|
|
||||||||
Articles |
a Department of Hormone Research, Kimron Veterinary Institute, Bet Dagan, Israel 50250
| ABSTRACT |
|---|
|
|
|---|
s) and cyclooxygenase II. FSH (520 ng/ml) significantly increased (p < 0.01) cAMP, inositol phosphate (p < 0.01), and PGE2 (p < 0.01) production by pre-estrous/estrous cervix but not by cervix at the other stages. We conclude that bovine cervix at the time of the peripheral plasma FSH peak (pre-estrus/estrus) contains high levels of FSHR and responds to FSH by increasing the PGE2 production responsible for cervical relaxation at estrus.
| INTRODUCTION |
|---|
|
|
|---|
The present investigation was therefore conducted to determine the presence of FSHR and its mRNA, and its physiological activity, in the bovine reproductive tract. Since the cervix is a prostaglandin E1 (PGE1)- and PGE2-sensitive tissue and responds to hormonal stimulation, we also determined whether FSH could increase cervical cyclooxygenase expression and production of PGE2 in vitro, particularly at the time near estrus.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cervical and ovarian tissues were collected from Holstein cows at a local abattoir. The stage of the cycle was determined according to signs of ovulation and the status of corpora lutea (CL; weight, color). These parameters allowed the classification of the cervix into three groups: 1) pre-estrous/estrous (follicular, 1820 days postovulation; regressed CL < 1.0 g; presence of cervical mucus; n = 54); 2) postovulatory (14 days postovulation; presence of corpora hemorrhagica; signs of follicular rupture; n = 35), and 3) luteal (1216 days postovulation; CL 46 g; n = 44). Bovine granulosa cells were collected from pre-estrous/estrous follicles and used as a positive control for FSHR expression [7].
The cervix external os segment was taken as the initial 3 cm of the cervix (total length of cervix is about 9 cm). The cervical os segments, primarily luminally oriented muscularis with epithelium, were sliced into horizontal strips (1 cm in length), pooled, and minced finely with a scalpel. The Kimron Veterinary Institute Animal Care and Use Committee approved all procedures.
FSHR Gene Expression
RNA isolation Bovine cervical or ovarian tissues were rapidly dissected and frozen in liquid nitrogen (within 20 min after slaughter). Total RNA was extracted using the acid phenol, guanidine thiocyanate technique [8], using TriReagent (Molecular Research Center, Inc., Cincinnati, OH) according to the manufacturer's instructions.
Reverse transcription (RT)-polymerase chain reaction (PCR) Bovine FSHR mRNA was detected as previously described for the LH receptor mRNA [5]. Oligonucleotides corresponding to the published sequence of the bovine FSHR [7] were synthesized and used as primers in a PCR reaction. Bovine ovarian and cervical tissue cDNA obtained by RT of 2 µg RNA was used as a template in the PCR reaction using a pair of primers corresponding to the transmembrane segments of the FSHR. The primers, 20-mer each, were selected using the OLIGO Program (Oligo R1 primer analysis software; National Biosciences, Plymouth, MN). The forward primer corresponded to position 13991419 (5'CGGCTTTTTCACTGTCTTTG3') on the bovine FSHR mRNA [7]. The reverse primer was a 20-mer oligonucleotide complementary to position 17631783 (5'CGCTTGGCTATCTTGGTGTC3'). The predicted size of the RT-PCR product was 384 basepairs (bp). Four microliters of the RT reaction were used as a template for PCR; the reaction was allowed to proceed 35 cycles using 2 U Termus Aquaticus DNA polymerase (recombinant) provided by MBI Fermentas, Vilnius, Lithuania, and 200 pmol of each primer. The cycling parameters of the PCR were 98°C for 20 sec, 56°C for 45 sec, and 72°C for 45 sec. After amplification the samples were separated on a 1% agarose gel, stained with ethidium bromide, and photographed under UV light. The 384-bp fragment was extracted using the Wizard PCR Preps Kit (Promega, Madison, WI) and sequenced with the upper primer using an automatic sequencer (Applied Biosystems, Foster City, CA). For internal control, a bovine ß-actin fragment of 890 bp was produced from an upper primer (5'ACCAACTGGGACGACATGGAG3'; 21 mer) and a lower primer (5'GCATTTGCGGTGGACAATGGA3'; 21 mer) as previously described [5]. Each PCR amplification was standardized using ovarian granulosa cDNA to produce a specific band of the predicted size. Standardization was based on temperature, cycle number, Mg level, and pH.
Western Blots
Cervical, bovine seminal vesicle, or muscle minces were sonicated for 45 sec, lysed in 500 µl lysing buffer (1% Nonidet-40 [Sigma, St. Louis, MO], 2 mM EGTA, 5 nM MgCl2, 1 mM PMSF in PBS) and incubated for 2 h at 4°C. After centrifugation, aliquots were taken for protein determination using gamma globulin (Sigma) as reference standard [9] and a protein dye binding method (Bio-Rad Laboratories, Richmond, CA). Sixty micrograms of protein of the soluble tissue extract was then separated by electrophoresis on 59%-gradient SDS-PAGE and electroblotted onto nitrocellulose paper (Amersham, Little Chalfont, Bucks, UK) as described previously [9]. The nitrocellulose membrane was washed with PBS containing 0.05% TWEEN-20 and blocked with 10% horse serum (Kimron Veterinary Institute) in washing solution. The nitrocellulose membrane was then treated with either 1) an anti-peptide antibody (code name 179) raised against human (h) FSHR peptide 265295, diluted 1:500 (donation of Dr. J.A. Dias, Wadsworth Center, New York State Department of Health); 2) rabbit antiserum for bovine G protein (
s) diluted 1:1000; UBI, Lake Placid, NY); or 3) rabbit anti-bovine cyclooxygenase polyclonal antiserum (diluted 1:200; Kimron Veterinary Institute) [9]. Different dilutions were used for each antibody, and the final dilution used was 75% of the dilution, which gave a maximal signal as previously described [9]. The nitrocellulose paper was then incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG (Sigma Israel, Rehovot, Israel; diluted 1:2000 in washing buffer) for 1 h at room temperature. The presence of FSHR, G protein (
s), or cyclooxygenase was then visualized by means of a color reaction as follows. The nitrocellulose paper was incubated in a substrate solution containing 3'3'-diaminobenzidine (0.5 mg/ml; Sigma) in a mixture of PBS containing 0.5% CaCl2 and 6% H2O2. The antibody to hFSHR recognized the 75-kDa protein of the FSHR. The antibody to G (
s) recognized both the 42-kDa and 87-kDa forms of this protein, and the antibody to cyclooxygenase recognized the 72-kDa form (cyclooxygenase II). Extract of bovine seminal vesicles that are known to have a high content of cyclooxygenase was used as positive control as previously described [9]. The densitometric scans were obtained using a bio-imaging system (B.I.S. 2020; Rhenium Dingo, Jerusalem, Israel) and processed with Tina 2.0 software (Fuji, Japan). Linearity of detection [9] was determined for densitometry for both Western and Northern blots. Each Western blot was evaluated in the absence of the first antibody, and no signal was detected.
Northern Blot Analysis
For Northern blots, 10 µg of total RNA was denatured in 20 µl 50% formamide/2.2 M formaldehyde in single-strength 3-(n-morpholino) propanesulfonic acid (MOPS) buffer (0.04 M MOPS, 10 mM sodium acetate, 1 mM EDTA) at 65°C for 10 min. Samples were placed on ice, and 5 µl of loading buffer (0.5% SDS, 0.25% bromophenol blue, 25% glycerol, 25 mM EDTA) was added. Samples were subjected to electrophoresis through a 1.2% agarose formaldehyde gel and transferred by capillary blotting to nylon membranes (Nytran; Schleicher and Schuell, Keene, NH). RNA was subsequently UV cross-linked to membranes. The RT-PCR product fragments of 384 bp for FSHR and 890 bp for ß-actin were used to generate biotinylated probes using random primer biotin labeling of DNA for chemiluminescence (NEBlot phototype kit; Biolabs, Beverly, MA) according to the manufacturer's instructions. The blotted membrane was prehybridized at 65°C for 1 h in prehybridization solution (6-strength SSC [3 M NaCl, 0.3 M sodium citrate], 5-strength Denhardt's reagent [ 1% ficoll, 1% polyvinylpyrrolidone, 1% BSA], 0.5% SDS, and 100 µg/ml denatured salmon sperm DNAs) and hybridized overnight in the same solution with the denatured biotinylated probe to the target RNA. The membrane was then washed in double-strength SSC, 0.1% SDS at room temperature for 10 min and washed again in 0.1-strength SSC, 0.1% SDS at 68°C for 15 min followed by subsequent chemiluminescence, development, and detection on x-ray film (RX; Fuji Film, Tokyo, Japan). To obtain quantitative data for the specific mRNA, we used the densimetric value for ß-actin mRNA to normalize each specific mRNA value. To remove FSHR probe, membranes were stripped using water for 15 min, then incubated in 0.4 M NaOH, 0.1% SDS at 80°C for 30 min. The membrane was rinsed again in 0.2 M Tris-HCl, 0.1-strength SSC for 30 min at 25°C. After stripping, prehybridization and hybridization with ß-actin probe were performed as described for FSHR mRNA.
Cyclic AMP Determinations
Cervical tissue minces (50 mg/ml) were incubated for 10 min in wells of 1.5 ml containing 1.0 ml of Tissue Culture Medium-199 (TCM-199 without serum (Biological Industries, Beit Haemek, Israel) in the absence or presence of physiological (5, 10 ng/ml) and pharmacological doses (20, 40 ng/ml) of FSH (USDA-bFSH-8-1; no further increase in cAMP production was seen at 50 or 100 ng/ml) or forskolin, a stimulator of adenylate cyclase (10 µM; Sigma). The dose of forskolin was selected to give a 3-fold increase in cAMP. At the end of the incubation, tissues were removed, blotted on filter paper to remove mucus, and incubated overnight at 4°C with 400 µl of 3% HClO4. The solution was then neutralized with 150 µl of KHCO3 and centrifuged, and 50-µl aliquots were taken for the radioreceptor assay as described by Brown et al. [10] and modified for endometrium by Miyazaki et al. [11]. Standards (01000 pg of cAMP) or samples were incubated at room temperature with 100 µl of cAMP binding protein prepared from bovine adrenal extracts as described [10]. The buffer used for the assay was added to form a final reaction volume of 400 µl. After 2-h incubation in a cold room, the reaction was stopped by adding 300 µl of a charcoal-dextran solution; centrifugation followed, and the supernatant was removed for counting in a scintillation counter. The sensitivity of the assay was 60 pg/tube. Quadruplicate assays were made for each value determined. The within-assay and between-assay coefficients of variance were 8% and 10%, respectively.
Measurement of Phospholipase C (PLC) Activity
Cervical minces (30 mg) were incubated in 1 ml TCM-199 containing 5 mCi [3H]myo-inositol for 90 min. Slices were rinsed with 1 ml TCM-199 and incubated for another 60 min to remove unincorporated [3H]myo-inositol. At the end of the preincubations, slices were incubated in 1 ml TCM-199 containing 10 mM LiCl to inhibit inositol phosphate (IP) hydrolysis, allowing 3H-IP, 3H-IP2, and 3H-IP3 to accumulate in the tissue after stimulation of PLC, in absence or presence of 020 ng/ml of FSH or 020 ng/ml LH (USDA bLH-I-1). Incubations were terminated by adding 2 ml ice-cold chloroform/methanol/hydrochloric acid (5:10:0.1, v:v:v) and then 1 ml chloroform and 1 ml EDTA (5 mM) and extracted as described by Kisielewska et al. [12]. 3H-IP, 3H-IP2, and 3H-IP3 were separated from the labeled inositol compounds by using Dowex AG 1-X8 (formate form). 3H-Labeled IP was eluted from the column by sequential elution into 10 fractions. Aliquots of each fraction were added to scintillation vials containing 5 ml scintillation fluid, and radioactivity was determined using a scintillation counter. Total activity of PLC is expressed as cpm of total IPs/30 mg/30 min.
RIA for PGE2 and PGF2
Aliquots of 100 µl were taken at the end of the incubation period for specific RIA of PGE2 and PGF2
, which were performed without chromatographic separation. The antisera for PGF2
(Sigma) reacts preferentially with PGF2
but cross-reacts with PGF1
(60%) and to a negligible extent (< 0.1%) with prostaglandins of the A, B, and E series. The antisera to PGE2 (Sigma Israel) reacts preferentially with PGE2 but cross-reacts with PGE1 (20%), PGA1, PGA2, PGF1
, and PGF2
(< 10%) and to a negligible extent with PGB1 and PGB2 (< 0.1%). The intraassay coefficients of variation were 9% and 11%, and the interassay coefficients of variance were 12.3% and 13% for PGF2
and PGE2.
Statistical Analysis
ANOVA was performed with a significance level of p < 0.05. Data were further analyzed using Tukey's procedure (p < 0.05 or p < 0.01) to assess significance between treatments. Student's t-test was used where appropriate. Values are expressed as means ± SEM.
| RESULTS |
|---|
|
|
|---|
RT-PCR demonstrated that the FSHR gene is expressed in bovine cervix as indicated by the presence of the 384-bp fragment corresponding to bFSHR mRNA. The mRNA was maximally expressed in the cervix during the pre-estrous/estrous phase. In contrast, the expression of the gene was reduced in postovulation cervix and not detectable in luteal-phase cervix (Fig. 1). However, reamplification of the PCR product, cDNA, from the luteal phase produced a detectable signal (Fig. 1).
|
To demonstrate that the absence of FSHR mRNA in luteal-phase cervix was specific, bovine ß-actin mRNA was used as internal control. PCR demonstrated that the specific 890 bp of the ß-actin cDNA band was produced by the cervical tissues of all the stages. The band for ß-actin was present even though the 384-bp band corresponding to the FSHR was absent (Fig. 1).
The nucleotide sequence (Fig. 2) of the 384-bp fragment obtained from pre-estrous/estrous cervix was compared with that for the Bos taurus FSHR reported by Houde et al. [7]. It was found that there was a 97.5% homology between the 384-bp fragment and the nucleotide range 14101763 found in the Bos taurus FSHR.
|
The Northern blot contained the expected three transcripts of 2.55, 3.3, and 3.8 kilobases (kb) present in the bovine granulosa. However, the high (6.8-kb) and low (1.6-kb) transcripts found in the ovary were not found in the cervix. The three transcripts were found in pre-estrous/estrous cervix, but only one transcript (2.55 kb) was seen in luteal cervix (1/8 of the pre-estrus/estrus level; n = 5) or postovulatory cervix (1/3 of the pre-estrus/estrus level; n = 5) (Fig. 3).
|
FSHR Protein in the Cervix
The presence of FSHR protein in the cervix was demonstrated as determined by Western blot analysis using a specific antipeptide antibody for hFSHR. The antibody recognized a 75-kDa protein in both bovine granulosa and cervical preparations identical with the predicted molecular size of FSHR. The signal for the 75-kDa protein was strongest in pre-estrous/estrous cervix when compared with postovulation- (3-fold) or luteal-phase (6-fold) cervix (Fig. 4). With the use of 60 µg protein in each lane, this protein was observed to be expressed throughout the estrous cycle.
|
In Vitro Effect of FSH on Induction of FSHRs
A time-course (0.75, 1.5, and 3 h) and dose-response (0, 10, and 20 ng/ml) study was carried out to determine in vitro effect of FSH on its own receptor. Cervical minces (100 mg) from cows in the pre-estrous/estrous, postovulatory, and luteal phases were used. It was found, as determined by Western blot, that FSH induced its own receptor in cervical tissues at pre-estrus/estrus, with a 3-fold increase (p < 0.01) observed at 10 ng/ml after 3 h of incubation (Fig. 5). However, no effect of FSH was seen at earlier times at the 10 ng/ml level. When 20 ng/ml was used, a stimulatory effect (2-fold) was seen after 1.5 h. No significant response was observed when tissues of the postovulatory or luteal phase were used at any dose or time tested (data not shown).
|
Effect of FSH Treatment on G Protein (
s)
A time-course and dose-response study was carried out to determine whether cervical FSHR was coupled to G protein. Cervical minces (100 mg) from cows in the pre-estrous/estrous, postovulatory, and luteal phases were incubated in the presence of FSH (020 ng/ml) for 0.75, 1.5, and 3 h. It was found in pre-estrous/estrous cervical tissue that, in the presence of FSH (10 ng/ml), there was a significantly (p < 0.05) higher level of G protein (
s) at the level of both the 87-kDa (
, ß,
complex) and the 42-kDa (
s) proteins after 3 h of incubation (Fig. 6). FSH, at either 10 or 20 ng/ml, did not have a stabilizing effect on the level of G protein (
s) at shorter times of incubation (0.75 or 1.5 h). No significant response was observed when tissues of the postovulatory or luteal phase were used at any dose or time tested (data not shown).
|
IP Pathway Activation by FSH
For IP measurement, cervical tissue minces (30 mg) from pre-estrous/estrous, postovulatory, and luteal-phase cows were incubated for 30 min in the absence or presence of FSH (10 ng/ml) or LH (10 ng/ml). FSH significantly (p < 0.01) increased the level of IP, IP2, and IP3 at pre-estrus/estrus. However, FSH significantly (p < 0.05) inhibited IP level in the postovulatory stage. In contrast, LH, but not FSH, stimulated IPs significantly (p < 0.01) at the luteal phase (Fig. 7).
|
Adenylate Cyclase Activation by FSH
A dose-response analysis was used to determine whether the cervical FSHR was coupled to adenylate cyclase. In these experiments, cervical tissue minces (50 mg) obtained from pre-estrous/estrous, postovulatory, and luteal-phase cows were incubated with FSH (040 ng/ml). FSH increased cAMP accumulation in a dose-dependent manner when incubated with pre-estrous/estrous cervical tissues, with maximal stimulation 2.5 times (p < 0.01) that of control in the presence of 10 ng/ml (Fig. 8A). In contrast, cervical tissue from luteal or postovulation did not respond to FSH even though tissues from all phases of the cycle responded to forskolin with a significant (p < 0.01) increase in cAMP (Fig. 8B).
|
Effect of FSH on PGE Production by Cervical Tissues
A dose-response analysis was carried out to determine whether FSHR was associated with cervical prostaglandin production. PGE2 and PGF2
production by cervical minces (100 mg/ml) in the presence of FSH (020 ng/ml) was determined by RIA. FSH stimulated (p < 0.01) basal PGE2 production in a dose-dependent manner and caused a 3-fold increase in PGE2 production at 10 ng/ml in pre-estrous/estrous cervical tissues (n = 8, Fig. 9). FSH had no effect on the small amount of basal PGF2
(< 1 ng/100 mg) produced by cervical tissue (data not shown). FSH did not elevate PGE2 in cervical tissues from the luteal phase; furthermore, a small but significant (p < 0.05) inhibition was observed at postovulation (Fig. 9).
|
Cyclooxygenase Activation by FSH
To determine whether the presence of FSHR was associated with the expression of cyclooxygenase, cervical minces were incubated for 3 h in the presence or absence of FSH (10 ng/ml). Tissues from pre-estrous/estrous, postovulatory, and luteal-phase cows were extracted, separated on SDS-PAGE, and tested for the cyclooxygenase II (72 kDa) using a specific antibody. It was found that in cervical tissues from six pre-estrous/estrous cows, FSH induced a 200% increase in the expression of cyclooxygenase after 3 h of incubation (Fig. 10). In contrast, no effect on cyclooxygenase expression was seen in cervical tissues from luteal-phase cows, and an insignificant (p > 0.05) elevation at the postovulatory phase was observed (data not shown).
|
| DISCUSSION |
|---|
|
|
|---|
Northern blot analysis of bovine cervical tissues from pre-estrous/estrous cows revealed multiple transcripts for bovine cervical FSHR. The sizes of the major transcripts were 2.5 kb, 3.3 kb, and 3.8 kb, which were similar to those obtained in bovine granulosa cells [7], rat testis and ovary [13, 14], and human ovary [15] and myometrium [16]. Other minor transcripts have been reported in all of these species. The RT-PCR product yielded a single band of 384 bp, which was the expected molecular size, so the different isoforms of the FSHR are probably the result of differential splicing of the same transcript. Isoforms of FSHR have been characterized in human [17] and primate [18] ovary and in ovine testis [19]. Since only a single 2.5-kb isomer was present in luteal-phase cervix (which did weakly produce FSHR), it would appear that there are different isoforms present in the bovine cervix as well.
The nucleotide sequence homology between our RT-PCR 384-bp product was 97.3% identical to the comparable region of the bovine FSHR, showing that our amplified cDNA was complementary to the Bos taurus mRNA FSHR. The PCR product of 384-bp cDNA was found primarily in the pre-estrous/estrous cervix.
Using specific antibody raised in rabbits against hFSHR (amino acid sequence 265296) for Western blot analysis resulted in a major signal for a 75-kDa protein. A protein of similar molecular mass has been reported in rat and human ovary [20]. A strong signal for this protein was seen in the pre-estrous/estrous cervix compared with cervix from the other stages of the cycle. This cervical receptor was regulated by FSH itself, similar to the regulation of the FSHR in the rat ovary [14].
FSH increased cAMP production by cervical tissue from the pre-estrous/estrous phase but did not elevate cAMP in the postovulatory and luteal phases. FSH elevation of IPs displayed the same pattern. It would therefore appear that the cervical FSHR is associated with signal transduction pathways in a way similar to the accepted mechanism of LH action in the ovary and testes, i.e., activation of the second messenger pathwaysadenylate cyclase [21] and phosphatidyl-inositol (PLC) [22, 23]. The inhibitory effect of FSH on IPs and cAMP at postovulation occur when FSHR is low. Since FSH activity is biphasic, i.e., is stimulated by a low dose and inhibited by a high dose, an inhibitory effect at low concentrations could be the result of the change in the ligand-receptor ratio.
FSH induced about a 200% increase in the expression of cyclooxygenase at pre-estrus/estrus but had no effect on the two other stages of the cycle. This was similar to the response of cyclooxygenase to LH that was observed for the bovine endometrium [2] and uterine vein [6]. However, in the endometrium, LH increased cyclooxygenase during both the luteal and postovulatory phases but not at estrus [2]. Furthermore, the induction of cyclooxygenase by gonadotropin in the endometrium was associated with an increased level of PGF2
, while in the cervix PGE2 was the major product.
The bFSH was of immunological grade and devoid of residual biological contamination of LH, thyroid-stimulating hormone, growth hormone, prolactin, or ACTH. The effects on increasing cAMP, PGE2, and cyclooxygenase as well as induction of FSHR were therefore specific. Furthermore, it was found that highly purified hFSH (1020 ng/ml) (donation of J.A. Dias) had the same effects as bFSH when incubated with cervical tissue under the same conditions (2.5-fold increase in cAMP; 3-fold increase in PGE2; 2-fold increase in cyclooxygenase).
The relaxation and opening of the gravid cervix is due to active biochemical and structural changes in the cervical connective tissue that are mediated in part by prostaglandins [24]. It is thought that stretching of the cervix is a factor in causing the release of these prostaglandins [25, 26]. The effect of PGE in causing cervical softening in the ewe is also well documented [2729]. In both nonpregnant and pregnant cows, PGE2 causes an increase in cervical opening within 3 h of treatment [30]. PGE1 administered intra-cervically in a jelly was shown to decrease cervical resistance within 24 h [31].
Recently, we reported [6] that oxytocin caused a significant stimulation of PGE2 production in vitro in cervical tissues from pre-estrous/estrous cows but had no effect on PGE2 production in cervical tissue from other stages of the estrous cycle of the cow. Similarly, in an initial report [31], it was shown that administration of oxytocin to pre-estrous cows increased the concentration of PGE2 in the cervical exudate. However, peripheral oxytocin concentrations during estrus are lower than during the luteal phase [32, 33], and elevations of both peripheral oxytocin and cervical oxytocin receptor concentration are necessary for oxytocin to cause cervical softening towards parturition [24]. Furthermore, progesterone in vitro induced a dose-dependent inhibition of PGE2 release by cervical tissues from pre-estrous/estrous cows, and this was associated with a decrease in both basal and oxytocin-stimulated PGE2 production [6]. It would therefore seem that hormones other than oxytocin are responsible for the increase in cervical PGE2 in the pre-estrous/estrous cow. The present report indicates that FSH, which has its peak peripheral concentration at the time of estrus, could be the hormone that increases cervical PGE2, as the FSHR expression is maximal at this time and FSH in vitro increases PGE2 production by the cervix.
The bovine cervix at pre-estrus/estrus has high levels of FSHR protein and its corresponding mRNA. Activation of the receptor by FSH is associated with the G-protein-coupled receptor family that mediates the cAMP and IP signalling pathways. These signalling pathways then increase the expression of cyclooxygenase and production of PGE2. The expression of the FSHR was maximal at the time of the FSH peak in the blood and suggests a physiological role for FSH in the relaxation and opening of the cervix at estrus.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 Correspondence: M. Shemesh, Department of Hormone Research, Kimron Veterinary Institute, Bet Dagan, POB 12, Israel 50250. FAX: 972 3 9681753; mshem{at}vs.moag.gov.il ![]()
Accepted: April 26, 1999.
Received: November 16, 1998.
| REFERENCES |
|---|
|
|
|---|
-induced luteolysis in the cow. Biol Reprod 1998; 58:103108.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |