| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Articles |
a Center for Reproductive Biology, Department of Genetics and Cell Biology, Washington State University, Pullman, Washington 99164-4231
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Transforming growth factor betas (TGFßs) are critical for growth regulation and development of many different cell types within an organism. Of the five TGFß isoforms identified, three [9–11] are present in mammals (TGFß1, TGFß2, TGFß3). Each of the TGFß isoforms is encoded by a unique gene, each on a different chromosome. The primary functions of the TGFß isoforms are to enhance formation of the extracellular matrix and inhibit proliferation of most cells (for reviews see [9, 12]). Inhibition of growth by TGFß occurs through an arrest of the cell cycle in late G1 phase and may require interactions with retinoblastoma and cyclin or cyclin-dependent kinases. The effects of TGFßs are elicited by activation of two types of membrane receptors containing serine/threonine kinase activity [12, 13], but all TGFß isoforms bind and signal primarily through the TGFß receptor II.
Gene knockout and overexpression experiments with TGFß have demonstrated that precise regulation of each isoform is essential for survival. TGFß1 knockouts are phenotypically normal until approximately 3 wk after birth and then develop a severe wasting syndrome [14, 15]. Reproductive traits and organs within TGFß1 isoform knockout mice have not been extensively studied. However, there are significant deviations from normal Mendelian ratios, resulting in decreased offspring for both heterozygotes and homozygotes carrying the allele with the TGFß1 gene disruption. Thus, TGFß1 may be important in reproductive function or embryonic development.
Both TGFß1 and TGFß2 have been localized to the somatic cells in early embryonic testis [16–18], with receptor localization within the germ cells [19]. Before birth, the TGFß2 isoform is also detected within the germ cells [18]. The primary functions of TGFß isoforms during embryonic testis development are regulation of steroidogenesis within Leydig cells [20] and potential regulation of germ cell apoptosis [19]. Since TGFß isoforms are present in somatic cells of the testis during early embryonic development, their presence may be necessary for cell-cell interactions that occur during the morphological process of cord formation or embryonic testis growth.
In the current study, the expression of TGFß isoforms during embryonic testis development was examined. In addition, two critical time points were evaluated to determine the actions of TGFß during testis development. The first was E13-E14, when seminiferous cord formation occurs. The second time was P0, when cells of the testis are actively proliferating. The hypothesis tested was that TGFß1, TGFß2, and TGFß3 have critical roles in testis development and are necessary for normal cell-cell interactions during the process of seminiferous cord formation and embryonic testis growth.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Timed pregnant Sprague-Dawley rats were obtained from Charles River (Wilmington, MA). For E13 dissections, gonads were dissected out with the mesonephros, and for later-stage dissections testes alone were dissected. The organs were cultured in drops of medium on Millicell CM filters (Millipore, Bedford, MA) floating on the surface of 0.4 ml of CMRL 1066 medium (Gibco BRL, Gaithersburg, MD) supplemented with penicillin-streptomycin, insulin (10 µg/ml), and transferrin (10 µg/ml). Antibodies and factors were added directly to the culture medium. The medium was changed every day. E13 gonad + mesonephros cultures were typically kept for 3 days, by which time point cords are well developed. E14 testes were kept for 3 days, and cords were formed before dissection and organ culture.
Genomic DNA Isolation and Polymerase Chain Reaction (PCR) for SRY
To determine the sex of E13 gonads, PCR for SRY was examined. Embryonic tails were collected to make genomic DNA by standard procedures. Briefly, the tissue was homogenized through a 25-gauge needle in digestion buffer (100 mM NaCl, 10 mM Tris pH 8, 25 mM EDTA, 0.5% SDS) and digested with proteinase K (0.15 mg/ml) for at least 4 h at 60°C. The samples were then extracted twice with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), and once with chloroform:isoamyl alcohol. The DNA was then precipitated by adding a 1/10 volume of 7.5 M NH4Ac and 3 volumes cold ethanol, and incubating at -80°C for 1 h before centrifugation at 4°C for 30 min. Pellets were dried and resuspended in 10 µl dH2O. PCR was performed using 1 µl of genomic DNA with primers to SRY. The sequences of the SRY primers are: 5' CGGGATCCATGTCAAGCGCCCCATGAATGCATTTATG 3' and 5' GCGGAATTCACTTTAGCCCTCCGATGAGGCTGATAT 3'. PCR was performed using an annealing temperature of 55°C for 30 cycles to yield a product of 240 base pairs (bp) [21].
P0 Testis Culture and Growth Assay
To generate a testicular culture from P0 testis, the tunica was removed, and the testis was digested with 0.125% trypsin, 0.1% EDTA, and 0.02 mg/ml deoxyribonuclease (DNase) in Hanks' Balanced Salt Solution (HBSS) for 15 min at 37°C. The trypsin was inactivated with 10% calf serum. The samples were triturated with a pipette tip and washed twice in 1 ml HBSS by resuspending, spinning for 2 min, and removing the supernatant. The remaining cell pellet was resuspended and used immediately in growth assays or plated in 100-mm plates in F12 medium supplemented with 10% bovine calf serum until confluent (approximately two days). Cells were plated at a 25% confluency in 24-well plates and allowed to settle overnight in Dulbecco's Modified Eagle's medium (DMEM) without thymidine. Medium was replaced the next day, and cells were treated for 24 h with different hormones or growth factors. Media were removed after the 24-h treatment period, and medium containing tritiated thymidine (10 µCi/ml) was placed on cells and allowed to remain for 6 h. After 6 h, media were discarded, and cells were either frozen or processed using the following tritiated thymidine assay. A solution of 0.5 M NaH2PO4 (pH 7.3; 500 µl) was added to each well, and cells were sonicated. Half of the sonicated cells were placed on DE-81 filters on a manifold, and a vacuum was applied. After three washes with the NaH2PO4 buffer (vacuum applied after each wash) the filters were dried, placed in counting vials with 5 ml of scintillation fluid, and counted. The remaining sonicate was then used for DNA assays to normalize number of cells (DNA) per well [22].
DNA Assay
To assay the DNA content of organs, each organ was sonicated in 100 µl ethidium bromide buffer (EBB; 20 mM NaCl, 5 mM EDTA, 10 mM Tris pH 7.5) and stored at -20°C. DNA content then was determined fluorometrically with ethidium bromide as previously described [22]. Briefly, 0.25 nM ethidium bromide and 100 U/ml heparin in EBB were added to each sample, vortexed, and incubated for 15 min at room temperature. Fluorescent emission was measured and quantified by using a standard curve with calf thymus DNA from 0.5 µg to 6 µg DNA. For growth assays, the above procedure was used on remaining sonicate from the tritiated thymidine procedure [22].
Imaging and Area Analysis
Images of whole organs were obtained by using an image analysis system (Pixera; Pixera Corp., Los Gatos, CA; [22]). Areas were quantified using the NIH image program. Previous data correlated DNA concentrations of testis organ cultures with the area imaged by the NIH image program [23]. Each testis (without mesonephros) was outlined three times, and the areas of these outlines were averaged to obtain accurate area measurements. The averages for the control testis organ cultures were set to 100%, and the area of a treated testis was calculated as a percentage of its paired control. Approximately 18 testis pairs for the E14 testis organ cultures (three experiments with 6 testis pairs per experiment) and 36 testis pairs for the E13 testis organ cultures (4 experiments with 6 testis pairs per experiment) were imaged for area quantifications. Areas for each age were averaged and presented as a percentage of their respective controls.
RNA Isolation and Quantitative Reverse Transcription (RT)-Polymerase Chain Reaction (PCR)
RNA for RT-PCR was extracted from tissue using Tri Reagent (Sigma, St. Louis, MO) for RNA isolation. RT and quantitative RT-PCR (QRT-PCR) procedures were utilized as previously published [22]. Briefly, for QRT-PCR, total RNA (1 µg) was reverse-transcribed using the specific 3'-primers of interest. Carrier DNA (Bluescript plasmid; Stratagene, La Jolla, CA) was added to a final concentration of 10 ng/µl. Plasmid DNAs containing standard subclones of interest were used to generate standard curves from 1 ng/µl (10-15 g/µl) to 10 pg/µl (10 x 10-9 g/µl), each containing 10 ng/µl Bluescript carrier DNA. Identical 10-µl aliquots of each sample and standard were used for PCR amplification. By this design it was possible to simultaneously assay 5 known standard concentrations and 40 unknown samples for each gene. At least 0.25 µCi of 32P-labeled dCTP was included in each sample during amplification. Specific PCR products were quantitated by electrophoresing all samples on 4–5% polyacrylamide gels, simultaneously exposing the gels to a phosphor screen for 8–24 h, and then quantifying specific bands on a PhosphorImager (Molecular Dynamics, Sunnyvale, CA). Each gene was assayed in separate PCR reactions from the same RT samples. Equivalent steady-state mRNA levels for each gene were determined by comparing each sample to the appropriate standard curve. All gene expression data were normalized for 1B15 (cyclophilin) mRNA. Cyclophilin is constitutively expressed in the testis until the pachytene spermatocytes are present [24]. Since pachytene spermatocytes first appear around P17–18 of age, measurements at any age after this point should be evaluated with this limitation considered. The optimal cycle number for amplification was determined for each assay in order to achieve maximum sensitivity while maintaining linearity (i.e., logarithmic phase of PCR reactions). The sensitivity of each quantitative PCR assay is below 1 fg, with intraassay variabilities of 6.0–15%. Primers used for the QRT-PCR are as follows: TGFß1, 5 prime: 5'-TCG ATT TTG ACG TCA CTG GAG TTG T-3', 3 prime: 5'-GGG GTG GCC ATG AGG AGC AGG-3'; TGFß2, 5 prime: 5'-CCG CCC ACT TTC TAC AGA CCC-3', 3 prime: 5'-GCG CTG GGT GGG AGA TGT TAA-3'; TGFß3, 5 prime: 5' TGC CCA ACC CGA GCT CTA AGC G-3', 3 prime: 5' CCT TTG AAT TTG ATC TCC A-3'; cyclophilin, 5 prime: 5' ACA CGC CAT AAT GGC ACT GG-3', 3 prime: 5'-ATT TGC CAT GGA CAA GAT GCC-3' [22].
Embedding, Histology, and Immunohistochemistry
Tissues were fixed in Histochoice (Amresco, Solon, OH) and embedded in paraffin according to standard procedures [25, 26]. Sections were stained with hematoxylin and eosin according to standard procedures [25, 26]. Briefly, 3-µm sections were deparaffinized and rehydrated, microwaved (15 min), and blocked in 10% serum for 30 min at room temperature. Immunocytochemistry was performed as previously described [22, 25]. The TGFß1 primary antibody was an anti-TGFß1 peptide antibody (Santa Cruz Biotechnology [SCB], Santa Cruz, CA) raised against amino acids 328–353 of human TGFß1 (which is 100% homologous to mouse TGFß1). The TGFß2 primary antibody was an anti-TGFß2 peptide antibody (SCB) raised against amino acids 352–377 of human TGFß2. The TGFß3 primary antibody was an anti-TGFß3 peptide antibody (SCB) raised against amino acids 350–375 of human TGFß3. The TGFß1 and TGFß3 antibodies were diluted 1:50 in 10% goat serum; the TGFß2 primary antibody was diluted 1:1200 in 10% goat serum. The biotinylated goat anti-rabbit secondary antibody (Vector Laboratories, Burlington, CA) was diluted 1:300. Two negative controls were conducted for each TGFß isoform. The first negative control involved a serial section of testis tissue treated as described above, but with no primary TGFß antibody. The second negative control involved incubation of each primary antibody with 50- to 100-fold excess of each respective TGFß protein before application to the tissue; then these tissues were treated as described above. The secondary antibody was detected by using the histo stain-sp kit (Zymed Laboratories, South San Francisco, CA), and immunohistochemical images were digitized with a slide scanner (Sprint Scan, Polaroid, Cambridge, MA).
Statistical Analysis
All data were analyzed by a JMP 3.1 statistical analysis program (SAS Institute, Cary, NC). All values are expressed as the mean ± SEM. Statistical analysis was performed using one-way ANOVA. Significant differences were determined using Dunnett's test for comparison to controls and using the Tukey-Kramer honestly significant difference test for multiple comparisons. Statistical difference was confirmed at p < 0.05.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Preliminary studies were performed to establish a reproducible and accurate QRT-PCR procedure [22]. The linearity of generating a PCR product relative to cycle number was determined [22]. Thirty cycles was selected as an appropriate cycle number for TGFß1, 33 cycles for TGFß2, 35 cycles for TGFß3, and 25 cycles for cyclophilin [22]. Comparison of standard DNA with unknown samples was conducted to determine parallel displacement. Plasmid DNA with subcloned PCR product and cDNA produced from unknown RNA samples were run in parallel. PCR products of diluted plasmid DNA and diluted unknown cDNA were compared. These two curves were parallel with each growth factor, indicating that the QRT-PCR assay could be used to quantitate mRNA levels. Minimal variability of this assay was demonstrated previously [22].
Developmental Regulation of TGFß Expression during Testis Development
Experiments were designed to investigate the changes in expression of TGFß1, TGFß2, and TGFß3 from E15 through postnatal day 30 (P30) of testis development. Whole testes were removed from rats aged E15, E16, E18, P0, P3, P4, P5, P10, P20, and P30, and the mRNA expression of TGFß was measured by QRT-PCR [22]. The expression of TGFß isoforms was quantitated using a standard curve for each isoform and was normalized by the expression of the gene cyclophilin, which is constitutively expressed through P10 of testis development [22], for each sample. The amount of mRNA for TGFß1 was low early in embryonic development (E15, p < 0.05); then increased at E16 (p < 0.05), birth (P0, p < 0.05), and prepuberty (P10, p < 0.05); and decreased after puberty and into adulthood (P20-P30, p < 0.05) (Fig. 1A). In contrast to TGFß1 expression, mRNA for TGFß2 was elevated early in embryonic development (E15, p < 0.05) and then decreased during the late embryonic period (E16, E18). TGFß2 transiently increased during the early postnatal period (P0-P4) and decreased during the pubertal and adult stages of testis development (P5-P30, p < 0.05) (Fig. 1B). Expression patterns for TGFß3 were the most dramatic, with higher concentrations of TGFß3 during embryonic testis development (E16-P0) and significantly lower concentrations during the postnatal, pubertal, and adult periods (P3-P30, p < 0.05) (Fig. 1C). In a subsequent study, E14 mRNA was analyzed, and levels of TGFß isoforms were consistent with those of E15 (data not shown). Each of the TGFß isoforms had a different pattern of expression during embryonic testis development. This suggests that these TGFß isoforms are differentially regulated. The reduction in message for all TGFß isoforms after puberty (P20–30) may be a dilution effect of increased number of germ cells in the testis due to the onset of spermatogenesis, or due to the increased amount of cyclophilin produced by pachytene spermatocytes at these developmental stages [24].
|
Localization of TGFß during Embryonic Testis Development
Immunohistochemistry was conducted on testis sections from E14 and P0 rats to determine expression of TGFß1, TGFß2, and TGFß3 (Fig. 2, A–H). Sections were evaluated and cell types were determined by staining of serial sections for cell-specific antibodies. Negative controls for each antibody were used to determine positively stained cells. Excess TGFß protein abolished staining for TGFßs 1, 2, and 3 antibodies for the sections evaluated (data not shown). At E14 there appeared to be more widespread staining of TGFß1. Positive staining for TGFß1 was present in Sertoli cells and surrounding gonocytes. However, even at higher magnification it was not conclusive whether gonocytes themselves were stained or the Sertoli cells surrounding the gonocytes were positive for TGFß1 (Fig. 2C). At P0, TGFß1 was expressed in Sertoli cells surrounding gonocytes, in gonocytes, and in some interstitial cells (Fig. 2D). Staining for TGFß2 was observed to be specific for Sertoli cells at E14 (Fig. 2E). At P0, TGFß2 was expressed at low levels in Sertoli cells, and high levels of expression were observed in selective interstitial cells (Fig. 2F). In contrast, TGFß3 was expressed in cells bordering the E14 mesonephros and testis (Fig. 2G). The intensely stained cells in E14 testis appeared to be pre-peritubular and to reside around seminiferous cords. Single cells of the testis interstitium also stained for TGFß3 at E14. Lower-intensity staining was observed both in mesonephric ducts of the mesonephros and in specific cells of the testis (Fig. 3, A–D). This pattern of TGFß3 may provide a marker for migrating cells from the mesonephros. In contrast to TGFß3 expression at E14, TGFß3 was expressed in gonocytes in the P0 testis (Fig. 2H). Cellular localization of TGFß isoforms appeared to be distinct, with changing cellular localization during embryonic and early postnatal testis development. These data complement the QRT-PCR data and confirm the expression of the TGFß proteins.
|
|
TGFß1 Regulation of Embryonic Seminiferous Cord Formation and Growth
The effects of TGFß1 on seminiferous cord formation were investigated in E13 testis organ cultures. E13 testes with mesonephroi were cultured on floating filters in the presence or absence of 40 ng/ml recombinant TGFß1 for a 3-day period. The testis organ cultures were routinely treated each day with daily changes of media. The control organ cultures formed seminiferous cords by the third day of culture. The dose of 40 ng/ml of TGFß1 was used because it had been determined previously [22, 23] to be the most effective dose to inhibit cellular growth in cell culture. Others have demonstrated that 10 ng/ml of TGFß1 can also inhibit cell growth in embryonic testis germ cells [19]. In the current study, TGFß1 did not inhibit seminiferous cord formation (Fig. 4, A and B) but did inhibit growth of the E13 testis organ cultures. The number of seminiferous cords formed in the TGFß1-treated testis was reduced, but this was due to the overall reduced size of the testis organ culture.
|
To determine the effects of TGFß on growth of testis organ cultures, the embryonic testes were cultured in the presence or absence of 40 ng/ml of TGFß1. TGFß1 inhibited growth of the E14 testis organ cultures in a manner similar to that of the E13 testis organ cultures (Fig. 4, C and D). The areas of the cultured testes were analyzed, and a significant reduction in testis size was observed in E13 and E14 cultured testes when compared to matched controls (approximately 40–50% reduction, p < 0.05; Fig. 5). Previously, the reduced area has been shown to correlate to a reduced DNA content in the organ (data not shown). Therefore, TGFß1 does not alter seminiferous cord formation but can inhibit testis growth, as demonstrated by the decreased testis area in TGFß1-treated E13 and E14 testis organ cultures.
|
TGFß1 Regulation of P0 Testis Cell Growth
The effects of TGFß1 on P0 testis growth were investigated through a tritiated thymidine incorporation assay to access cellular growth. Data were normalized to the amount of DNA for each sample. Mixed populations of P0 testis cultures were treated with the most effective dose of the growth factors FSH (25 ng/ml), EGF (50 ng/ml), and 10% calf serum. All treatments stimulated tritiated thymidine incorporation in growth assays conducted on P0 testis cultures (Fig. 6). P0 testis cell cultures were treated with TGFß alone or with positive regulators of P0 testis growth—FSH, EGF, and 10% calf serum. TGFß1 (40 ng/ml) treatment alone at the most effective dose for growth inhibition did not significantly alter thymidine incorporation into P0 testis cultures when compared to controls. However, TGFß1 inhibited (p < 0.05) EGF- and 10% calf serum-stimulated thymidine incorporation into P0 testis cultures (p < 0.05; Fig. 5). Interestingly, TGFß1 did not modulate FSH-stimulated growth in P0 testis cultures. Therefore, TGFß1 can inhibit growth factor-stimulated growth in P0 testis cultures (i.e., EGF and 10% calf serum) and may be a potential regulator of testis growth during this perinatal period.
|
Hormonal Regulation of TGFß Expression
The effects of positive stimulators of growth (i.e., EGF and FSH) on expression of TGFß1, TGFß2, and TGFß3 were examined (Fig. 7) in P0 testis cultures using QRT-PCR. All values were normalized with cyclophilin and expressed as relative expression compared with that in control cultures. P0 testis cultures were treated with FSH (25 ng/ml) and EGF (100 ng/ml), and RNA was collected after 24 h of treatment. EGF significantly stimulated expression of TGFß1 (p < 0.05) and reduced expression of TGFß3 (p < 0.05) after a 24-h period relative to controls (Fig. 7). There was no effect of treatment of P0 testis cultures with FSH (25–50 ng/ml) on expression of TGFß isoforms 24 h after stimulation. Therefore, these data demonstrate that EGF may directly regulate expression of mRNA for TGFß1 and TGFß3 in P0 testis cultures. This regulation may be part of a negative feedback loop between EGF and TGFß to modulate testis cell growth and differentiation.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
To extend these data, expression of mRNA for TGFß isoforms were also evaluated in the current study. Expression patterns of TGFß1, TGFß2, and TGFß3 are unique during testis development and do not appear to have overlapping expression patterns. Early in embryonic testis development (i.e., E15), only TGFß2 expression was high while the concentrations of mRNA for TGFß1 and TGFß3 were relatively low. There were similar results with E14 testis (data not shown). In addition, expression of TGFß1 was significantly higher at P0 and P10 while expression of TGFß2 was highest at E15 and P3. Interestingly, TGFß3 has the most distinctive expression pattern, with highest concentrations observed during embryonic testis development. This pattern may indicate an important role of TGFß3 during embryonic testis development, or it may have been due to the dilution effect of spermatogenesis during the postnatal period. TGFß1 has been reported to be present in germ cells and Sertoli cells during the postnatal period, and there was no dramatic change in expression of mRNA between the embryonic and postnatal periods. It is not known what the expression pattern of TGFß3 is during the postnatal period; therefore, if it is present in the somatic cells, a decrease in expression of this gene would be observed.
Actions of TGFß during embryonic testis development are thought to be primarily on gonocytes (E14), and by E16.5 on both Leydig cells and gonocytes [19]. Receptors for TGFß have been localized to gonocytes and Leydig cells at these developmental time periods. TGFß1 has been identified as a regulator of Leydig cell steroidogenesis, and it can inhibit LH-stimulated testosterone production [20] in E16.5 testis cultures. Both TGFß1 and TGFß2 have been demonstrated to induce gonocyte apoptosis around E14 of embryonic testis development [19]. Therefore, these results suggest that paracrine and/or autocrine interactions occur between cells that produce TGFß1 and TGFß2, to regulate both Leydig and gonocyte functions in the embryonic testis.
The potential action of TGFß on seminiferous cord formation has not been previously reported and is addressed in the current study. Treatment of E13 testis organ cultures did not affect seminiferous cord formation in the present study. However, growth of the embryonic testis organ cultures was inhibited as measured by testis area. A reduction in seminiferous cord numbers was observed in E13 testis organ cultures, but this was determined to occur because of a reduced overall size of the testis. This inhibition of growth was further demonstrated in E14 testis organ cultures treated with TGFß1, in which a 40% reduction in testis size compared to that of controls was observed. Previous reports have demonstrated a similar effect on gonocyte numbers with TGFß1 and TGFß2 treatment of E13.5 testis organ cultures. This reduction was demonstrated to occur through an increase in gonocyte apoptosis [19], and no data were included on effects of TGFß on overall testis size. In the current study, a 40% reduction in testis size in both E13 and E14 testis organ cultures was observed with TGFß1. A similar effect would be hypothesized with TGFß2. It seems unlikely that a 40% reduction in the size of the testis would occur because of the inhibition of one cell population alone. The dose of TGFß1 used in these experiments (40 ng/ml) was greater than in the experiments previously reported (10 ng/ml) [19]. Additionally, our experiments were conducted for 3 days, with TGFß1 treatments each day. Thus, by the last day of treatment, the Leydig cells may have obtained receptors for TGFß, causing a reduction in cellular proliferation within this cell type. This may explain the dramatic reduction in testis size within the testis organ cultures in the current study. Therefore, regulation of expression of TGFß1 may be important during embryonic testis development to initially regulate germ cell numbers and later to potentially regulate somatic cell growth.
TGFß1 is capable of inhibiting early postnatal testis growth as well as embryonic testis growth. In the current study, TGFß1 inhibited EGF- and 10% calf serum-stimulated growth in P0 testis cultures. The P0 testis cultures have a mixed population of cells, and these data must be interpreted carefully. Both gonocytes and Leydig cells, but not Sertoli cells, have receptors for TGFß at this time during testis development. Treatment of P0 testis cultures with FSH stimulates tritiated thymidine incorporation, presumably through stimulation of growth of Sertoli cells, which contain FSH receptors. TGFß1 did not inhibit FSH-stimulated growth but did inhibit EGF- and 10% calf serum-stimulated growth. Therefore, most of the effects of TGFß1 on inhibition of P0 testis may be elicited through inhibition of interstitial and/or gonocyte cell growth.
The TGFßs have been reported to stop the cell cycle in numerous cell types [13, 27] late in G1 when the cell becomes committed to enter S phase. Previous literature has demonstrated that gonocytes undergo mitotic arrest around E17-E18 and resume mitosis after P5 [28]. TGFß1 and TGFß2 may contribute to the regulation of this mitotic arrest since they are both highly expressed around P0. Growth stimulators such as EGF and FSH must either stimulate the expression of genes that promote progression to the S phase of the cell cycle, or inhibit expression of genes that halt cell cycle progression. Therefore, in the present study we hypothesized that EGF and FSH may inhibit mRNA expression of the TGFß isoforms. EGF did suppress expression of TGFß3 in P0 testis 24 h after stimulation. However, most of the data collected in the present study did not support our hypothesis. FSH stimulation had no effect on expression of TGFß isoforms. EGF stimulated expression of TGFß1 and suppressed expression of mRNA for TGFß3. These observation are interesting since FSH does not appear to regulate TGFß isoforms while EGF appears to regulate them differentially. Previous data suggest overlapping roles for the TGFß isoforms in the regulation of cell growth and proliferation; however, the current study suggests a unique regulation of each TGFß isoform by growth factors.
Interestingly, FSH stimulation of P0 testis was not inhibited by TGFß. In addition, FSH treatment did not influence expression of TGFß isoforms. Potential interactions have been reported between TGFß1 and LH in the fetal rat testis. TGFß1 has been demonstrated to inhibit LH-induced cAMP production and LH-induced testosterone production in dispersed fetal testis (E16.5) [20]. However, no studies have demonstrated interactions between FSH and TGFß isoforms. The results of the current study suggest that there is no direct regulation of FSH on expression of TGFß isoforms in cultures of P0 testis. This may be due to the fact that Sertoli cells do not appear to contain receptors for TGFß isoforms. Therefore, TGFß isoforms are incapable of directly regulating Sertoli cell specific growth. FSH may also stimulate the expression of factors that stimulate growth such as TGF
.
It is also interesting that the growth factor EGF can stimulate expression of a growth-inhibitory factor such as TGFß1 while suppressing TGFß3. This differential regulation of the two isoforms of TGFß may be due to the different cell types that produce each factor. At P0, TGFß1 is localized to three different cell types while TGFß3 is in gonocytes. EGF may differentially regulate these cell types. Increased expression of TGFß1 in response to EGF would demonstrate a feedback loop between these growth factors. High concentrations of EGF may act to stimulate TGFß1, which in turn suppresses EGF-stimulated growth.
The novel results of the current study demonstrate that TGFß isoforms effect embryonic testis growth through the regulation of locally produced growth factors. The unique expression patterns and cellular localization of the TGFß isoforms during embryonic testis development support a role for each isoform in the regulation of cellular growth and differentiation. TGFß regulates embryonic testis growth through inhibition of growth stimulators such as EGF. In contrast, EGF regulates expression of mRNA for TGFß isoforms. Combined observations suggest that the interactions of paracrine factors such as TGFßs and EGF allow for optimal cellular growth and differentiation during embryonic testis development.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Correspondence. FAX: 509 335 2176; skinner{at}mail.wsu.edu
Accepted: January 11, 1999.
Received: October 2, 1998.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  R. Zachow and M. Uzumcu The hepatocyte growth factor system as a regulator of female and male gonadal function J. Endocrinol., December 1, 2007; 195(3): 359 - 371. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Seenundun and B. Robaire Time-Dependent Rescue of Gene Expression by Androgens in the Mouse Proximal Caput Epididymidis-1 Cell Line after Androgen Withdrawal Endocrinology, January 1, 2007; 148(1): 173 - 188. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G Ricci, A Catizone, and M Galdieri Expression and functional role of hepatocyte growth factor and its receptor (c-met) during fetal mouse testis development J. Endocrinol., December 1, 2006; 191(3): 559 - 570. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. A. Henderson, G. M Cooke, and B. Robaire Region-specific expression of androgen and growth factor pathway genes in the rat epididymis and the effects of dual 5{alpha}-reductase inhibition. J. Endocrinol., September 1, 2006; 190(3): 779 - 791. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Itman, S. Mendis, B. Barakat, and K. L. Loveland All in the family: TGF-{beta} family action in testis development. Reproduction, August 1, 2006; 132(2): 233 - 246. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. C. Bott, R. M. McFee, D. T. Clopton, C. Toombs, and A. S. Cupp Vascular Endothelial Growth Factor and Kinase Domain Region Receptor Are Involved in Both Seminiferous Cord Formation and Vascular Development During Testis Morphogenesis in the Rat Biol Reprod, July 1, 2006; 75(1): 56 - 67. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Dufour, M. Hamilton, R. V. Rajotte, and G. S. Korbutt Neonatal Porcine Sertoli Cells Inhibit Human Natural Antibody-Mediated Lysis Biol Reprod, May 1, 2005; 72(5): 1224 - 1231. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. D. Mruk and C. Y. Cheng Sertoli-Sertoli and Sertoli-Germ Cell Interactions and Their Significance in Germ Cell Movement in the Seminiferous Epithelium during Spermatogenesis Endocr. Rev., October 1, 2004; 25(5): 747 - 806. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. S. Cupp, M. Uzumcu, H. Suzuki, K. Dirks, B. Phillips, and M. K. Skinner Effect of Transient Embryonic In Vivo Exposure to the Endocrine Disruptor Methoxychlor on Embryonic and Postnatal Testis Development J Androl, September 1, 2003; 24(5): 736 - 745. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. L. Loveland, M. Bakker, T. Meehan, E. Christy, V. von Schonfeldt, A. Drummond, and D. de Kretser Expression of Bambi Is Widespread in Juvenile and Adult Rat Tissues and Is Regulated in Male Germ Cells Endocrinology, September 1, 2003; 144(9): 4180 - 4186. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. L. L. Robinson, J. Townsend, and R. A. Anderson The Human Fetal Testis Is a Site of Expression of Neurotrophins and Their Receptors: Regulation of the Germ Cell and Peritubular Cell Population J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3943 - 3951. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. Cupp, M. Uzumcu, and M. K. Skinner Chemotactic Role of Neurotropin 3 in the Embryonic Testis That Facilitates Male Sex Determination Biol Reprod, June 1, 2003; 68(6): 2033 - 2037. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Dufour, R. V. Rajotte, and G. S. Korbutt Development of an In Vivo Model to Study Testicular Morphogenesis J Androl, September 1, 2002; 23(5): 635 - 644. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. Cupp, L. Tessarollo, and M. K. Skinner Testis Developmental Phenotypes in Neurotropin Receptor trkA and trkC Null Mutations: Role in Formation of Seminiferous Cords and Germ Cell Survival Biol Reprod, June 1, 2002; 66(6): 1838 - 1845. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Uzumcu, K. A. Dirks, and M. K. Skinner Inhibition of Platelet-Derived Growth Factor Actions in the Embryonic Testis Influences Normal Cord Development and Morphology Biol Reprod, March 1, 2002; 66(3): 745 - 753. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. Cupp, G. H. Kim, and M. K. Skinner Expression and Action of Neurotropin-3 and Nerve Growth Factor in Embryonic and Early Postnatal Rat Testis Development Biol Reprod, December 1, 2000; 63(6): 1617 - 1628. [Abstract] [Full Text]
|
|
