| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Articles |
a Institute for Hormone and Fertility Research, University of Hamburg, 22529 Hamburg, Germany
b Department of Animal Science, University of Florida, Gainesville, Florida 32611-0910
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The function of RLF is not yet known. However, the primary amino acid sequence not only shows a structure closely similar to that of the other members of this hormone family with A-, B-, and C-peptide domains, but it also appears to retain the putative receptor-binding motif of relaxin on the B-domain [12], albeit slightly shifted in position. Furthermore, preliminary experiments with a synthetic human RLF peptide show that it can interact specifically with mouse relaxin receptors [12]. Ruminants differ from other mammals in having no detectable relaxin gene [13, 14], although a relaxin-like physiology in late pregnancy is evident [15]. Given the unusually high ovarian expression of RLF in ruminants, it is tempting to speculate that this peptide may be able to functionally substitute for relaxin. It order to gain more information on a possible role for RLF in the female ruminant, we have now made detailed studies of its pattern of expression and regulation in various tissues. In both corpus luteum and follicular theca cells, expression of the RLF gene in terms of both temporal and quantitative aspects is very similar to that for the relaxin gene in, for example, the porcine ovary [16, 17]. Because of the high level of RLF mRNA expression in the cells of the theca interna, the present study focused on the regulation of the RLF gene in bovine theca cell cultures.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Bovine tissues from the ovaries and female tract of dated nonpregnant and pregnant animals were obtained from an experimental herd of Angus crossbred cattle as previously described [18]. Ovarian stromal tissue, follicles, and hypothalami were obtained from nonpregnant, commercially slaughtered Holstein cows; the time of the estrous cycle was estimated from the gross morphological appearance of the ovary [19]. Total RNA was prepared from all tissues using a one-step procedure [20]. For the determination of specific RNA content in freshly prepared individual theca cell populations, cells were prepared from individual follicles (see below). Follicles were separated into four categories: 1) small to medium-sized (< 10-mm diameter) antral follicles with high estradiol (E2) content (> 80 ng/ml); 2) large (> 15-mm diameter), presumably preovulatory antral follicles; 3) atretic follicles (< 10-mm diameter) with low E2 content (< 10 ng/ml); 4) follicular cysts (diameter > 35 mm). RNA was prepared from 3–4 individual theca cell preparations for each category, whereby smaller follicles were pooled prior to extraction. The data shown represent means and SEM from independent RNA preparations. All Northern blots (see later) were repeated at least once for each tissue type using tissues from independent animals, thus confirming the reproducibility of these assays.
Primary Culture of Bovine Theca Cells
Bovine ovaries were obtained from the local slaughterhouse, and only tertiary follicles of healthy morphological appearance and with diameters of 10–25 mm were used for the preparation of theca cell cultures. The serum-free culture system used in this study has been previously characterized and described in detail elsewhere [21]. After the Percoll purification step, the cells were resuspended in 1:1 Dulbecco's minimal essential medium and Ham's F-12 medium, supplemented with 2 mM L-glutamine, 100 IU/ml penicillin, 100 µg/ml streptomycin, 0.1% BSA, 5 µg/ml transferrin, and 5 ng/ml sodium selenite, together with effectors as outlined below. Routinely, cells were cultured in 6-well vitrogen-coated plates (about 500 000 cells per well) for up to 15 days under an atmosphere of 95% air and 5% CO2 at 37°C; the medium was changed every 2–3 days. Where indicated in the figure legends, cells were additionally treated with 10 ng/ml bovine LH (bLH; a kind gift of NIADDK and the National Hormone and Pituitary Program, NIH, Bethesda, MD) or 100 ng/ml bovine insulin (Boehringer Mannheim, Mannheim, Germany). Some cultures were also treated with 5% fetal calf serum (FCS). The cultures generally reached full confluence at about Day 6 of culture. At the end of the culture period, medium was assayed for progesterone and androstenedione using validated immunoassays (see below). Cells were extracted for either total RNA as described above, or for DNA using the Hoechst stain to estimate cell numbers. Some cell cultures were also subjected to morphological analysis by immunofluorescence microscopy using an anti-vimentin antibody (M725; Dako, Hamburg, Germany), exactly as described in Bracken et al. [22]. Finally, proliferation rates, expressed relative to cell numbers, were assessed in some cultures on Days 3–4 through measurement of 5-bromo-2'-deoxyuridine (BrdU) incorporation using a standard kit according to the instructions of the manufacturer (Boehringer Mannheim).
Immunoassays for Progesterone, E2, and Androstenedione
For the determination of progesterone in culture medium, a new progesterone ELISA was established. The system applied made use of a competitive double-antibody enzyme immunoassay in solid-phase technique using microtiter strips coated with goat anti-rabbit IgG antibodies. Progesterone standard or the sample medium competes with a progesterone-biotin derivative (tracer) for binding to the specific anti-progesterone antibody, the immunocomplexes that are formed binding to the microtiter wells via the second goat anti-rabbit IgG antibody. Horseradish peroxidase-coupled streptavidin was added to the biotin-containing immunocomplexes, the enzyme then converting the colorless substrate tetramethylbenzidine into its blue derivative, which turned yellow upon treatment with H2SO4. The intensity of the developed color was inversely proportional to the amount of progesterone in the standard or sample. This ELISA provided accurate measurements of progesterone in the range 0.14–34.02 ng/ml, corresponding to 7–1701 pg/well. Within this range, the interassay coefficient of variation for the lowest standard was < 15%. Relative cross-reactivity of the assay to structurally related compounds was estimated from the concentration required to yield a 50% suppression of the biotinylated progesterone tracer. Cross-reactivity was minor with 11-deoxycorticosterone (9.5%), corticosterone (4.9%), and 17
-hydroxyprogesterone (1.1%) and was negligible with an array of other steroids tested. A new immunoassay system was also developed for the measurement of E2, following exactly the same principles as outlined above. The detection range for E2 was 0.02–4.86 ng/ml, corresponding to 1–243 pg/well, with an interassay coefficient of variation within this range of < 15%. Measurement of relative cross-reactivity of the E2 assay for other structurally related compounds indicated a moderate cross-reaction with estradiol glucuronide (41%) and estradiol-17ß-3-sulfate (13.3%), a minor cross-reaction with estriol (0.56%) and estrone (0.40%), and negligible cross-reaction for a wide variety of other steroids tested. (Full details of all components and protocols can be obtained from Dr. M. Schumacher, Institute for Hormone and Fertility Research, University of Hamburg, Grandweg 64, 22529 Hamburg, Germany.) Androstenedione was measured by RIA using a commercial kit (IBL; Immunobiological Laboratories, Hamburg, Germany).
RNA Analysis by Northern Hybridization and RNase H Digestion
Total RNA was electrophoresed on 1.3% agarose/2.2 M formaldehyde gels in morpholinopropanesulfonic acid running buffer [23] as indicated in the figure legends. The RNA was transferred to a nylon membrane (Nytran; Schleicher & Schüll, Dassell, Germany) by overnight capillary transfer and fixed by UV cross-linking. Hybridization was as previously described [9], using an approximately 500-base pair (bp) BamHI restriction fragment of the full-length bovine RLF cDNA [9] as template to prepare single-stranded antisense 32P-labeled DNA probes with T7 DNA polymerase and an internal 3' oligonucleotide (GAGGCAGCAGTGGCGGGC) as specific primer. A specific probe, recognizing the mRNA for the bovine P450 side-chain cleavage enzyme (P450scc), was also prepared in a similar manner. As template, an RT-PCR product was employed that was made from luteal cDNA using the primers TGGTCAAAGCCTGCCCAC and GCATCTCCGTAATATTGG, corresponding, respectively, to nucleotides 34–52 and 949–967 of the published cDNA sequence [24]. The PCR product was subcloned and sequenced to verify identity. A single-stranded antisense 32P-labeled probe was made using T7 DNA polymerase and the specific downstream primer (as above). As control to check for even loading and transfer of the RNA, a probe representing the bovine S15 protein of the small ribosomal subunit (unpublished results) was prepared by random-primed labeling [25]. The specific mRNA signals were quantified using a PhosphorImager (Storm 840; Molecular Dynamics, Sunnyvale, CA), and data were evaluated using the ImageQuant software (Molecular Dynamics). Since it was not always possible to ensure absolutely even loading and transfer of RNA for hybridization, in some cases PhosphorImager results were expressed relative to the signals for the S15 mRNA (as indicated in the figure legends). Control experiments (not shown) were carried out using different amounts of total RNA to verify that signal-target relationships under the conditions employed were linear over the range of intensities analyzed for all probes used. Quantified results were compared, where indicated, by ANOVA, and significance was assessed by the Neuman-Keuls test.
RLF mRNA appeared as differently sized bands in different culture conditions. In order to determine whether this size difference was due to variability in the 3' polyadenylation, or possibly to differing 5' sequences, some RNA samples were subjected to RNase H digestion in the presence of specific oligonucleotides. Approximately 10 µg total RNA was incubated for 2 min at 50°C with either 750 ng oligo(dT) or an equivalent amount of an internal oligonucleotide (GCTCCTCTGAGGTGAGAACA) from the 3' region of the bovine RLF cDNA sequence, approximately 100 bp from the 3' end. KCl was then added to a concentration of 50 mM, and incubation was continued at room temperature for 10 min. This was supplemented with 1.5 units of RNase H (Gibco-BRL, Eggenstein, Germany) and the appropriate buffer to specifically digest double-stranded regions, and reactions were incubated for 60 min at 37°C. The resulting products were then analyzed by Northern hybridization as described above.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Northern hybridization of various bovine tissues (Fig. 1) confirmed previous findings that the RLF gene is expressed in the ovary at levels comparable to those in the adult testis. In particular, the corpus luteum and freshly prepared follicular theca cells showed very high levels of expression (Fig. 1). Much longer exposure of Northern blots from other tissues, using poly(A)-enriched RNA (Fig. 1, lanes 8–15), also indicated a very weak signal for the hypothalamus on repeated blots, though not in any other tissue examined. Corpora lutea were systematically collected from throughout the estrous cycle and pregnancy. Northern analysis of this RNA for the presence of RLF transcripts and quantification by PhosphorImager (Fig. 2) showed that there was very little RLF mRNA at the beginning of the estrous cycle. Specific mRNA levels increased through the cycle, reaching peak values in the mid to late cycle at about Day 12. Luteolysis was accompanied by a rapid decline in levels of specific mRNA. In the event that pregnancy occurred, there was no luteolysis-associated decline, and RLF mRNA levels continued to increase steadily to reach a maximum at the end of the second trimester. Levels were kept high through the third trimester but declined dramatically when the cows entered labor (Fig. 2B).
|
|
Analysis of individual theca cell populations (Fig. 3) showed that not all theca cells expressed the RLF gene to equivalent intensity. Theca cells from small to medium-sized (< 10 mm) antral follicles, containing high levels of estrogen (A), showed the highest proportion of RLF mRNA; the larger, presumably more differentiated preovulatory follicles showed the next highest proportion (B). Atretic follicles (C) and follicular cysts (D), while still containing appreciable amounts of RLF mRNA, showed significantly lower levels. Cysts showed a high individual variability, with cells from two of three cysts analyzed here having virtually no detectable RLF mRNA.
|
Expression and Regulation of RLF mRNA in Primary Cultures of Bovine Theca Cells
Because freshly prepared bovine theca cells consistently showed a high level of endogenous RLF mRNA and are known to be able to differentiate (luteinize) in long-term primary culture, theca cells were subjected to a variety of conditions in order to determine what factors might influence RLF gene expression. In initial experiments using a high level of insulin (5 µg/ml) in the culture medium (Fig. 4A), it could be shown that addition of 5% FCS was clearly detrimental to RLF gene expression. Replacement of this high dose of insulin by a lower concentration (100 ng/ml) or by 10 or 100 ng/ml of recombinant insulin-like growth factor-1 (IGF-1; Boehringer Mannheim), in the absence of added serum (not shown), showed no substantial difference, so all future experiments included 100 ng/ml insulin in the culture medium. Applying different concentrations of insulin in preliminary experiments indicated that in the complete absence of insulin or IGF-1, the cells still appeared healthy and that they grew with parameters similar to those of cells cultured in the presence of insulin; however, RLF gene expression was irreversibly inhibited (not shown). What is also clearly evident in Figure 4A (lane 6) is the appearance under insulin stimulation in the absence of added serum of a second, longer RLF transcript.
|
When the standard serum-free cultures, containing 100 ng/ml insulin, were then supplemented with 10 ng/ml bLH (Fig. 4B), the gonadotropin initially appeared to have a positive effect on the specific RLF mRNA—which now appeared at a size in between the sizes of two previously identified isoforms. The Day 3 levels were nevertheless reduced in comparison to those in fresh cells. At later time points, however, the bLH-stimulated cultures indicated less RLF mRNA than in theca cells cultured without bLH (see later). In both this and the preceding experiment, it was evident that the theca cells growing only in the presence of added insulin appeared to have reduced levels of RLF mRNA at intermediate time points, before specifically increasing the longer mRNA isoform.
Depending upon the culture conditions, theca cells appeared to exhibit three differently sized isoforms of RLF mRNA: in RNA freshly extracted from testis, corpus luteum, or theca cells, an mRNA species at approximately 0.85–0.9 kilobases (kb) was evident; in theca cells cultured long-term in the presence only of insulin, the mRNA was longer at about 1.0 kb; and in theca cells additionally cultured in the presence of bLH, an mRNA of intermediate size was detected. In order to check whether this size difference may be due to a difference in the length of the poly(A) tail or to some other feature of the transcript (alternative 5' end, alternative 3' polyadenylation site), RNA from different tissue sources and culture conditions was subjected to RNase H analysis in the presence either of oligo(dT) (Fig. 5A) or of an internal RLF-specific oligonucleotide 100 bp from the 3' end of the cloned cDNA sequence (Fig. 5B). RNase H specifically cleaves double-stranded RNA or RNA-DNA heteroduplexes, but not single-stranded RNA regions, which can then be detected by Northern hybridization. Cleavage by RNase H of the specific heteroduplexes formed with these oligonucleotides, and hybridization of the remaining intact RNA against a near full-length cDNA probe excluding the 3' end (Fig. 5), showed that for both oligonucleotides (and irrespective of the source of the RNA), only one sharply defined product resulted. Use of oligo(dT), such that only the poly(A) tail was removed, reduced all mRNA bands to a size of 0.8 kb, as predicted from the cloned cDNA sequence (0.77 kb [9]). Using the internal oligonucleotide to make the RNase H-sensitive heteroduplex gave rise to hybridizing bands that were exactly 100 kb shorter (Fig. 5B). Together, these results clearly demonstrated that the difference in transcript length was attributable to different degrees of polyadenylation at the same polyadenylation site, and that the 5' end was similar in all instances.
|
Culture of theca cells for longer periods under standard serum-free conditions (Fig. 6) revealed that in the absence of bLH there was, as seen previously (see above), a hiatus in the expression of RLF mRNA between Days 3 and 6. This was followed by a dramatic increase in levels of the longer isoform of the specific mRNA continuing up to Day 15 (Fig. 6, lanes 1–10). Similar parallel cultures with bLH added (Fig. 6, lanes 11–20) showed no such increase but rather a persistent decline. Addition of 5% FCS over the same period led to an immediate and irrevocable down-regulation of the RLF gene (not shown). When the same Northern blots were rehybridized against a probe for bovine P450scc, then, as might be expected, there was no change over 15 days of culture in the presence of insulin alone (Fig. 6, lanes 1–10); in contrast, addition of bLH led to a considerable and consistent increase (Fig. 6, lanes 11–20). There were no consistent changes under either culture condition in the levels of the control mRNA for the S15 ribosomal protein.
|
Markers of Differentiation for Bovine Theca Cells in Culture
The theca cells of the antral follicle are producers of androgens that become aromatized to estradiol by the granulosa cells. After the LH surge, the P450scc enzyme is up-regulated, and theca cells, like granulosa cells, begin to produce large amounts of progesterone. In vivo these theca cells become the small luteal cells of the corpus luteum formed after successful ovulation. In order to understand what was happening in the differently stimulated theca cell cultures, we also measured several different parameters indicative of the differentiation status of bovine theca cells. Assessment of androstenedione and its precursor progesterone secreted into the culture medium (Fig. 7) confirmed what the mRNA levels for P450scc had already suggested. Androstenedione production decreased rapidly in all culture conditions, concomitant with the down-regulation of the CYP17 gene—though it appeared to recover somewhat between Days 12 and 15 when cells were cultured in the presence of insulin with or without added bLH. Addition of 5% FCS led to a rapid and complete cessation of androstenedione production. Progesterone, on the other hand, indicated a more differentiated phenotype. Whereas in the presence of only bLH and insulin there was a large and steady increase throughout the culture period, paralleling the increase in P450scc mRNA, in the absence of these factors (with or without 5% FCS) the progesterone levels declined consistently through the latter periods of culture. Interestingly, in the first days of culture, FCS alone appeared to cause a transient stimulation of progesterone production.
|
The cells were also assessed morphologically at different times in culture. Under 5% FCS conditions, the cells appeared to retain the relatively undifferentiated and compact mesenchymal appearance seen at the beginning of culture (Fig. 8A). In contrast, when cultured without serum, the cells became flattened and extensively polygonal (Fig. 8B); addition of insulin had no impact on this morphology (not shown). The appearance changed dramatically upon addition of bLH (Fig. 8C). While retaining their extended and flattened phenotype, the cells now showed extensive formation of dendrite-like processes. Proliferation rates were also assessed over the first 4 days in culture by measuring BrdU incorporation (not shown). Whereas, as expected, there was a marked increase in proliferation rate in the presence of 5% FCS, in all serum-free conditions with or without added insulin or bLH, no significant differences in proliferation rates were measured—all cultures attaining confluence by about Days 5–6. Assessing total DNA levels as an estimate of cell numbers in parallel wells reinforced the more general observations that cells cultured in FCS initially divided more rapidly, reaching confluence at between Days 3–4. After this there appeared to be contact inhibition, with little further increase in cell number. After Day 9 of culture, cell numbers appeared to decline somewhat. In serum-free conditions, the initial proliferation rates were lower, confluence being attained at between Days 4 and 6. However, the cell diameters were much larger than when cells were grown in FCS (Fig. 8); thus contact inhibition appeared to set in at a lower total cell number for those cells grown without serum or without added insulin. Cell numbers remained constant throughout the remainder of the culture. Addition of bLH to these serum-free cultures did not affect the time at which these cultures reached confluence and had no effect on initial proliferation rates. However, a higher total cell density was attained, suggesting a greater degree of cell overlap in these cultures, concomitant with the development of the extensive cell processes.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In mouse Leydig cells, we have shown that RLF is a differentiation marker for the mature adult Leydig cell [10]. Prepubertal mice or hypogonadal hpg mutant mice do not express RLF until the Leydig cells have been exposed to LH or hCG for several days. Short-term stimulation with the gonadotropin has no effect on RLF gene expression either in vivo or in adult Leydig cells in culture [10], where RLF appears to be expressed constitutively. Interestingly, human Leydig cell hyperplasias and tumors show greatly reduced RLF expression [34], correlating with dedifferentiation of the cells and showing that RLF can act as a useful marker of mature differentiation status.
As to the situation in the bovine ovary in vivo, RLF mRNA appears to be expressed at a higher level in theca cells from small preovulatory follicles than in those from larger, presumably later preovulatory follicles. Evidently, between ovulation and the formation of the early corpus luteum, in which theca interna cells go on to form the small luteal cells, there is a further down-regulation of the RLF gene. RLF gene expression then appears to increase again until the mid to late luteal phase. If pregnancy occurs, this increase is maintained through to the end of the second trimester, and high levels of RLF mRNA are present in the corpus luteum until term. Only at parturition is there a dramatic decrease in the concentration of RLF mRNA, similar to that seen at luteolysis at the end of the estrous cycle. Whereas in the follicle the theca cells are the major source of bovine RLF transcripts, in the mid-late cycle corpus luteum we have previously shown that both mRNA [9] and RLF-specific immunoreactivity [35] are in large luteal cells. Also in the marmoset monkey [7], RLF appears to be present only within large luteal cells. This leaves open the question whether the RLF-immunopositive large luteal cells seen in the mid-late corpus luteum are cells that have derived by further differentiation of theca cells (small luteal cells) or whether they represent a late differentiation form of the granulosa-derived large luteal cells. Freshly prepared granulosa cells from large antral follicles show only a very weak signal for RLF mRNA (Fig. 1), and long-term (10 day) cultures of granulosa cells grown under serum-free luteinizing conditions are negative for RLF mRNA (unpublished results).
In order partly to assess this issue, we have studied long-term cultures of primary theca cells under various conditions. The fresh theca cells from which the cultures were started all expressed relatively high levels of RLF mRNA. Addition of 5% serum to these cultures led to a rapid decline in RLF gene expression and also in androstenedione production. Progesterone production was initially maintained, but at later time points was also inhibited, even though the expression of P450scc mRNA remained constant throughout the culture period (not shown). In preliminary experiments, we had also established cultures for 2 days in the presence of serum and then switched to serum-free media; RLF mRNA failed to reappear even after 6 days of culture (not shown). A feature of the serum-stimulated cultures is that the cells proliferate more rapidly and attain confluence more quickly than the serum-free systems. The cells also retain throughout a smaller, less differentiated, more fibroblast-like mesenchymal appearance. Although theca cells in primary culture can be grown without insulin or IGF-1 under serum-free conditions, cultures appear healthier in the presence of either insulin or IGF-1 and are more steroidogenically active. In the presence of insulin, theca cells initially indicate a decrease in RLF mRNA to a minimum at about Days 4–6 of culture; subsequently, specific levels of RLF mRNA increase again, reaching at Day 15 levels that are at least as high as in the freshly prepared theca cells. The hiatus at Day 6 is accompanied by a switch from a form with a short poly(A) tail to one with a long poly(A) tail. The hiatus at Day 6 is also accompanied by a form of "crisis" in the cultures: here the cells subjectively appear less healthy, androstenedione production is at its lowest, and also DNA levels indicate that some cell death may have occurred. Cell death is not readily evident in these cultures, possibly because of theca cell phagocytosis [36]. However, throughout these cultures there is no change in the relative levels of the control S15 mRNA or of the mRNA for P450scc. Progesterone production is maintained at a steady moderate level. Addition of bLH to the cultures leads to a prominent steady increase in the levels of P450scc mRNA, as expected under these strongly luteotrophic conditions, and accordingly also to a considerable increase in progesterone production. The RLF mRNA under these conditions declines steadily over this period, however not as dramatically as under the influence of 5% serum. Interestingly, the length of the poly(A) tail of the RLF mRNA is intermediate between those of the short and long forms seen in the absence of LH, and it appears to be similar in size to the prevalent form seen in the testis and corpus luteum in vivo.
Morphologically, cells cultivated in the absence of serum are larger and more polygonal in appearance, irrespective of whether insulin is present or not. These cells also exhibit a lower rate of proliferation in preconfluent cultures than those growing in the presence of serum. Addition of LH has no effect on the overall dimensions or the initial proliferation rates of the cells grown as described here. However, as previously shown by Brunswig-Spickenheier et al. [37], the LH-stimulated theca cells exhibit extensive dendrite-like processes, and a higher overall cell density appears to be possible under long-term culture. LH also appears to increase the formation of discrete cell aggregates much as has been shown also for porcine theca cells in culture [38].
It is tempting to draw a comparison between these long-term cultures and the fate of the theca-derived cells in vivo. Culturing in serum would appear to maintain a phenotype similar to that of the so-called fibroblast-like small cells of the bovine corpus luteum [19], wherein steroidogenesis is down-regulated, but where it has been speculated that these might act as stem cells for differentiation into steroidogenic cell types. These cells are highly proliferative. Cells grown in serum-free conditions appear within a few days to acquire a large-cell phenotype, with or without added LH. A reduction in proliferation rates, and attainment of confluency in the cultures, may accompany an up-regulation of the RLF gene. This phenotype is very similar to that of the midcycle large luteal cells. Addition of LH appears long term to cause a down-regulation of the RLF gene and a further change in the morphological phenotype. Whether this has a pendant within the corpus luteum is not known, since the studies using in situ hybridization [9] or immunohistochemistry [35] have not provided the detail required for this distinction. In vivo, the small theca-derived luteal cells are LH responsive; whether the large cells are LH responsive in vivo is still debated [39]. Another possibility that needs further clarifying experimentation is that the small luteal cells in vivo are those that remain closest to blood vessels as a source of serum and in turn give rise to larger, more differentiated luteal cells further away from such vessels. Certainly, in vivo small bovine luteal cells are negative for RLF mRNA and immunoreactivity [9, 35], whereas the majority of all large cells are positive for RLF gene products by mid-late cycle. If one could assume that RLF gene expression is limited to one cell lineage only, then this view would support the idea that granulosa-derived large luteal cells are being ousted by large cells derived from small theca-lutein cells by the mid to late luteal cycle. It is important to stress, however, that any such comparisons between the in vivo situation and such artificial long-term cultures as described here are highly speculative, especially since after about Day 6 these cultures, lacking lipoproteins and cholesterol, are probably suboptimal for steroidogenesis. It should be noted, though, that cultures grown serum-free in the presence of insulin and bLH are still capable of high progesterone production even after 2 wk of culture (Fig. 7).
Nevertheless, it would appear that RLF gene products with differing degrees of transcript polyadenylation and hormonally dependent levels of expression could provide an important new marker with which to follow theca-luteal cell differentiation. In particular, the inverse relationship between RLF gene expression and cell proliferation, as is also seen during Leydig cell development [10] and neoplasia [34], and the differential response toward LH under serum-free conditions, do offer possible clues as to the different large-cell phenotypes described in vivo [19].
The function of the RLF protein is still not defined. Considering, however, that in both sheep [13] and cows [14] the gene for the closely related hormone relaxin appears to be deleted or not expressed, even though these animals exhibit a relaxin-like physiology at parturition, it is extremely interesting to observe that the levels, timing, and cellular localization of RLF expression in the cow mirror very precisely those parameters for relaxin in the pig [16, 17]. In all other species in which ovarian relaxin is expressed normally, levels of ovarian RLF mRNA in the species that have been studied (e.g., human, mouse, marmoset monkey, pig) are consistently much lower, probably subserving only a local paracrine function. In preliminary studies it has been shown that a human RLF peptide can interact with mouse relaxin receptors [12]; future studies will need to extend such studies to the bovine system, to see whether RLF indeed is compensating for relaxin in this species.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Correspondence and current address: Ross A.D. Bathgate, Howard Florey Institute, University of Melbourne, Parkville, Victoria 3052, Australia. FAX: 61–3–93481707; r.bathgate{at}hfi.unimelb.edu.au
Accepted: June 2, 1999.
Received: March 4, 1999.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
secretion in cultured endometrial cells. Endocrinology 1997; 138:237–247.This article has been cited by other articles:
|
|
 |
|
  R. Ivell and R. Anand-Ivell Biology of insulin-like factor 3 in human reproduction Hum. Reprod. Update, July 1, 2009; 15(4): 463 - 476. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. L. Russell and R. L. Robker Molecular mechanisms of ovulation: co-ordination through the cumulus complex Hum. Reprod. Update, May 1, 2007; 13(3): 289 - 312. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Schwarzenbach, G. Chakrabarti, H. J. Paust, and A. K. Mukhopadhyay Gonadotropin-Mediated Regulation of the Murine VEGF Expression in MA-10 Leydig Cells J Androl, January 1, 2004; 25(1): 128 - 139. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Telgmann, R. A.D. Bathgate, S. Jaeger, G. Tillmann, and R. Ivell Transcriptional Regulation of the Bovine Oxytocin Receptor Gene Biol Reprod, March 1, 2003; 68(3): 1015 - 1026. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Schwarzenbach, P. R. Manna, D. M. Stocco, G. Chakrabarti, and A. K. Mukhopadhyay Stimulatory Effect of Progesterone on the Expression of Steroidogenic Acute Regulatory Protein in MA-10 Leydig Cells Biol Reprod, March 1, 2003; 68(3): 1054 - 1063. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Paciga, A. J. Watson, G. E. DiMattia, and G. F. Wagner Ovarian Stanniocalcin Is Structurally Unique in Mammals and Its Production and Release Are Regulated through the Luteinizing Hormone Receptor Endocrinology, October 1, 2002; 143(10): 3925 - 3934. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Ivell and R. A.D. Bathgate Reproductive Biology of the Relaxin-Like Factor (RLF/INSL3) Biol Reprod, September 1, 2002; 67(3): 699 - 705. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. T. Budnik and A. K. Mukhopadhyay Lysophosphatidic Acid-Induced Nuclear Localization of Protein Kinase C {delta} in Bovine Theca Cells Stimulated with Luteinizing Hormone Biol Reprod, September 1, 2002; 67(3): 935 - 944. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. F. Irving-Rodgers, R. A.D. Bathgate, R. Ivell, R. Domagalski, and R. J. Rodgers Dynamic Changes in the Expression of Relaxin-Like Factor (Insl3), Cholesterol Side-Chain Cleavage Cytochrome P450, and 3{beta}-Hydroxysteroid Dehydrogenase in Bovine Ovarian Follicles During Growth and Atresia Biol Reprod, April 1, 2002; 66(4): 934 - 943. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Klonisch, J. Kauffold, K. Steger, M. Bergmann, R. Leiser, B. Fischer, and S. Hombach-Klonisch Canine Relaxin-Like Factor: Unique Molecular Structure and Differential Expression Within Reproductive Tissues of the Dog Biol Reprod, February 1, 2001; 64(2): 442 - 450. [Abstract] [Full Text]
|
|
|
|
|
|
B. D. Murphy Models of Luteinization Biol Reprod, July 1, 2000; 63(1): 2 - 11. [Abstract] [Full Text]
|
|
|
|
 |
|
 R. A. D. Bathgate, C. S. Samuel, T. C. D. Burazin, S. Layfield, A. A. Claasz, I. G. T. Reytomas, N. F. Dawson, C. Zhao, C. Bond, R. J. Summers, et al. Human Relaxin Gene 3 (H3) and the Equivalent Mouse Relaxin (M3) Gene. NOVEL MEMBERS OF THE RELAXIN PEPTIDE FAMILY J. Biol. Chem., January 4, 2002; 277(2): 1148 - 1157. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
