|
|
||||||||
Articles |
a Department of Cell Biology,
b Department of Urology, and
c The Center for Recombinant Gamete Contraceptive Vaccinogens, University of Virginia, Charlottesville, Virginia 22908
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Sperm antigens are considered to induce autoimmune responses because many are "differentiation or neo-antigens" [19], tissue-specific gene products that do not appear until puberty when meiosis is initiated [2]. Before puberty during neonatal induction of self-tolerance, these differentiation antigens may not be recognized as self antigens by the immune system [2]. The later stages of male germ cells are normally sequestered from contact with the immune system by the blood-testis barrier in the seminiferous epithelium [20] and by junctions between epididymal epithelial cells, the so-called blood-epididymal barrier [21]. However, obstruction of the vas deferens leads to release of both spermatozoa and/or soluble sperm antigens and induction of antibodies, which correlate with testicular alterations [10, 22]. Interestingly, unilateral vasectomy in rats shows histological changes in both the obstructed and the contralateral testis along with elevations in antisperm antibodies [23]. Obstruction of the male reproductive tract during prepubertal development is also followed by formation of antisperm antibodies, but only after sexual maturation when sperm appear in the epididymis [24, 25]. Complete occlusion is not even necessary since injury to the vas at a prepubertal state also leads at a later time to the production of antisperm antibodies [26].
Although antisperm antibodies arise after hyperimmunization with isologous sperm, after vasectomy, or after the onset of puberty in rats in which the vas deferens has been obstructed prepubertally, very few sperm autoantigens have been biochemically characterized. Western blots of sperm antigens reacted with sera from vasectomized, isoimmunized, or prepubertally obstructed rats show a common repertoire of immunodominant antigens, including proteins of 8278, 68 or 63, 57, 42, 36, and 22 kDa [2729]. High-resolution two-dimensional gel electrophoresis over a broad isoelectric range demonstrates more than 1400 silver-stained sperm proteins [30]. Remarkably, from this large field of potential sperm immunogens, relatively few consistently appear in the patterns of immunoreactive rat sperm proteins observed on Western blots reacted with sera from different animals. Although the apparent molecular masses and isoelectric points of some of the few autoantigenic proteins are now known from one- and two-dimensional immunoblots, to our knowledge no rat sperm autoantigenic protein sequences have been published.
Sperm mitochondria-associated cysteine-rich protein (SMCP), previously known as mitochondrial capsule selenoprotein (MCS) and mitochondrial capsule protein (MCP), is a major structural element of the mitochondria in the midpiece of the sperm tail [31]. (Since there are recent questions about the selenium content of this protein [see Discussion], we use the designation SMCP.) This report presents evidence that SMCP is an antigen in both auto- and iso-immune responses to sperm.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Poly(A)+ mRNA was isolated and purified from freshly harvested Lewis rat testis using guanidine isothiocyanate extraction and oligo(dT)-cellulose chromatography as described by Freemerman et al. [32, 33]. A testis expression library was constructed using Stratagene's Zap cDNA Synthesis Kit according to the manufacturer's instructions (Stratagene, La Jolla, CA). The system used an oligo(dT) primer with an XhoI site and EcoRI adapters to generate double-stranded cDNA from 5 µg of the poly(A)+ RNA. Samples were size-fractionated before ligation into Uni-Zap XR Vector Arms (Stratagene) and were then packaged into lambda coat proteins with Gigapack II Gold extracts (Stratagene). The library was amplified once through Stratagene's XL-Blue MRF' strain of Escherichia coli.
Screening of Library
Following procedures described by Maniatis [34], the expression library was screened with a 1:500 dilution of Lewis rat hyperimmune sera produced by immunizing rats with isologous cauda epididymal sperm [28]. Approximately 5 x 106 phage were plated in the first round of screening. Initial clones were isolated to purity, converted into Bluescript SK+ plasmid through phagemid rescue as described in Stratagene's protocol, and sequenced using the deoxy chain termination method and Sequenase (United States Biochemical Corp., Cleveland, OH) [32]. A cDNA probe from the longest of these clones, 1-1-1-3-2, was used to screen approximately 1 x 107 phage for additional clones [34]. Sixteen micrograms of clone 1-1-1-3-2 plasmid was digested simultaneously with EcoRI/XhoI (Promega, Madison, WI), and the insert was isolated by electrophoresis on a 1% agarose gel followed by electro-elution. The resulting fragment was labeled with [
-32P]dCTP using the Gibco-BRL Nick-Translation Kit protocols (Gibco, Grand Island, NY) and was used to isolate the full-length clone.
Expression of Recombinant SMCP (rec-SMCP) Protein
Full-length expression constructs of SMCP were engineered in the pET-22b+ expression vector (Novagen, Madison, WI). The constructs included 24 bases of 5 prime sequence because when this work was initiated the literature indicated that the start codon for SMCP was further upstream [35] than the currently accepted start codon. The vector confers an N-terminal pelB signal peptide to the recombinant protein (rec-protein) to enhance cytosolic expression and adds 6 histidine residues to the C terminus for purification by Ni-affinity chromatography. The following oligonucleotide primers were synthesized by the Biomolecular Research Facility at the University of Virginia: 137 (5'-GGGGAATTC
TCAGAAACTCCAACTCTAAAG) and 595 (5'-CCCCTCGAGCTTGGTCTTCTTCTGGTTCCA). For directional cloning into the vector, the 5' primer 137 contains an EcoRI site (shown in bold italics), and the reverse complement 3' primer 595 contains an XhoI site (bold italics). In addition, the 5' primer contains a spacer nucleotide (underlined G) to preserve the vector reading frame in the recombinant construct. Polymerase chain reaction fragments corresponding to the sequence (nucleotides 137595) were amplified using the primer set 137/595. All of the recombinant DNA procedures were carried out as described by Maniatis [34]. Both the engineered inserts and the vector DNA were digested with EcoRI and XhoI sequentially. The digested vector DNA was treated with calf intestine phosphatase before ligation. Ligation was carried out at 16°C overnight [34]. Five milliliters of each ligation reaction was transfected into competent BL-21 E. coli (Novagen) and selected for ampicillin resistance on NZY-ampicillin agar plates. Colonies were selected and the isolated plasmids were analyzed by EcoRI/XhoI digestion for the corresponding recombinant inserts. The constructs were sequenced, as above, from both sides of the inserts to ensure that the correct reading frame for the vector was maintained. To increase the overall yield of expressed protein, the construct was transfected into BL-21 pLysS E. coli (Novagen), which controls the transcription rate of the gene, preventing cell death due to overproduction of the protein.
Production and purification of the rec-SMCP protein was performed as described by Reddi et al. [36]. Briefly, 10 L of 3-strength Terrific Broth [37] with 50 µg/ml carbenicillin was inoculated with 200 ml of an overnight culture of the pET-22b construct in BL-21 pLysS host bacteria. The cells were induced with 1 mM isopropyl thiogalactoside (IPTG) when they had reached a density of A600 = 0.97, and the induction of the rec-protein continued for 5 h. The cells were harvested, pelleted under slow-speed centrifugation, and stored at -20°C. Purification of the soluble rec-protein was accomplished by Ni-affinity chromatography [36].
Generation of Polyclonal Ascites and Sera
Mouse anti-rat 137/595 rec-SMCP polyclonal ascites was generated in the Lymphocyte Culture Center (LCC) at the University of Virginia. Preimmune blood samples were obtained from the tail veins of three 6- to 8-wk-old female Balb/c mice. The immunogen for each injection was 20 µg of the Ni-affinity-purified 137/595 rec-SMCP, which was gel-purified by SDS-PAGE. The ~22.5 kDa acrylamide slice was emulsified in complete Freund's adjuvant for the first two injections and incomplete Freund's adjuvant for the third. Each animal received 3 injections at Weeks 0, 5, and 11, half of the immunogen being injected s.c. and half intraperitoneally. The abdomen was pristane-primed at Week 11, and the production of an ascites tumor was established by injection of nonsecreting SP2/0-Ag14 [38] mouse myeloma cells 10 days after priming. Sham ascites fluids were generated in an identical manner, after immunization with acrylamide slices lacking any protein. Ascites fluids from both sets of mice were collected over several weeks and were delipidated by centrifuging the fluid and removing the ascites from beneath the lipid layer.
Rabbit anti-rat 137/595 rec-SMCP polyclonal sera were generated in 3 female New Zealand white rabbits (78 lbs). After the preimmune sera were collected, each animal received an injection of 300 µg of rec-protein, gel-purified as described above. Half of the emulsion was injected i.m. and half into the popliteal lymph node. After the first immunization with Freund's complete adjuvant, three booster immunizations were administered, every fifth week, using Freund's incomplete adjuvant, and serum samples were collected 1 wk after the final boost.
Analysis of Rec-Protein and Polyclonal Antibodies
SDS-PAGE and Western blotting Proteins were solubilized in Laemmli buffer [39]. A 7.515% gradient or 10% linear separating gel was run at 30 mA for 4 h, and proteins were either silver-stained or electrotransferred onto 0.45-µm NitroPure nitrocellulose (Micron Separations Inc., Westborough, MA) at 100 mAmp for 14 h. The blots were stained with 0.1% amido black and were destained in 10% methanol and 10% acetic acid. The membrane was cut into strips that were blocked in 5% milk in PBS with 0.05% Tween-20 (PBS-tw) for 2 h. Rat serum samples were preabsorbed with an E. coli lysate, and the primary sera were incubated overnight at 4°C at varying dilutions. After the primary antibody incubation, the strips were washed 3 x 5 min in PBS-tw. The peroxidase-conjugated secondary antibodies were diluted 1:10 000 in the case of the goat anti-rabbit IgG or 1:5000 for the rabbit anti-rat IgG. The dilutions were made in PBS-tw, and incubation was for 1.5 h at 22°C. The strips were washed thrice for 5 min in PBS-tw, and each blot was developed using 0.2% diaminobenzidine substrate enhanced with 0.1% nickel chloride and 0.1% H2O2 in 0.1 M Trizma base.
Olmstead elution of antibody To purify anti-SMCP antibodies from the rabbit polyclonal sera, the immunoaffinity method of Olmstead was used [27, 40]. One hundred micrograms of purified rec-SMCP was loaded on an SDS-PAGE curtain gel, which was run and transferred as described previously. The 22- to 25-kDa rec-SMCP region was cut horizontally from the blot, blocked for 2 h in 5% milk, and incubated overnight at 4°C with a 1:1000 dilution of rabbit anti rec-SMCP polyclonal antibody (preimmune or postimmune). After washing for 3 x 30 min in PBS-tw, the purified antibody was eluted from the strip by incubating twice for 6 min each with 1 ml of 0.2 M glycine/0.5 M NaCl (pH 3.5). After incubation, each 1 ml of antibody solution was immediately neutralized with NaOH, and 1% w:v of BSA was added to stabilize the antibody. The strip was placed in 100 mM Tris/0.5 M NaCl (pH 8.0) and was incubated for 15 min. The strip was then incubated overnight with the original antibody solution, and the process was repeated a second time on the next day.
Immunofluorescence Adult Lewis rats were killed, and the cauda epididymidis and vas deferens were removed. Sperm were obtained by inserting an irrigating cannula into the proximal vas and flushing the contents from the vas and distal cauda of the epididymis with TE culture medium [41]. The sperm were washed twice with TE culture medium and collected by centrifugation. Five milliliters of medium was layered on top of the pellet, and the sperm were allowed to swim up for 1 h at 37°C in a 5% CO2 incubator. The swim-up sperm were counted using a hemocytometer and were diluted to a concentration of 1 x 106 sperm/ml. Twenty microliters of the sperm suspension was added per well (2 x 105 sperm) onto poly-L-lysine coated slides, and the sperm were allowed to bind to the slide for 7 min before the excess sperm were removed. The slides were dried at 40°C and then methanol-fixed for 10 min. After three 5-min washes in PBS, all subsequent incubations were carried out in a humid chamber. The preparations were blocked in 10% normal goat serum (NGS) in PBS-tw for 30 min. The rabbit anti-rec-SMCP primary antibody was diluted 200-fold with 10% NGS in PBS-tw and was incubated overnight at 4°C. The slides were then washed 3 x 5 min in PBS-tw, and the secondary antibody, goat anti-rabbit IgG conjugated with fluorescein isothiocyanate (Jackson ImmunoResearch, West Grove, PA), was applied at a 1:100 dilution in 10% NGS in PBS-tw for 2 h at 37°C. The slides were washed 3 x 5 min in PBS-tw, and the Slow Fade-Light Antifade Kit (Molecular Probes, Inc., Eugene, OR) was used to reduce the fading rate of the fluorescein.
| RESULTS |
|---|
|
|
|---|
|
The cDNA encoding the complete open reading frame for SMCP, including 24 bases of 5 prime sequence, was inserted into the pET 22b expression vector with inclusion of a PelB leader to increase protein export (Fig. 2). The terminal codon (bp 594596) was deleted (Fig. 2), and the expressed protein was purified by immobilized metal immunoaffinity chromatography using the six terminal histidines provided by the vector.
|
Migration in SDS-PAGE of the expressed rat SMCP, inclusive of the 26 amino acids of the PelB leader, is shown in Figure 3, lanes I and P. The bulk of this material ran at approximately 2225 kDa, and in addition a band at 3640 kDa was observed in these preparations, possibly indicating the presence of dimers of the expressed rec-SMCP. When recombinant rat SMCP was gel-purified and injected into rabbits, antisera were generated that showed reactivity with the 22- to 25-kDa band corresponding to rec-SMCP (Fig. 3).
|
In order to understand the pattern of immunoreactivity with SMCP in sperm, antiserum generated to the rec-SMCP was incubated with sperm protein extracts and was found to react with a broad band ranging from 16 to 24 kDa (Fig. 4), with some high molecular immunoreactive forms also being noted, e.g., at ~40 kDa. To study further the nature of the high molecular mass material, an immunoreagent specific to the 22- to 25-kDa form of the rec-SMCP was generated using the Olmstead elution method from a nitrocellulose strip containing only the 22- to 25-kDa form of mitochondrial capsule protein. This mono-specific antiserum to the recombinant 22- to 25-kDa form stained the higher molecular mass forms of the rec-SMCP at 3640, 5053, and 70 kDa, as well as the 22- to 25-kDa form from which the antibody was eluted, supporting the belief that the higher molecular mass forms were generated by complexing of SMCP, either with itself or with another protein (Fig. 5). Both the original polyclonal antisera to rec-SMCP as well as the Olmstead-enriched monospecific serum to the 22- to 25-kDa band recognized these polymorphic forms (Figs. 4 and 5). It may also be noted that when two-dimensional gels of sperm extracts were run, blotted, and immunostained with anti-rec-SMCP ascites, the higher molecular mass forms of SMCP showed considerable charge heterogeneity (data not shown).
|
|
Immunocytochemical staining using rabbit antisera to rec-SMCP showed intense staining of a portion of the tails of virtually all the sperm (Fig. 6A). Careful comparison of immunofluorescence (IF) and differential interference contrast (DIC) images (Fig. 6; A and B, E and F) showed localization of the staining to the anterior portion of the sperm tail beginning immediately behind the sperm head; i.e., in the region corresponding to the midpiece of the tail. Immunofluorescence controls exposed to preimmune serum under the same conditions as the immune test serum produced no staining (Fig. 6; C and D, G and H). Thus, the immunoreactivity of the antiserum produced to rec-SMCP corresponded to the location of the helical array of mitochondria within the sperm midpiece.
|
In order to determine whether the SMCP is an iso- and an auto-antigen, rec-SMCP and sperm protein extracts were reacted with sera 1) from animals that had been hyperimmunized with isologous sperm, or 2) from vasectomized rats containing autoantibodies to rat sperm (Fig. 7). Both hyperimmune serum (Fig. 7A, lane 3) and postvasectomy serum (Fig. 7A, lane 5) recognized rec-SMCP. Staining of sperm extracts was much more complex because both of these antisera were raised to whole sperm and thus bound multiple proteins (Fig. 7B). Reactivity of antibodies in hyperimmune and postvasectomy sera with rec-SMCP demonstrated that this sperm molecule was both an isoantigen and an autoantigen.
|
| DISCUSSION |
|---|
|
|
|---|
SMCP, identified here both as an sperm autoantigen and isoantigen for the first time, is an unusual protein believed to comprise part of the sperm mitochondria. The sperm tail contains many unique, highly differentiated structures. The mitochondria are very unusual in being arranged head to tail in a helix around the outer dense fibers in the mid-piece of the mammalian spermatozoon [45]. In this position, the individual mitochondria assume a crescentic shape, and there is evidence that they are held in place or stabilized in this array by a thickening of the outer mitochondrial membranes known as the mitochondrial capsule [46, 47]. SMCP is rich in cysteine and proline, found in repeat domains [48], and it is believed that SMCP has a structural role in the mitochondrial capsule [31]. This paper presents the first report of the expression and purification of a rec-SMCP and the generation of a monospecific antibody to the protein.
The precise immunofluorescent localization of SMCP to the midpiece in our study reinforces the generally accepted view that SMCP is a component of the mitochondrial capsule. Although there appears to be agreement about the composition and general location of the cysteine- and proline-rich SMCP in the sperm tail, the relation of SMCP to selenium-containing proteins of the spermatozoa has been more problematic. The selenium content of sperm proteins is of interest because reduced sperm motility and disorganization of sperm mitochondria occur in rats with a selenium deficiency [49, 50]. Pallini et al. [46] described three main proteins as comprising the mitochondrial capsules of bull sperm, including a 20-kDa protein of unusual composition, rich in cystine (17.9%) and proline (26.5%), and containing selenium. Calvin et al. [51, 52] subsequently studied a 17-kDa protein in rat sperm mitochondrial capsules with a molecular mass of 17 kDa that labeled with radioactive selenium, which they believed was identical to the smallest of the proteins identified by Pallini et al. [46] in the bull. Thus, the cysteine- and proline-rich mitochondrial protein became known as mitochondrial capsule selenoprotein, or MCS [48]. However, molecular cloning of cDNAs and sequencing of the MCS gene revealed several possible transcriptional start sites (AUG codons) [44]. In the mouse, use of one of the more 5 prime AUG codons provided three in-frame UGA codons [35], opal stop codons that are read by a tRNA for selenocysteine in the context of secondary structure [53]. However, in the rat and human, the comparable UGA codons are in a different reading frame [42, 43]. More recent evidence suggests that it is the third of the three AUG codons that constitutes the start site for SMCP in the mouse [44] and that the reading frame contains no UGA (selenocysteine) codons [44]. If SMCP indeed contains no selenium, the selenium-containing protein of sperm mitochondria may instead be the enzyme phospholipid hydroperoxide glutathione peroxidase (PHGPX) [44, 54].
The gene for both mouse and human SMCP is composed of two exons. The human SMCP gene maps to Q21 of chromosome 1 [43]. SMCP is a single-copy gene in both mice and humans, and expression of SMCP appears to be testis-specific [48]. A dramatic reduction in the level of the RNA for SMCP is seen in mice in which gene targeting was used to selectively eliminate the cAMP response element modulator CREM, a transcription factor active in regulating a number of postmeiotic genes [55].
The identification of the cysteine- and proline-rich mitochondrial protein SMCP as an auto- and iso-antigen of rat sperm is not surprising in view of its expression only in the testis and in sperm [48]. SMCP mRNA appears to be transcribed postmeiotically in round spermatids in mice [56] and rats [42]. Furthermore, SMCP is under translational regulation, and the protein is synthesized mainly in elongating spermatids [44, 57]. Since it is found only in the highly differentiated structures of the sperm tail and is expressed only after puberty, and since it is normally sequestered behind the blood-testis and blood-epididymal barriers, SMCP might be expected to be viewed as foreign by the immune system. After vasectomy or obstruction of the epididymis, contact of cells of the immune system with large amounts of SMCP can take place when rupture of the tract in the epididymis and/or vas deferens leads to formation of spermatic granulomas [5861], which are cyst-like foci of chronic inflammation containing sperm, lymphocytes, plasma cells, etc. Additional ways in which immune cells can contact spermatozoa include migration of macrophages into the lumen of the efferent ductules [60].
Other sperm and testicular autoantigens have been identified previously by various means. In experimental allergic orchitis in guinea pigs, semipurified preparations have been defined that are capable of inducing aspermatogenesis [62, 63]. The surface autoantigenic rabbit sialo glycoprotein, RSA1, has been cloned, and a related family of peptides has been identified in the mouse and human [64, 65]. Recently, a novel sperm-specific peptide antigen has been identified and cloned using a monoclonal antibody obtained from a vasectomized mouse [66]. Postvasectomy sera from men bind several human sperm proteins such as nuclear protamines [67], DNA polymerase [68], the sperm-specific glycoprotein FA1 [69], and other antigens identified by immunoprecipitation [70] or blotting with postvasectomy sera [7174].
Although immunoblotting has identified numerous immunoreactive protein spots, the molecular identity of only a few are known. Now that SMCP has been cloned and expressed, and identified as both an auto- and an iso-antigen in rats, use of rec-SMCP may prove of interest in experimental models of autoimmune orchitis. In the future, recombinant human SMCP might be useful as a target antigen for assessing the incidence of anti-SMCP antibodies in both men and women with antisperm antibody-mediated infertility.
| FOOTNOTES |
|---|
2 Correspondence: John C. Herr, Department of Cell Biology, University of Virginia, Box 439, Health Sciences Center, Charlottesville, VA 22908. FAX: 804 982 3912; jch7k{at}virginia.edu ![]()
3 Current address: Vrinda Khole, Institute for Research in Reproduction (ICMR), JM Street, Mumbai, India. ![]()
Accepted: March 17, 1999.
Received: December 29, 1998.
| REFERENCES |
|---|
|
|
|---|
6ß1 functions as a sperm receptor. Cell 1995; 81:10951104.[CrossRef][Medline]This article has been cited by other articles:
![]() |
S. K. Nagdas, V. P. Winfrey, and G. E. Olson Identification of a Hamster Sperm 26-Kilodalton Dehydrogenase/Reductase That Is Exclusively Localized to the Mitochondria of the Flagellum Biol Reprod, August 1, 2006; 75(2): 197 - 202. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E Olson, V. P Winfrey, K. E Hill, and R. F Burk Sequential development of flagellar defects in spermatids and epididymal spermatozoa of selenium-deficient rats Reproduction, March 1, 2004; 127(3): 335 - 342. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Rao, J. C. Herr, P. P. Reddi, M. J. Wolkowicz, L. A. Bush, N. E. Sherman, M. Black, and C. J. Flickinger Cloning and Characterization of a Novel Sperm-Associated Isoantigen (E-3) with Defensin- and Lectin-Like Motifs Expressed in Rat Epididymis Biol Reprod, January 1, 2003; 68(1): 290 - 301. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nayernia, I. M. Adham, E. Burkhardt-Gottges, J. Neesen, M. Rieche, S. Wolf, U. Sancken, K. Kleene, and W. Engel Asthenozoospermia in Mice with Targeted Deletion of the Sperm Mitochondrion-Associated Cysteine-Rich Protein (Smcp) Gene Mol. Cell. Biol., May 1, 2002; 22(9): 3046 - 3052. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Flickinger, J. Rao, L. Ann Bush, N. E. Sherman, R. J. Oko, F. C.L. Jayes, and J. C. Herr Outer Dense Fiber Proteins Are Dominant Postobstruction Autoantigens in Adult Lewis Rats Biol Reprod, May 1, 2001; 64(5): 1451 - 1459. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |