Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mizrachi, D.
Right arrow Articles by Shemesh, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mizrachi, D.
Right arrow Articles by Shemesh, M.
Agricola
Right arrow Articles by Mizrachi, D.
Right arrow Articles by Shemesh, M.
Biology of Reproduction 61, 776-784 (1999)
©Copyright 1999 Society for the Study of Reproduction, Inc.


Articles

Follicle-Stimulating Hormone Receptor and Its Messenger Ribonucleic Acid Are Present in the Bovine Cervix and Can Regulate Cervical Prostanoid Synthesis1

D. Mizrachia, and M. Shemesh2,a

a Department of Hormone Research, Kimron Veterinary Institute, Bet Dagan, Israel 50250


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The hypothesis that FSH regulates the bovine cervical prostaglandin E2 (PGE2) synthesis that is known to be associated with cervical relaxation and opening at the time of estrus was investigated. Cervical tissue from pre-estrous/estrous, luteal, and postovulatory cows were examined for 1) the presence of bovine (b) FSH receptor (R) and its corresponding mRNA and 2) the effect of FSH on the PGE2 regulatory pathway in vitro. The presence of bFSHR mRNA in the cervix (maximal during pre-estrus/estrus) was demonstrated by the expression of a reverse transcription (RT) polymerase chain reaction (PCR) product (384 base pairs) specific for bFSHR mRNA and sequencing. Northern blotting revealed three transcripts (2.5, 3.3, and 3.8 kilobases [kb]) in cervix from pre-estrous/estrous cows. The level of FSHR (75 kDa) was significantly higher (p < 0.01) in Western blots of pre-estrous/estrous cervix than in other cervical tissues. There was a good correlation between the 75-kDa protein expression and its corresponding transcript of 2.55 kb throughout the estrous cycle as described by Northern blot analysis as well as RT-PCR. Incubation of FSH (10 ng/ml) with pre-estrous/estrous cervix resulted in a 3-fold increase in the expression of FSHR and a 2-fold increase in both G protein ({alpha}s) and cyclooxygenase II. FSH (5–20 ng/ml) significantly increased (p < 0.01) cAMP, inositol phosphate (p < 0.01), and PGE2 (p < 0.01) production by pre-estrous/estrous cervix but not by cervix at the other stages. We conclude that bovine cervix at the time of the peripheral plasma FSH peak (pre-estrus/estrus) contains high levels of FSHR and responds to FSH by increasing the PGE2 production responsible for cervical relaxation at estrus.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
FSH and LH are the two known pituitary hormones that regulate gonadal functions. FSH is essential for female fertility, specifically for folliculogenesis, and human ovarian failure has been related to mutations both in the FSH receptor (FSHR) and in the FSHß gene [1]. However, unlike LH, for which extra-gonadal binding has been documented for the uterus in the cow [2], pig [3], and human [4], no extra-gonadal effects of FSH have been reported. The uterine LH receptors have been shown to be physiologically active in the cow [2, 5]. The concentration of uterine LH receptors is related to the phase of the cycle, and binding of LH to uterine receptors increases uterine prostaglandin synthesis [2, 5]. Preliminary observations in our laboratory indicated that both FSH and LH receptors are also present in the cervix. We therefore investigated whether FSHRs are associated with the regulation of cervical prostaglandin, particularly around the time of estrus, when both cervical PGE2 production [6] and peripheral FSH concentrations are maximal.

The present investigation was therefore conducted to determine the presence of FSHR and its mRNA, and its physiological activity, in the bovine reproductive tract. Since the cervix is a prostaglandin E1 (PGE1)- and PGE2-sensitive tissue and responds to hormonal stimulation, we also determined whether FSH could increase cervical cyclooxygenase expression and production of PGE2 in vitro, particularly at the time near estrus.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals

Cervical and ovarian tissues were collected from Holstein cows at a local abattoir. The stage of the cycle was determined according to signs of ovulation and the status of corpora lutea (CL; weight, color). These parameters allowed the classification of the cervix into three groups: 1) pre-estrous/estrous (follicular, 18–20 days postovulation; regressed CL < 1.0 g; presence of cervical mucus; n = 54); 2) postovulatory (1–4 days postovulation; presence of corpora hemorrhagica; signs of follicular rupture; n = 35), and 3) luteal (12–16 days postovulation; CL 4–6 g; n = 44). Bovine granulosa cells were collected from pre-estrous/estrous follicles and used as a positive control for FSHR expression [7].

The cervix external os segment was taken as the initial 3 cm of the cervix (total length of cervix is about 9 cm). The cervical os segments, primarily luminally oriented muscularis with epithelium, were sliced into horizontal strips (1 cm in length), pooled, and minced finely with a scalpel. The Kimron Veterinary Institute Animal Care and Use Committee approved all procedures.

FSHR Gene Expression

RNA isolation Bovine cervical or ovarian tissues were rapidly dissected and frozen in liquid nitrogen (within 20 min after slaughter). Total RNA was extracted using the acid phenol, guanidine thiocyanate technique [8], using TriReagent (Molecular Research Center, Inc., Cincinnati, OH) according to the manufacturer's instructions.

Reverse transcription (RT)-polymerase chain reaction (PCR) Bovine FSHR mRNA was detected as previously described for the LH receptor mRNA [5]. Oligonucleotides corresponding to the published sequence of the bovine FSHR [7] were synthesized and used as primers in a PCR reaction. Bovine ovarian and cervical tissue cDNA obtained by RT of 2 µg RNA was used as a template in the PCR reaction using a pair of primers corresponding to the transmembrane segments of the FSHR. The primers, 20-mer each, were selected using the OLIGO Program (Oligo R1 primer analysis software; National Biosciences, Plymouth, MN). The forward primer corresponded to position 1399–1419 (5'CGGCTTTTTCACTGTCTTTG3') on the bovine FSHR mRNA [7]. The reverse primer was a 20-mer oligonucleotide complementary to position 1763–1783 (5'CGCTTGGCTATCTTGGTGTC3'). The predicted size of the RT-PCR product was 384 basepairs (bp). Four microliters of the RT reaction were used as a template for PCR; the reaction was allowed to proceed 35 cycles using 2 U Termus Aquaticus DNA polymerase (recombinant) provided by MBI Fermentas, Vilnius, Lithuania, and 200 pmol of each primer. The cycling parameters of the PCR were 98°C for 20 sec, 56°C for 45 sec, and 72°C for 45 sec. After amplification the samples were separated on a 1% agarose gel, stained with ethidium bromide, and photographed under UV light. The 384-bp fragment was extracted using the Wizard PCR Preps Kit (Promega, Madison, WI) and sequenced with the upper primer using an automatic sequencer (Applied Biosystems, Foster City, CA). For internal control, a bovine ß-actin fragment of 890 bp was produced from an upper primer (5'ACCAACTGGGACGACATGGAG3'; 21 mer) and a lower primer (5'GCATTTGCGGTGGACAATGGA3'; 21 mer) as previously described [5]. Each PCR amplification was standardized using ovarian granulosa cDNA to produce a specific band of the predicted size. Standardization was based on temperature, cycle number, Mg level, and pH.

Western Blots

Cervical, bovine seminal vesicle, or muscle minces were sonicated for 45 sec, lysed in 500 µl lysing buffer (1% Nonidet-40 [Sigma, St. Louis, MO], 2 mM EGTA, 5 nM MgCl2, 1 mM PMSF in PBS) and incubated for 2 h at 4°C. After centrifugation, aliquots were taken for protein determination using gamma globulin (Sigma) as reference standard [9] and a protein dye binding method (Bio-Rad Laboratories, Richmond, CA). Sixty micrograms of protein of the soluble tissue extract was then separated by electrophoresis on 5–9%-gradient SDS-PAGE and electroblotted onto nitrocellulose paper (Amersham, Little Chalfont, Bucks, UK) as described previously [9]. The nitrocellulose membrane was washed with PBS containing 0.05% TWEEN-20 and blocked with 10% horse serum (Kimron Veterinary Institute) in washing solution. The nitrocellulose membrane was then treated with either 1) an anti-peptide antibody (code name 179) raised against human (h) FSHR peptide 265–295, diluted 1:500 (donation of Dr. J.A. Dias, Wadsworth Center, New York State Department of Health); 2) rabbit antiserum for bovine G protein ({alpha}s) diluted 1:1000; UBI, Lake Placid, NY); or 3) rabbit anti-bovine cyclooxygenase polyclonal antiserum (diluted 1:200; Kimron Veterinary Institute) [9]. Different dilutions were used for each antibody, and the final dilution used was 75% of the dilution, which gave a maximal signal as previously described [9]. The nitrocellulose paper was then incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG (Sigma Israel, Rehovot, Israel; diluted 1:2000 in washing buffer) for 1 h at room temperature. The presence of FSHR, G protein ({alpha}s), or cyclooxygenase was then visualized by means of a color reaction as follows. The nitrocellulose paper was incubated in a substrate solution containing 3'3'-diaminobenzidine (0.5 mg/ml; Sigma) in a mixture of PBS containing 0.5% CaCl2 and 6% H2O2. The antibody to hFSHR recognized the 75-kDa protein of the FSHR. The antibody to G ({alpha}s) recognized both the 42-kDa and 87-kDa forms of this protein, and the antibody to cyclooxygenase recognized the 72-kDa form (cyclooxygenase II). Extract of bovine seminal vesicles that are known to have a high content of cyclooxygenase was used as positive control as previously described [9]. The densitometric scans were obtained using a bio-imaging system (B.I.S. 2020; Rhenium Dingo, Jerusalem, Israel) and processed with Tina 2.0 software (Fuji, Japan). Linearity of detection [9] was determined for densitometry for both Western and Northern blots. Each Western blot was evaluated in the absence of the first antibody, and no signal was detected.

Northern Blot Analysis

For Northern blots, 10 µg of total RNA was denatured in 20 µl 50% formamide/2.2 M formaldehyde in single-strength 3-(n-morpholino) propanesulfonic acid (MOPS) buffer (0.04 M MOPS, 10 mM sodium acetate, 1 mM EDTA) at 65°C for 10 min. Samples were placed on ice, and 5 µl of loading buffer (0.5% SDS, 0.25% bromophenol blue, 25% glycerol, 25 mM EDTA) was added. Samples were subjected to electrophoresis through a 1.2% agarose formaldehyde gel and transferred by capillary blotting to nylon membranes (Nytran; Schleicher and Schuell, Keene, NH). RNA was subsequently UV cross-linked to membranes. The RT-PCR product fragments of 384 bp for FSHR and 890 bp for ß-actin were used to generate biotinylated probes using random primer biotin labeling of DNA for chemiluminescence (NEBlot phototype kit; Biolabs, Beverly, MA) according to the manufacturer's instructions. The blotted membrane was prehybridized at 65°C for 1 h in prehybridization solution (6-strength SSC [3 M NaCl, 0.3 M sodium citrate], 5-strength Denhardt's reagent [ 1% ficoll, 1% polyvinylpyrrolidone, 1% BSA], 0.5% SDS, and 100 µg/ml denatured salmon sperm DNAs) and hybridized overnight in the same solution with the denatured biotinylated probe to the target RNA. The membrane was then washed in double-strength SSC, 0.1% SDS at room temperature for 10 min and washed again in 0.1-strength SSC, 0.1% SDS at 68°C for 15 min followed by subsequent chemiluminescence, development, and detection on x-ray film (RX; Fuji Film, Tokyo, Japan). To obtain quantitative data for the specific mRNA, we used the densimetric value for ß-actin mRNA to normalize each specific mRNA value. To remove FSHR probe, membranes were stripped using water for 15 min, then incubated in 0.4 M NaOH, 0.1% SDS at 80°C for 30 min. The membrane was rinsed again in 0.2 M Tris-HCl, 0.1-strength SSC for 30 min at 25°C. After stripping, prehybridization and hybridization with ß-actin probe were performed as described for FSHR mRNA.

Cyclic AMP Determinations

Cervical tissue minces (50 mg/ml) were incubated for 10 min in wells of 1.5 ml containing 1.0 ml of Tissue Culture Medium-199 (TCM-199 without serum (Biological Industries, Beit Haemek, Israel) in the absence or presence of physiological (5, 10 ng/ml) and pharmacological doses (20, 40 ng/ml) of FSH (USDA-bFSH-8-1; no further increase in cAMP production was seen at 50 or 100 ng/ml) or forskolin, a stimulator of adenylate cyclase (10 µM; Sigma). The dose of forskolin was selected to give a 3-fold increase in cAMP. At the end of the incubation, tissues were removed, blotted on filter paper to remove mucus, and incubated overnight at 4°C with 400 µl of 3% HClO4. The solution was then neutralized with 150 µl of KHCO3 and centrifuged, and 50-µl aliquots were taken for the radioreceptor assay as described by Brown et al. [10] and modified for endometrium by Miyazaki et al. [11]. Standards (0–1000 pg of cAMP) or samples were incubated at room temperature with 100 µl of cAMP binding protein prepared from bovine adrenal extracts as described [10]. The buffer used for the assay was added to form a final reaction volume of 400 µl. After 2-h incubation in a cold room, the reaction was stopped by adding 300 µl of a charcoal-dextran solution; centrifugation followed, and the supernatant was removed for counting in a scintillation counter. The sensitivity of the assay was 60 pg/tube. Quadruplicate assays were made for each value determined. The within-assay and between-assay coefficients of variance were 8% and 10%, respectively.

Measurement of Phospholipase C (PLC) Activity

Cervical minces (30 mg) were incubated in 1 ml TCM-199 containing 5 mCi [3H]myo-inositol for 90 min. Slices were rinsed with 1 ml TCM-199 and incubated for another 60 min to remove unincorporated [3H]myo-inositol. At the end of the preincubations, slices were incubated in 1 ml TCM-199 containing 10 mM LiCl to inhibit inositol phosphate (IP) hydrolysis, allowing 3H-IP, 3H-IP2, and 3H-IP3 to accumulate in the tissue after stimulation of PLC, in absence or presence of 0–20 ng/ml of FSH or 0–20 ng/ml LH (USDA bLH-I-1). Incubations were terminated by adding 2 ml ice-cold chloroform/methanol/hydrochloric acid (5:10:0.1, v:v:v) and then 1 ml chloroform and 1 ml EDTA (5 mM) and extracted as described by Kisielewska et al. [12]. 3H-IP, 3H-IP2, and 3H-IP3 were separated from the labeled inositol compounds by using Dowex AG 1-X8 (formate form). 3H-Labeled IP was eluted from the column by sequential elution into 10 fractions. Aliquots of each fraction were added to scintillation vials containing 5 ml scintillation fluid, and radioactivity was determined using a scintillation counter. Total activity of PLC is expressed as cpm of total IPs/30 mg/30 min.

RIA for PGE2 and PGF2{alpha}

Aliquots of 100 µl were taken at the end of the incubation period for specific RIA of PGE2 and PGF2{alpha}, which were performed without chromatographic separation. The antisera for PGF2{alpha} (Sigma) reacts preferentially with PGF2{alpha} but cross-reacts with PGF1{alpha} (60%) and to a negligible extent (< 0.1%) with prostaglandins of the A, B, and E series. The antisera to PGE2 (Sigma Israel) reacts preferentially with PGE2 but cross-reacts with PGE1 (20%), PGA1, PGA2, PGF1{alpha}, and PGF2{alpha} (< 10%) and to a negligible extent with PGB1 and PGB2 (< 0.1%). The intraassay coefficients of variation were 9% and 11%, and the interassay coefficients of variance were 12.3% and 13% for PGF2{alpha} and PGE2.

Statistical Analysis

ANOVA was performed with a significance level of p < 0.05. Data were further analyzed using Tukey's procedure (p < 0.05 or p < 0.01) to assess significance between treatments. Student's t-test was used where appropriate. Values are expressed as means ± SEM.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
FSHR mRNA Expression in the Cervix

RT-PCR demonstrated that the FSHR gene is expressed in bovine cervix as indicated by the presence of the 384-bp fragment corresponding to bFSHR mRNA. The mRNA was maximally expressed in the cervix during the pre-estrous/estrous phase. In contrast, the expression of the gene was reduced in postovulation cervix and not detectable in luteal-phase cervix (Fig. 1). However, reamplification of the PCR product, cDNA, from the luteal phase produced a detectable signal (Fig. 1).



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 1. RT-PCR amplification of bovine cervix FSHR and ß-actin mRNA. RT-PCR was performed as described in Materials and Methods for FSHR and ß-actin. Separate RT-PCR amplification products of FSHR (estimated 384 bp) and ß-actin (estimated 890 bp) were combined and separated on agarose gel electrophoresis and stained with ethidium bromide. RT-PCR was performed using 2 µg RNA of bovine granulosa cells as a positive control (lane 1), cervical tissue at the pre-estrous/estrous (lanes 3–4), postovulatory (lanes 5–6), and luteal phases (lanes 7–8). Lanes 9–10 represent reamplification, using as template the PCR product, cDNA, from the luteal-phase amplification. Lane 2 represents negative control in the absence of RNA. The tissue was taken from 4 cows at each stage of the estrous cycle, and two representative samples from each stage are shown. SM, size markers.

To demonstrate that the absence of FSHR mRNA in luteal-phase cervix was specific, bovine ß-actin mRNA was used as internal control. PCR demonstrated that the specific 890 bp of the ß-actin cDNA band was produced by the cervical tissues of all the stages. The band for ß-actin was present even though the 384-bp band corresponding to the FSHR was absent (Fig. 1).

The nucleotide sequence (Fig. 2) of the 384-bp fragment obtained from pre-estrous/estrous cervix was compared with that for the Bos taurus FSHR reported by Houde et al. [7]. It was found that there was a 97.5% homology between the 384-bp fragment and the nucleotide range 1410–1763 found in the Bos taurus FSHR.



View larger version (49K):
[in this window]
[in a new window]
 
FIG. 2. Automated nucleotide sequencing and homology between Bos taurus mRNA FSHR (GenBank accession number L22319) from nucleotides 1401 to 1763 and the PCR products obtained using the upper primer as described in Materials and Methods. A homology of 97.5% was found between Bos taurus and our amplified cDNA obtained by RT-PCR from cervical mRNA at pre-estrus/estrus, suggesting that they are complementary.

The Northern blot contained the expected three transcripts of 2.55, 3.3, and 3.8 kilobases (kb) present in the bovine granulosa. However, the high (6.8-kb) and low (1.6-kb) transcripts found in the ovary were not found in the cervix. The three transcripts were found in pre-estrous/estrous cervix, but only one transcript (2.55 kb) was seen in luteal cervix (1/8 of the pre-estrus/estrus level; n = 5) or postovulatory cervix (1/3 of the pre-estrus/estrus level; n = 5) (Fig. 3).



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 3. Northern blot for analysis of total RNA (10 µg) extracted from bovine cervical tissues collected from pre-estrous/estrous, postovulatory, and luteal-phase cows, and bovine granulosa cells as a positive control. Relative migration of 28S and 18S ribosomal RNA is indicated. To localize mRNA for FSHR and ß-actin, our RT-PCR products (384-bp and 890-bp fragments, respectively) were used to generate biotinylated probes using biotin random primer. Figure shows results for FSHR mRNA in bovine granulosa cells as a positive control (lane A); and in cervical tissues at pre-estrus/estrus (lanes B–C), postovulation, (lanes D–E) and the luteal phase (lanes F–G). The corresponding ß-actin band was obtained by reprobing of the membranes previously tested for FSHR mRNA as described in Materials and Methods. Columns show mean ± SEM of the optical density of the ratio FSHR:ß-actin, in which the luteal phase is given an arbitrary value of 1.0. *Significantly different from luteal-phase value (p < 0.01); n = 5 for each stage.

FSHR Protein in the Cervix

The presence of FSHR protein in the cervix was demonstrated as determined by Western blot analysis using a specific antipeptide antibody for hFSHR. The antibody recognized a 75-kDa protein in both bovine granulosa and cervical preparations identical with the predicted molecular size of FSHR. The signal for the 75-kDa protein was strongest in pre-estrous/estrous cervix when compared with postovulation- (3-fold) or luteal-phase (6-fold) cervix (Fig. 4). With the use of 60 µg protein in each lane, this protein was observed to be expressed throughout the estrous cycle.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 4. Presence of FSHR protein in cervical tissues as determined by Western blot. Soluble cell extracts (60 µg protein) were used to determine the amount of FSHR as described in Materials and Methods. Western blot proteins were transferred to nitrocellulose paper and probed with antiserum to peptide hFSHR, 265–296. Western blot displays a representative result for bovine granulosa cells, used as positive control (lane A); bovine seminal vesicles (lane B) and muscle, used as a negative control (lane C); and cervical tissues from three stages of the estrous cycle: pre-estrous/estrous (lane D), postovulatory (lane E), and luteal (lane F). Histogram summarizes the results for the three stages of the estrous cycle. Columns show mean ± SEM of the relative optical density in which the luteal phase is given an arbitrary value of 1.0. *Significantly different from luteal-phase value (p < 0.01); n = 7 for each stage.

In Vitro Effect of FSH on Induction of FSHRs

A time-course (0.75, 1.5, and 3 h) and dose-response (0, 10, and 20 ng/ml) study was carried out to determine in vitro effect of FSH on its own receptor. Cervical minces (100 mg) from cows in the pre-estrous/estrous, postovulatory, and luteal phases were used. It was found, as determined by Western blot, that FSH induced its own receptor in cervical tissues at pre-estrus/estrus, with a 3-fold increase (p < 0.01) observed at 10 ng/ml after 3 h of incubation (Fig. 5). However, no effect of FSH was seen at earlier times at the 10 ng/ml level. When 20 ng/ml was used, a stimulatory effect (2-fold) was seen after 1.5 h. No significant response was observed when tissues of the postovulatory or luteal phase were used at any dose or time tested (data not shown).



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 5. Effect of incubation of cervical tissues with FSH on the expression of the FSHR protein. Cervical tissue from 5 pre-estrous/estrous cows was incubated in the absence or presence of FSH (0 or 10 ng/ml). Western blot is representative for FSH protein concentration after 3 h of incubation, with granulosa cell extract serving as positive control. Lane A, Granulosa cells (GC); lane B, cervical tissue at Time 0; lane C, cervical tissue after 3 h of incubation in TCM-199; lane D, cervical tissue after 3 h of incubation with 10 ng/ml of FSH. Lane E represents muscle tissue incubated with FSH (10 ng/ml) for 3 h as a negative control. Histogram summarizes the results of six experiments. Columns are means ± SEM. *Significantly different (p < 0.01) from the column representing the control at 3 h (a given value of 1).

Effect of FSH Treatment on G Protein ({alpha}s)

A time-course and dose-response study was carried out to determine whether cervical FSHR was coupled to G protein. Cervical minces (100 mg) from cows in the pre-estrous/estrous, postovulatory, and luteal phases were incubated in the presence of FSH (0–20 ng/ml) for 0.75, 1.5, and 3 h. It was found in pre-estrous/estrous cervical tissue that, in the presence of FSH (10 ng/ml), there was a significantly (p < 0.05) higher level of G protein ({alpha}s) at the level of both the 87-kDa ({alpha}, ß, {gamma} complex) and the 42-kDa ({alpha}s) proteins after 3 h of incubation (Fig. 6). FSH, at either 10 or 20 ng/ml, did not have a stabilizing effect on the level of G protein ({alpha}s) at shorter times of incubation (0.75 or 1.5 h). No significant response was observed when tissues of the postovulatory or luteal phase were used at any dose or time tested (data not shown).



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 6. Effect of incubation of cervical tissues with FSH on the synthesis of G protein. Cervical tissues from 5 pre-estrous/estrous cows were incubated in the absence or presence of FSH (10 ng/ml). Both the 87-kDa G protein ({alpha}, ß, {gamma} complex) and 42-kDa protein ({alpha}s) are elevated at 3 h of incubation. Granulosa cell extract was used as a positive control. Lane A, Granulosa cells (GC); lane B, cervical tissue at Time 0; lane C, cervical tissue after 3 h of incubation in TCM-199; lane D, cervical tissue after 3 h of incubation with 10 ng/ml of FSH. Columns are means ± SEM of 42-kDa protein. *Significantly different (p < 0.05) from the column representing the control at 3 h (with an arbitrary value of 1.0).

IP Pathway Activation by FSH

For IP measurement, cervical tissue minces (30 mg) from pre-estrous/estrous, postovulatory, and luteal-phase cows were incubated for 30 min in the absence or presence of FSH (10 ng/ml) or LH (10 ng/ml). FSH significantly (p < 0.01) increased the level of IP, IP2, and IP3 at pre-estrus/estrus. However, FSH significantly (p < 0.05) inhibited IP level in the postovulatory stage. In contrast, LH, but not FSH, stimulated IPs significantly (p < 0.01) at the luteal phase (Fig. 7).



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 7. Effect of FSH on IP production in cervical tissue. Cervical tissues from six cows at each of three stages of the cycle were incubated for 30 min in the absence or presence of FSH (10 ng/ml) or LH (ng/ml). IPs produced were determined in four replicates by amount of labeled compound (cpm) produced. Columns are means ± SEM (*p < 0.05; **p < 0.01; significantly different from control value for each stage of the cycle).

Adenylate Cyclase Activation by FSH

A dose-response analysis was used to determine whether the cervical FSHR was coupled to adenylate cyclase. In these experiments, cervical tissue minces (50 mg) obtained from pre-estrous/estrous, postovulatory, and luteal-phase cows were incubated with FSH (0–40 ng/ml). FSH increased cAMP accumulation in a dose-dependent manner when incubated with pre-estrous/estrous cervical tissues, with maximal stimulation 2.5 times (p < 0.01) that of control in the presence of 10 ng/ml (Fig. 8A). In contrast, cervical tissue from luteal or postovulation did not respond to FSH even though tissues from all phases of the cycle responded to forskolin with a significant (p < 0.01) increase in cAMP (Fig. 8B).



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 8. Effect of FSH on adenylate cyclase production in cervical tissue. A) Cervical tissues from six cows at pre-estrus/estrus were incubated (4 replicates) for 10 min in the absence or presence of FSH (0, 5, 10, 20, or 40 ng/ml) or forskolin (10 µmol/L), and the amount of cAMP produced was measured by a protein binding assay. B) Cervical tissues from six cows at each of the three stages of the estrous cycle were incubated (4 replicates) for 10 min in the absence or presence of FSH (10 ng/ml) or forskolin (10 µM). The amount of cAMP produced was measured by a protein binding assay. Columns are means ± SEM. Columns with asterisks were statistically different from their own control (*p < 0.01; **p < 0.05).

Effect of FSH on PGE Production by Cervical Tissues

A dose-response analysis was carried out to determine whether FSHR was associated with cervical prostaglandin production. PGE2 and PGF2{alpha} production by cervical minces (100 mg/ml) in the presence of FSH (0–20 ng/ml) was determined by RIA. FSH stimulated (p < 0.01) basal PGE2 production in a dose-dependent manner and caused a 3-fold increase in PGE2 production at 10 ng/ml in pre-estrous/estrous cervical tissues (n = 8, Fig. 9). FSH had no effect on the small amount of basal PGF2{alpha} (< 1 ng/100 mg) produced by cervical tissue (data not shown). FSH did not elevate PGE2 in cervical tissues from the luteal phase; furthermore, a small but significant (p < 0.05) inhibition was observed at postovulation (Fig. 9).



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 9. FSH dose response on production of PGE2 by cervical tissues. Cervical tissues from 8 pre-estrous/estrous, postovulatory, or luteal-phase cows were incubated in the absence or presence of FSH (5, 10, or 20 ng/ml) for 6 h, and the effect on the production of PGE2 was measured by RIA. *p < 0.01; **p < 0.05.

Cyclooxygenase Activation by FSH

To determine whether the presence of FSHR was associated with the expression of cyclooxygenase, cervical minces were incubated for 3 h in the presence or absence of FSH (10 ng/ml). Tissues from pre-estrous/estrous, postovulatory, and luteal-phase cows were extracted, separated on SDS-PAGE, and tested for the cyclooxygenase II (72 kDa) using a specific antibody. It was found that in cervical tissues from six pre-estrous/estrous cows, FSH induced a 200% increase in the expression of cyclooxygenase after 3 h of incubation (Fig. 10). In contrast, no effect on cyclooxygenase expression was seen in cervical tissues from luteal-phase cows, and an insignificant (p > 0.05) elevation at the postovulatory phase was observed (data not shown).



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 10. Effect of incubation of cervical tissues with FSH on the expression of cyclooxygenase. Cervical tissues from 5 pre-estrous/estrous cows were incubated in the absence or presence of FSH (10 ng/ml). The 72-kDa cyclooxygenase II protein was elevated at 3 h of incubation. Lane A, bovine granulosa cells (GC); lane B, cervical tissue at Time 0; lane C, cervical tissue after 3 h of incubation in TCM-199; lane D, cervical tissue after 3 h of incubation with 10 ng/ml of FSH. Columns are means ± SEM of 72-kDa protein. *Significantly different (p < 0.01) from the column representing the control at 3 h (with an arbitrary value of 1.0).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Results of this study demonstrate by both PCR amplification and Northern blot analysis that FSHR mRNA is present in the bovine cervix. The bands corresponding to the receptor (75 kDa) and its mRNA were maximally expressed during the pre-estrous/estrous phase. Incubation of cervical tissues with FSH increased the expression of cyclooxygenase and the production of PGE2 (and possibly PGE1) at the pre-estrous/estrous phase. The stimulation of cervical cyclooxygenase was associated with activation of both the PLC and adenylate cyclase second messenger G-protein related pathways.

Northern blot analysis of bovine cervical tissues from pre-estrous/estrous cows revealed multiple transcripts for bovine cervical FSHR. The sizes of the major transcripts were 2.5 kb, 3.3 kb, and 3.8 kb, which were similar to those obtained in bovine granulosa cells [7], rat testis and ovary [13, 14], and human ovary [15] and myometrium [16]. Other minor transcripts have been reported in all of these species. The RT-PCR product yielded a single band of 384 bp, which was the expected molecular size, so the different isoforms of the FSHR are probably the result of differential splicing of the same transcript. Isoforms of FSHR have been characterized in human [17] and primate [18] ovary and in ovine testis [19]. Since only a single 2.5-kb isomer was present in luteal-phase cervix (which did weakly produce FSHR), it would appear that there are different isoforms present in the bovine cervix as well.

The nucleotide sequence homology between our RT-PCR 384-bp product was 97.3% identical to the comparable region of the bovine FSHR, showing that our amplified cDNA was complementary to the Bos taurus mRNA FSHR. The PCR product of 384-bp cDNA was found primarily in the pre-estrous/estrous cervix.

Using specific antibody raised in rabbits against hFSHR (amino acid sequence 265–296) for Western blot analysis resulted in a major signal for a 75-kDa protein. A protein of similar molecular mass has been reported in rat and human ovary [20]. A strong signal for this protein was seen in the pre-estrous/estrous cervix compared with cervix from the other stages of the cycle. This cervical receptor was regulated by FSH itself, similar to the regulation of the FSHR in the rat ovary [14].

FSH increased cAMP production by cervical tissue from the pre-estrous/estrous phase but did not elevate cAMP in the postovulatory and luteal phases. FSH elevation of IPs displayed the same pattern. It would therefore appear that the cervical FSHR is associated with signal transduction pathways in a way similar to the accepted mechanism of LH action in the ovary and testes, i.e., activation of the second messenger pathways—adenylate cyclase [21] and phosphatidyl-inositol (PLC) [22, 23]. The inhibitory effect of FSH on IPs and cAMP at postovulation occur when FSHR is low. Since FSH activity is biphasic, i.e., is stimulated by a low dose and inhibited by a high dose, an inhibitory effect at low concentrations could be the result of the change in the ligand-receptor ratio.

FSH induced about a 200% increase in the expression of cyclooxygenase at pre-estrus/estrus but had no effect on the two other stages of the cycle. This was similar to the response of cyclooxygenase to LH that was observed for the bovine endometrium [2] and uterine vein [6]. However, in the endometrium, LH increased cyclooxygenase during both the luteal and postovulatory phases but not at estrus [2]. Furthermore, the induction of cyclooxygenase by gonadotropin in the endometrium was associated with an increased level of PGF2{alpha}, while in the cervix PGE2 was the major product.

The bFSH was of immunological grade and devoid of residual biological contamination of LH, thyroid-stimulating hormone, growth hormone, prolactin, or ACTH. The effects on increasing cAMP, PGE2, and cyclooxygenase as well as induction of FSHR were therefore specific. Furthermore, it was found that highly purified hFSH (10–20 ng/ml) (donation of J.A. Dias) had the same effects as bFSH when incubated with cervical tissue under the same conditions (2.5-fold increase in cAMP; 3-fold increase in PGE2; 2-fold increase in cyclooxygenase).

The relaxation and opening of the gravid cervix is due to active biochemical and structural changes in the cervical connective tissue that are mediated in part by prostaglandins [24]. It is thought that stretching of the cervix is a factor in causing the release of these prostaglandins [25, 26]. The effect of PGE in causing cervical softening in the ewe is also well documented [2729]. In both nonpregnant and pregnant cows, PGE2 causes an increase in cervical opening within 3 h of treatment [30]. PGE1 administered intra-cervically in a jelly was shown to decrease cervical resistance within 24 h [31].

Recently, we reported [6] that oxytocin caused a significant stimulation of PGE2 production in vitro in cervical tissues from pre-estrous/estrous cows but had no effect on PGE2 production in cervical tissue from other stages of the estrous cycle of the cow. Similarly, in an initial report [31], it was shown that administration of oxytocin to pre-estrous cows increased the concentration of PGE2 in the cervical exudate. However, peripheral oxytocin concentrations during estrus are lower than during the luteal phase [32, 33], and elevations of both peripheral oxytocin and cervical oxytocin receptor concentration are necessary for oxytocin to cause cervical softening towards parturition [24]. Furthermore, progesterone in vitro induced a dose-dependent inhibition of PGE2 release by cervical tissues from pre-estrous/estrous cows, and this was associated with a decrease in both basal and oxytocin-stimulated PGE2 production [6]. It would therefore seem that hormones other than oxytocin are responsible for the increase in cervical PGE2 in the pre-estrous/estrous cow. The present report indicates that FSH, which has its peak peripheral concentration at the time of estrus, could be the hormone that increases cervical PGE2, as the FSHR expression is maximal at this time and FSH in vitro increases PGE2 production by the cervix.

The bovine cervix at pre-estrus/estrus has high levels of FSHR protein and its corresponding mRNA. Activation of the receptor by FSH is associated with the G-protein-coupled receptor family that mediates the cAMP and IP signalling pathways. These signalling pathways then increase the expression of cyclooxygenase and production of PGE2. The expression of the FSHR was maximal at the time of the FSH peak in the blood and suggests a physiological role for FSH in the relaxation and opening of the cervix at estrus.


    ACKNOWLEDGMENTS
 
We thank Dr. J.A. Dias, Wadsworth Center, New York State Department of Health, for his donation of the anti-peptide antibody raised against hFSHR peptide 265–295 and purified hFSH; and the USDA Animal Hormone Program and NHPP for the bFSH and bLH.


    FOOTNOTES
 
1 This work was supported by grant No. US-2333-93 from the US-Israel Binational Agricultural Research and Development Fund (BARD). This work is in partial fulfillment of a Ph.D. Thesis (D.M.) to be submitted to the Hadassah Medical School, Hebrew University. Back

2 Correspondence: M. Shemesh, Department of Hormone Research, Kimron Veterinary Institute, Bet Dagan, POB 12, Israel 50250. FAX: 972 3 9681753; mshem{at}vs.moag.gov.il Back

Accepted: April 26, 1999.

Received: November 16, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Dias JA, Lindau-Shepard B, Hauer C, Auger I. Human follicle-stimulating hormone structure-activity relationships. Biol Reprod 1998; 58:1331–1336.[Free Full Text]
  2. Freidman S, Gurevich M, Shemesh M. Bovine cyclic endometrium contains affinity luteinizing hormone/human chorionic gonadotropin. Biol Reprod 1995; 52:1020–1026.[Abstract]
  3. Ziecik AJ, Stanchev PD, Tilton JE. Evidence for the presence of luteinizing hormone/human chorionic gonadotropin-binding sites in the porcine uterus. Endocrinology 1986; 119:1159–1163.[Abstract]
  4. Reshef E, Lei ZM, Rao ChV, Pridham DD, Chegini N, Luborsky JL. The presence of gonadotropin receptors in nonpregnant human uterus, human placenta, fetal membranes, and decidua. J Clin Endocrinol Metab 1990; 70:421–430.[Abstract]
  5. Shemesh M, Gurevich M, Mizrachi D, Dombrovski L, Stram Y, Fields MJ, Shore LS. Expression of functional luteinizing hormone receptor and its mRNA in bovine uterine veins; luteinizing hormone induction of cyclooxygenase and augmentation of prostaglandin production in bovine uterine veins. Endocrinology 1997; 138:4844–4851.[Abstract/Free Full Text]
  6. Shemesh M, Dombrovski L, Gurevich M, Friedman S, Shore LS, Fuchs AR, Fields MF. Regulation of bovine cervical secretion of prostaglandins and synthesis of cyclooxygenase by oxytocin. Reprod Fertil Dev 1997; 9:525–530.[CrossRef][Medline]
  7. Houde A, Lambert A, Saumande J, Silversides DW, Lussier JG. Structure of bovine follicle-stimulating hormone receptor complementary DNA and expression in bovine tissues. Mol Reprod Dev 1994; 39:127–135.[CrossRef][Medline]
  8. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162:156–159.[Medline]
  9. Izhar M, Pasmanik M, Marcus S, Shemesh M. Dexamethasone inhibition of cyclooxygenase expression in bovine term placenta. Prostaglandins 1992; 43:239–254.[CrossRef][Medline]
  10. Brown BL, Albano JDM, Ekins RP, Sgherzi AM, Tampion W. A simple and sensitive saturation assay method for measurement of adenosine 3':5'-cyclic monophosphate. Biochem J 1971; 121:561–562.[Medline]
  11. Miyazaki K, Tanaka N, Kawakami S, Okamura H. Adenylyl cyclase activity in human decidua and myometrium during pregnancy and labour. J Reprod Fertil 1995; 105:141–145.[Abstract]
  12. Kisielewska J, Flint APF, Ziecik AJ. Phospholipase C and adenylate cyclase signalling systems in the action of hCG on porcine myometrial smooth muscle cells. J Endocrinol 1996; 148:175–180.[Abstract]
  13. Heckert LL, Griswold MD. Expression of follicle-stimulating hormone receptor mRNA in rat testes and sertoli cells. Mol Endocrinol 1991; 5:670–677.[Abstract]
  14. LaPolt PS, Tilly JL, Aihara T, Nishimori K, Hsueh AJW. Gonadotropin-induced up-and-down-regulation of ovarian follicle-stimulating hormone (FSH) receptor gene expression in immature rats: effects of pregnant mare's gonadotropin, human chorionic gonadotropin, and recombinant FSH. Endocrinology 1992; 130:1289–1295.[Abstract]
  15. Tilly JL, Aihara T, Nishimori K Jia X-C, Billig H, Kowalski KI, Perlas EA, Hsueh AJW. Expression of recombinant human follicle-stimulating hormone receptor: species-specific ligand binding, signal transduction, and identification of multiple ovarian messenger ribonucleic acid transcripts. Endocrinology 1992; 1131:799–806.
  16. Kornyei JL, Li X, Lei ZM, Rao ChV. Restoration of human chorionic gonadotropin response in human myometrial smooth muscle cells by treatment with follicle-stimulating hormone (FSH): evidence for the presence of FSH receptors in human myometrium. Eur J Endocrinol 1996; 134:225–231.[Abstract]
  17. Gromell J, Gutermann T, Nieschlag E. Molecular cloning of truncated isoform of the human follicle stimulating hormone receptor. Biochem Biophys Res Commun 1992; 188:1077–1083.[CrossRef][Medline]
  18. Gromell J, Dankbar B, Sharma RS, Nieschlag E. Molecular cloning of the testicular follicle stimulating hormone receptor of the nonhuman primate Macaca fascicularis and identification of multiple transcripts in the testes. Biochem Biophys Res Commun 1993; 19:1066–1072.
  19. Khan H, Yarney TA, Sairam MR. Cloning of alternately spliced mRNA transcripts coding for variants of ovine testicular follitropin receptor lacking the G protein coupling domains. Biochem Biophys Res Commun 1993; 190:888–894.[CrossRef][Medline]
  20. Liu X, DePasquale JA, Griswold MD, Dias JA. Accessibility of rat and human follitropin receptor primary sequence (R265-S296) in situ. Endocrinology 1994; 135:682–691.[Abstract]
  21. Marsh JM. The role of cyclic AMP in gonadal function. In: Greengard P, Robinson GA (eds.), Cyclic Nucleotide Research. Vol. 6. New York: Raven Press; 1975: 137–199.
  22. Davis JS. Stimulation of intracellular free Ca2+ by luteinizing hormone in isolated bovine luteal cells. Adv Exp Med Biol 1987; 219:671–675.[Medline]
  23. Davis RJ. The mitogen-activated protein kinase signal transduction pathway. J Biol Chem 1993; 268:14553–14556.[Free Full Text]
  24. Fuchs A-R, Goeschen J, Rasmussen AB, Rehnström JV. Cervical ripening by endocervical and extra-amniotic PGE2. Prostaglandins 1984; 28:217–227.[CrossRef][Medline]
  25. Ellwood DA, Mitchell MD, Anderson ABM, Turnbull AC. Specific changes in the in vitro production of prostanoids by the ovine cervix at parturition. Prostaglandins 1980; 39:675–684.
  26. Hiller K, Coad N. Synthesis of prostaglandins by the human uterine cervix in vitro during passive mechanical stretch. J Pharm Pharmacol 1982; 34:262–263.[Medline]
  27. Stys SJ, Dresser BL, Ott TE, Clark KE. Effects of prostaglandin E2 on cervical compliance in pregnant ewes. Am J Obstet Gynecol 1981; 140:415–419.[Medline]
  28. Ledger WL, Ellwood DA, Taylor MJ. Cervical softening in late pregnant sheep by infusion of prostaglandin E2 into cervical artery. J Reprod Fertil 1983; 69:511–515.[Abstract]
  29. Khalifa RME, Sayre BL, Lewis GS. Exogenous oxytocin dilates the cervix in the ewes. J Anim Sci 1992; 70:38–42.[Abstract]
  30. Duchens M, Fredriksson G, Kindahl H, Aiumlamai S. Effect of intracervical administration of a prostaglandin E2 gel in pregnant and non-pregnant heifers. Vet Rec 1993; 133:546–549.[Abstract]
  31. Graddy L, Fields M, Kowalski A, Chang S-M, Fuchs A-R. Effects of oxytocin and PGE1 on bovine cervix at estrus. Biol Reprod 1998; 58(suppl 1):174 (abstract 327).
  32. Schams D. Oxytocin determination by radioimmunoassay. III. Improvement to subpicogram sensitivity and application to blood levels in cyclic cattle. Acta Endocrinol 1983; 103:180–183.
  33. Ohtani M, Kobayashi S-I, Miyamoto A, Hayashi K, Yutaka F. Real-time relationships between intraluteal and plasma concentrations of endothelin, oxytocin and progesterone during prostaglandin F2{alpha}-induced luteolysis in the cow. Biol Reprod 1998; 58:103–108.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mizrachi, D.
Right arrow Articles by Shemesh, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mizrachi, D.
Right arrow Articles by Shemesh, M.
Agricola
Right arrow Articles by Mizrachi, D.
Right arrow Articles by Shemesh, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS