measurement of interleukin-1{alpha} and interleukin-6 in pregnancy-associated tissues. Reprod Fertil Dev 1996; 8:1069–1073.[CrossRef][Medline]
  49. Steinborn A, Kuhnert M, Halberstadt E. Immunomodulating cytokines induce term and preterm parturition. J Perinat Med 1996; 24:381–390.[Medline]
  50. Li P, Allen H, Banerjee S, Franklin S, Herzog L, Johnston C, McDowell J, Paskind M, Rodman L, Salfeld J, Towne E, Tracey D, Wardwell S, Wei F-Y, Wong W, Kamen R, Seshadri T. Mice deficient in interleukin-1 converting enzyme (ICE) are defective in production of mature interleukin-1ß and resistant to endotoxic shock. Cell 1995; 80:401–411.[CrossRef][Medline]
  51. Abbondanzo SJ, Cullinan EB, McIntyre K, Labow MA, Stewart CL. Reproduction in mice lacking a functional type 1 IL-1 receptor. Endocrinology 1996; 137:3598–3601.[Abstract]
  52. Hirsch E, Irikura VM, Paul SM, Hirsh D. Functions of interleukin-1 receptor antagonist in gene knockout and overproducing mice. Proc Natl Acad Sci USA 1996; 93:11008–11013.[Abstract/Free Full Text]
  53. Fantuzzi G, Zheng H, Faggioni R, Benigni F, Ghezzi P, Sipe JD, Shaw AR, Dinarello CA. Effect of endotoxin in IL-1ß-deficient mice. J Immunol 1996; 157:291–296.[Abstract]
  54. Dinarello CA, Ikejima T, Warner SJ, Orencole SF, Lonnemann G, Cannon JG, Libby P. Interleukin 1 induces interleukin 1. I. Induction of circulating interleukin 1 in rabbits in vivo and in human mononuclear cells in vitro. J Immunol 1987; 139:1902–1910.[Abstract]
  55. Dinarello CA. Biological basis for interleukin-1 in disease. Blood 1996; 87:2095–2147.[Abstract/Free Full Text]
  56. Cominelli F, Nast CC, Clark BD, Schindler R, Llerena R, Eysselein VE, Thompson RC, Dinarello CA. Interleukin-1 gene expression, synthesis and effect of specific IL-1 receptor blockade in rabbit immune complex colitis. J Clin Invest 1990; 86:972–980.
  57. Hirano K, Daitoh T, Kamada M, Maeda N, Ohmoto Y, Aono T. Predominant production of amniotic interleukin-1{alpha} in cases with premature rupture of the membranes. Am J Reprod Immunol 1993; 29:162–170.
  58. Kobayashi Y, Yamamoto K, Saido T, Kawasaki H, Oppenheim JJ, Matsushima K. Identification of calcium-activated neutral protease as a processing enzyme of human interleukin 1{alpha}. Proc Natl Acad Sci USA 1990; 87:5548–5552.[Abstract/Free Full Text]
  59. Miller AC, Schattenberg DG, Malkinson AM, Ross D. Decreased content of the IL-1{alpha} processing enzyme calpain in murine bone marrow-derived macrophages after treatment with the benzene metabolite hydroquinone. Toxicol Lett 1994; 74:177–184.[CrossRef][Medline]
  60. Laham N, Brennecke SP, Bendtzen K, Rice GE. Labour-associated increase in interleukin-1{alpha} release in vitro by human gestational tissues. J Endocrinol 1996; 150:515–522.[Abstract/Free Full Text]
  61. De M, Sanford TH, Wood GW. Detection of interleukin-1, interleukin-6, and tumor necrosis factor-{alpha} in the uterus during the second half of pregnancy in the mouse. Endocrinology 1992; 131:14–20.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Biol. Reprod.Home page
W. Li, E. Unlugedik, A. D. Bocking, and J. R.G. Challis
The Role of Prostaglandins in the Mechanism of Lipopolysaccharide-Induced proMMP9 Secretion from Human Placenta and Fetal Membrane Cells
Biol Reprod, April 1, 2007; 76(4): 654 - 659.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
X. Wang, H. Hagberg, C. Mallard, C. Zhu, M. Hedtjarn, C.-F. Tiger, K. Eriksson, A. Rosen, and B. Jacobsson
Disruption of Interleukin-18, but Not Interleukin-1, Increases Vulnerability to Preterm Delivery and Fetal Mortality after Intrauterine Inflammation
Am. J. Pathol., September 1, 2006; 169(3): 967 - 976.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
B. C. Timmons and M. S. Mahendroo
Timing of Neutrophil Activation and Expression of Proinflammatory Markers Do Not Support a Role for Neutrophils in Cervical Ripening in the Mouse
Biol Reprod, February 1, 2006; 74(2): 236 - 245.
[Abstract] [Full Text] [PDF]

Home page
 Reproductive SciencesHome page
K. Yoshimura and E. Hirsch
Effect of Stimulation and Antagonism of Interleukin-1 Signaling on Preterm Delivery in Mice
Reproductive Sciences, October 1, 2005; 12(7): 533 - 538.
[Abstract] [PDF]

Home page
 Reproductive SciencesHome page
E. Hirsch and H. Wang
The Molecular Pathophysiology of Bacterially Induced Preterm Labor: Insights From the Murine Model
Reproductive Sciences, April 1, 2005; 12(3): 145 - 155.
[Abstract] [PDF]

Home page
 Biol. Reprod.Home page
H. Wang and E. Hirsch
Bacterially-Induced Preterm Labor and Regulation of Prostaglandin-Metabolizing Enzyme Expression in Mice: The Role of Toll-Like Receptor 4
Biol Reprod, December 1, 2003; 69(6): 1957 - 1963.
[Abstract] [Full Text] [PDF]

Home page
 Reproductive SciencesHome page
S. M. Yellon, A. M. Mackler, and M. A. Kirby
The Role of Leukocyte Traffic and Activation in Parturition
Reproductive Sciences, September 1, 2003; 10(6): 323 - 338.
[Abstract] [PDF]

Home page
 Biol. Reprod.Home page
E. Hirsch and R. Muhle
Intrauterine Bacterial Inoculation Induces Labor in the Mouse by Mechanisms Other than Progesterone Withdrawal
Biol Reprod, October 1, 2002; 67(4): 1337 - 1341.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
L. L. Reznikov, B. D. Shames, H. A. Barton, C. H. Selzman, G. Fantuzzi, S.-H. Kim, S. M. Johnson, and C. A. Dinarello
Interleukin-1beta deficiency results in reduced NF-kappa B levels in pregnant mice
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2000; 278(1): R263 - R270.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reznikov, L. L.
Right arrow Articles by Dinarello, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reznikov, L. L.
Right arrow Articles by Dinarello, C. A.
Agricola
Right arrow Articles by Reznikov, L. L.
Right arrow Articles by Dinarello, C. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS