| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Articles |
a University of Oulu, Department of Anatomy and Cell Biology, FIN-90401 Oulu, Finland
b University of Oulu, WHO Collaborating Centre for Research on Reproductive Health, FIN-90220 Oulu, Finland
c University of Turku, Department of Anatomy, FIN-20520 Turku, Finland
d Department of Biosciences, Division of Biochemistry, FIN-00014 University of Helsinki, Finland
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
A specific carrier protein responsible for the transport of bicarbonate into the sperm cell has not been unequivocally identified. Chloride/bicarbonate exchangers, together with Na+/H+ exchangers, are the main regulators of intracellular pH in mammalian cells; the former are capable of transporting bicarbonate in both directions through the plasma membrane. Chloride/bicarbonate exchangers include Na-driven, Na-dependent, and Na-independent types. In addition, electrogenic Na+/HCO3- cotransporter has been cloned and characterized [9]. Physiological measurements have indicated that both sodium-dependent and -independent exchangers are present in sperm cells [10, 11].
In our earlier study [12], we identified a polypeptide in both human and rat sperm cells that is immunologically related to members of the anion exchanger (AE) gene family and is expressed in a highly polarized pattern in the equatorial segment of the sperm head. The identified AE protein was found to be most homologous to either AE1 or AE2 isoforms of the AE gene family. AE1 (previously termed band 3) is a founding member of the sodium-independent Cl-/HCO3--exchanger gene family, which according to the current knowledge consists of at least two additional members, namely AE2 and AE3 [13–18]. In addition, each gene produces tissue-specific variants by means of alternative splicing and/or by the use of alternative promoters [19–22]. AE1 is found in erythrocytes, kidney, and heart [18, 19, 23]. AE2 is found in almost all tissues, but mainly in the stomach, kidney, and intestine [21, 24, 25]. AE3 is expressed predominantly in the brain and heart [17,26]. In erythrocytes, AE1 has an important role in the transport of CO2 (as a form of HCO3-) into the lungs. In nonerythroid cells, all AE proteins are known as regulators of intracellular pH, cell volume, and Cl- concentration.
In the present study, we have isolated and sequenced a full-length cDNA encoding the AE2 isoform from a human testicular cDNA library. The cloned full-length AE2 mRNA was found to be expressed mainly in the seminiferous tubules in both rat and human testis. This finding together with our previous immunological data [12] demonstrates that the AE expressed in sperm cells is the full-length AE2 isoform.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
A commercial human testis 
gt-11 cDNA library (5'-STRETCH) was obtained from Clontech (Palo Alto, CA). The library was screened with 32P-labeled PstI-fragment (0.4 kilobases [kb]) probe derived from rat AE2 cDNA. The same probe had been used previously for Northern blotting of rat testicular 4.4-kb AE2 mRNA [12]. Prehybridization and hybridization were performed at 42°C in 50% formamide, 5-strength SET (125 mM Tris, 2 mM EDTA, 0.75 M NaCl, pH 8.0), 5-strength Denhardt's, 0.1% SDS, and 50 µg/ml tRNA. Plaque purification produced three positive clones, two of which (T2 and T3) were selected for sequencing. They partly overlapped and comprised about 3.5 kb of the complete 4.4-kb testicular AE2 mRNA with missing transcription start site.
Complementary DNA Sequencing
Selected clones T2 and T3 were subcloned into the pGEM-3z vector and sequenced using automated sequencing method (ABI Prism 377 XL; Foster City, CA). Specific sequencing primers were obtained from Pharmacia (Pharmacia and Upjohn, Kalamazoo, MI).
Isolation of the 5' End of AE2 cDNA
The 5' end of the cDNA not represented in the T2 and T3 clones was amplified by reverse transcription-polymerase chain reaction (RT-PCR) from human testis total RNA. Primers were synthesized according to human kidney AE2 sequence [15] on the 5' end. For RT, 1 µg of total RNA was used, and two successive PCR rounds were performed. The cycling parameters were 1 min at 94°C, 1 min at 58°C, and 1 min at 72°C for the first-round PCR and 1 min at 94°C, 1 min at 65°C, and 1 min at 72°C for the second-round PCR. For the second-round amplification, one of the two primers was nested with respect to the first-round primer. AE2 cDNA was reverse transcribed from total RNA with primer PCR1. First-round primer pair was PCR13-PCR14; for the second-round amplification, primers PCR13 and PCR12 were used. The sequences of the primers were as follows: primer PCR1, nucleotides 979...955, 5' GCTCCACAAACACCTCATGGGGCTT 3'; primer PCR13, nucleotides -47...-26, 5' GTTGCCCTGAATGCCGCAGCGA 3'; primer PCR14, nucleotides 918...892, 5' AGGCTCCCGCCCTTCTCGGCCACTCTG 3'; primer PCR12, nucleotides 907...882, 5' CTTCTCGGCCACTCTGTGTGGAACCT 3'. PCR product (named 5'-1000) was then sequenced and compared to the published human genomic AE2 sequence [14]. In order to avoid any amplification errors, we amplified an additional 600-base pair (bp) product named 5'-600 (which lacks the last 400 bp of 5'-1000), sequenced it, and compared the sequence to that of the 5'-1000 sequence. All three cDNA clones (5'-1000, T2, and T3) were digested with appropriate restriction enzymes and then ligated to form full-length AE2 cDNA, which was then subcloned to EcoRI-site of pGEM-4z plasmid vector. Figure 1 shows the relative positions of 5'-1000, T2, and T3 with respect to full-length AE2 cDNA.
|
Total RNA Isolation
Total RNA was isolated from human testis and segments of rat seminiferous epithelium by using the acid guanidinium thiocyanate-phenol-chloroform extraction method [27]. Human testis tissue was obtained alongside routine histopathological specimens taken during urological operations for prostatic carcinoma at Oulu University Hospital.
In Situ Hybridization
Antisense and sense riboprobes were transcribed from SP6 or T7 plasmid promoters. Plasmids T2 and T3 were linearized with restriction enzymes BsaAI and BsrGI, respectively. Linearized T3 was used for preparing 35S-labeled antisense riboprobe from SP6 promoter and linearized T2 for sense riboprobe from T7 promoter. Antisense riboprobe corresponds to nucleotides 3368–3896 of the full-length AE2 cDNA sequence. Human and rat AE2 sequences share 89.7% homology in this region. In situ hybridization was performed on 7-µm paraffin sections of human and adult Wistar rat (Experimental Animal Unit, University of Oulu) testis. Tissue samples were fixed in 4% paraformaldehyde in PBS for 3–4 h at room temperature, washed in PBS, dehydrated, and embedded in paraffin before sectioning. Paraffin sections were hydrated, digested with proteinase K, postfixed in 4% paraformaldehyde in PBS, acetylated, and then dehydrated in series of 30%, 70%, 97%, and 100% ethanol for 5 min in each.
Hybridization was performed mainly as described by Fontaine et al. [28] and modified by Schmid [29] and Angerer [30, 31]. Briefly, 70 µl of the sense or antisense RNA probe (20 000 cpm/µl of labeled RNA in 50% formamide, 0.3 M NaCl, 20 mM Tris-HCl [pH 8.0], 5 mM EDTA, 100 mM dithiothreitol, 0.5 mg/ml tRNA, single-strength Denhardt's solution, and 10% dextran sulfate) was applied to the tissues; coverslips were added and the slides were incubated at 60°C overnight. The sections were washed in 4-strength SSC (single-strength SSC is 0.15 M sodium chloride and 0.015 M sodium citrate) and 10 mM dithiothreitol four times for 15 min each, then for 30 min at 60°C in 50% formamide, 0.15 M NaCl, 30 mM Tris-HCl, 5 mM EDTA, pH 8.0. The sections were then treated with RNase A solution (20 µg/ml) for 30 min at 37°C, washed for 15 min in double-strength SSC at 60°C and for 15 min in 0.1-strength SSC at 60°C, dehydrated in ethanol, and air dried. The slides were then dipped in NTB2 emulsion (Eastman Kodak, Rochester, NY; diluted 1:1 in 0.6 M ammonium acetate) and exposed in the dark at 4°C for 15 days. The slides were then developed at 12°C by treatment with D-19 solution for 2.5 min, rinsed in distilled water, fixed for 5 min in Unifix (Kodak), and finally rinsed for 5 min in distilled water. Nuclei were stained with Hoechst 33258 (Sigma Chemical Co., St. Louis, MO), after which the slides were mounted with glycergel (DAKO A/S, Glostrup, Denmark).
Microdissection of Rat Seminiferous Tubules
Testes of adult Sprague-Dawley rats (Experimental Animal Unit, University of Oulu) were decapsulated, and the seminiferous tubules were isolated from the interstitial tissue under a stereomicroscope in a Petri dish containing PBS. With use of transillumination, the stages of the cycle of the seminiferous epithelium were recognized, and the tubular segments (2 mm) were divided into 10 pools (I, II-III, IV-V, VI, VIIab, VIIcd, VIII-IX, X, XI-XII, and XIII-XIV) as described by Parvinen and Ruokonen [32]. Two preparations yielding 7 cm of tubule segments in each were obtained and used for RT-PCR amplification.
AE2 mRNA Expression During the Seminiferous Epithelial Cycle
Isolation of total RNA from 10 segments of rat seminiferous tubules corresponding to known developmental stages of maturing sperm cells, as well as RT-PCR, was performed as described above. For RT, R31 primer was used, and subsequent PCR rounds were amplified with primer pairs F24-R38 and F24-R45. The sequences of primers (Pharmacia) were as follows: primer R31, nucleotides 2456...2436, 5' ACGAAGCGGACCAGGAAGCTC 3'; primer F24, nucleotides 979...999, 5' CTGAATGAGTTGCTCCTGGAC 3'; primer R38, nucleotides 2134...2105, 5' TTGATGGCCGTCAGCAGGTC 3'. PCR products were size separated on 0.8% agarose gel, transferred to nitrocellulose membrane, and hybridized with 32P-labeled cDNA probe (0.6-kb EcoRI-SacI fragment of T2 cDNA corresponding to nucleotides 496–1127 of the full-length AE2 cDNA). Two batches of total RNA were used for RT reactions, and RT products were then used as templates for the PCR. To confirm that the amount of total RNA was comparable in each sample, we amplified a 300-bp product from glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from the same RNA samples. GAPDH is a glycolytic enzyme and known as a "housekeeping" protein expressed widely and rather invariably in different tissues. RT reaction was done with primer GAPDH-3 followed by two subsequent PCR rounds with GAPDH primers (GAPDH-1 and GAPDH-2) and using the same cycling parameters as above except that 55°C annealing temperature was used for both rounds. Sequences for GAPDH primers (Pharmacia) were as follows: primer GAPDH1, nucleotides 234...343, 5' CGTCTTCACCACCATGGAGA 3'; primer GAPDH2, nucleotides 623...603, 5' CGGCCATCACGCCACAGCTTT 3'; primer GAPDH3, nucleotides 759...741, 5' TCAGATCCACAACGGATACA 3'. After agarose gel electrophoresis, PCR products were blotted to nitrocellulose filter and hybridized with 32P-labeled full-length GAPDH cDNA probe.
The relative optical densities (ROD) of the bands were measured from the film using a computer-assisted image analysis program (MCID-M1; Imaging Res. Inc., St. Catharines, ON, Canada). The variation in GAPDH mRNA expression was corrected for the ROD values of AE2 PCR products. The GAPDH-correlated ROD values of all stages were summarized, and the percentage optical density at each stage was then calculated with respect to this value. The optical densities expressed as a percentage (mean ± SD, n = 2) were then calculated from two separate experiments of each stage.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Library screening and plaque purification produced three independent clones (T1, T2, T3), all of which corresponded to the AE2 mRNA after preliminary sequencing and restriction enzyme analyses. Because T1 clone was included in clones T2 or T3, the latter two were chosen for further analysis. T2 and T3 also overlapped partially and had sizes of about 2.4 kb and 2.3 kb. The overlapping region covered about 1 kb, and the sequence was identical in the two clones except for the 160-bp additional sequence found only in T2 clone.
To find out the identity of the 160-bp "insert," we synthesized two primers from both sides of the 160-bp sequence and used them to amplify a short fragment of AE2 cDNA using clones T1, T2, and T3, human genomic DNA, human testis library cDNA, and reverse-transcribed testicular total RNA as templates. Size analysis of the PCR products showed that the additional 160-bp sequence was present in T2 clone and human genomic DNA (data not shown). However, total RNA and cDNA from the human testis library produced two different-sized bands, the larger one corresponding in size to that containing the 160-bp additional sequence. The larger-sized band was the major form obtained from the human testis cDNA library, whereas the smaller band was the major form obtained from total testicular RNA (data not shown). This "additional" sequence appears, therefore, to be an unspliced intron. The presence of unspliced intronic sequences in RNA preparations is fully compatible with the earlier findings made by other research groups [15, 16].
Multiple-tissue Northern blot hybridization analysis with 32P-labeled EcoRI-SacI fragment demonstrated expression of AE2 mRNA in all tissues examined; and in testis, a single 4.4-kb band was clearly seen (data not shown; see also [12]). Because clones T2 and T3 covered about 3.4 kb of the expected 3.9-kb open reading frame of the AE2 [12, 14, 15], and T3 contained a poly(A) tail, about 600 bp of the 5' end was missing from the complete coding region of AE2 mRNA. The missing 5' end was obtained by using RT-PCR amplification. The amplification product (954 bp, termed 5'-1000) contained a 379-bp overlapping region with T2 clone. All three clones (T2, T3, 5'-1000) were then ligated together to form the full-length AE2 cDNA sequence.
Sequencing of the full-length human testis AE2 cDNA showed few discrepancies in comparison to the nucleotide sequence of AE2 exons obtained in the genomic clones [14]. There were few nucleotide disparities, which did not cause amino acid changes. We found A instead of C in position 285, i.e., A-C285 and T-C486, C-T936, T-C1071, T-C1464, and finally G-A2202. The first two of these were in the region amplified by RT-PCR and could be explained by mismatch errors, but since both RT-PCR products, i.e., 5'-1000 and 5'-600, had the same base in positions 285 and 486, this possibility is unlikely. We found four amino acid disparities in the amino terminal end of AE2, i.e., Q instead of R in position 157 (Q-R157), Y-H364, E-D495, and L-V496. Corresponding base changes were G-A470, C-T1090, C-G1455, and G-C1456.
Detection of AE2 mRNA in Human and Rat Testis by In Situ Hybridization
Our control probe did not show hybridization to any particular region of the rat testis sections (Fig. 2A). This was in marked contrast to the antisense riboprobe, which corresponded to the region 3368–3896 of AE2 cDNA. This region is highly conserved between species, but homology between other members of the AE family is under 60%. In situ hybridization with antisense riboprobe clearly showed high AE2 mRNA expression throughout the seminiferous epithelium (Fig. 2, B and C), indicating that the signal was present in differentiating sperm cells. Some of the signal may also have come from Sertoli cells, as AE2 is known to be ubiquitously expressed in almost all cells and tissues examined. The main body of Sertoli cells is also known to lie close to the basal lamina surrounding the seminiferous tubules. Figure 2, B and C, also shows that the hybridization signal was not uniform between the tubules; i.e., some cells/tubules showed higher expression levels than others even in the same tissue section. We also found tubule cross sections in which the hybridization signal was nearly equal to that in the control.
|
AE2 mRNA Expression at Different Stages During Sperm Cell Development
To find out whether AE2 mRNA is expressed in a stage-specific manner, rat seminiferous tubules were cut into segments that contained different developmental stages of maturing sperm cells [32], in addition to Sertoli and peritubular cells. Total RNA from 10 such segments (corresponding to stages I, II–III, IV–V, VI, VIIab, VIIcd, VIII–IX, X, XI–XII, and XIII–XIV) were then isolated and used as templates for RT-PCR amplification. We amplified a 830-bp AE2 product with primers F24 and R45. We found that AE2 mRNA was expressed at all stages, but the highest expression was detected at stages VII–IX and XI–XIV (Fig. 3).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Our conclusion is based on several findings made by others and us. First, AE2 mRNA was shown to be the major AE isoform in the testis [33] when evaluated by probing testicular RNA with either AE1-, AE2-, or AE3-specific probes. Second, of the multiple different variants found in other tissues (AE2a-c) of both the rat and chicken [19–22], the full-length AE2 mRNA (AE2a, 4.4 kb) was found to be the predominant form in the testis [33]. Accordingly, we detected only a single 4.4-kb AE2 mRNA species in both human and rat testicular RNA when probed with either a PstI-fragment [12] or EcoRI-SacI fragment (this study) of AE2 cDNA. Third, we showed by using in situ hybridization that AE2 mRNA is expressed throughout the testicular seminiferous tubules, including developing sperm cells, although some of the hybridization signal probably comes also from Sertoli and peritubular myoid cells, as AE2 is ubiquitously expressed in various tissues and cell types. These findings are also consistent with our previous immunological evidence, showing that an AE polypeptide is present both in developing sperm cells and in fully matured spermatozoa [12].
Sequencing of the clones did not reveal major differences between our sequence and the recently published AE2 sequence derived from the genomic clones [14]. The cloned cDNA contained 3896 bp with 3726-bp open reading frame, 169-bp 3'-noncoding region including the poly(A) tail, and 83-bp 5'-noncoding region. We found four amino acid discrepancies in comparison to AE2 exons, i.e., Q instead of R157, Y instead of H364, E instead of D495, and L instead of V496. Three of these (Q157, D495, and L496) are found to be identical in other mammalian species. In addition, we found six nucleotide disparities that do not cause amino acid changes. The differences found between published AE2 sequences and our sequence may be due to sequencing method(s) and/or polymorphism.
Spermatozoa develop from the primitive sperm cells or spermatogonia lying in the basal layer of the seminiferous tubules. Spermatogonia divide and enter the meiotic cycle, eventually forming haploid spermatids. During spermiogenesis, spermatids undergo several morphological changes including condensation of the nucleus, formation of acrosome, loss of most of the cytoplasm and its organelles, and the development of the tail. Altogether, spermiogenesis can be divided into 19 steps according to morphological alterations of the acrosomic system and of the nucleus [34].
In situ hybridization analyses suggested that AE2 mRNA expression in the seminiferous tubules of rat testis is not completely uniform, in that not all tubules showed as a prominent signal as others (see Fig. 2, B and C). We therefore evaluated the expression levels of AE2 mRNA at different stages during the epithelial cell cycle by using RT-PCR analysis. Total RNA isolated from developmentally defined tubular segments were used as templates for the RT-PCR. Compatible with our in situ hybridization data, our results showed that although AE2 mRNA is expressed throughout the spermatogenesis, some variability in the expression level is evident between the various stages of the epithelial cell cycle (Fig. 3). Strongest expression was observed at stages VIIab–IX and XI–XII, while a weaker expression was observed at stages I–VI and X. The rise observed in the AE2 mRNA expression level at stage VII thus coincides well with the period when major structural and morphological changes take place during sperm cell development. These include, for example, orientation of the acrosomic system toward the basal membrane, formation of the tail, and elongation of the spermatids and the nucleus. Overall RNA synthesis is also highest during these stages, ceasing after stage VIII. The reason for the lower expression at stage X is not exactly known. However, elongation of the spermatids initiates at stage IX, extending over stages X–XI, and may thus influence the mRNA expression at these stages. Moderate expression at stages I–VI may result from early spermatids or from a predominant presence of late spermatids (steps 15–18) at these stages. As AE2 mRNA is ubiquitously expressed in nearly all cells and tissues examined, including Sertoli cells, more detailed studies and different methodology are required to clarify whether AE2 mRNA expression in developing sperm cells is indeed restricted to only certain stages of the epithelial cell cycle.
In conclusion, we have cloned and sequenced the testicular AE2 gene product, and we show that the cloned full-length AE2 mRNA is expressed in developing sperm cells. On the basis of these two criteria and our previous immunological evidence [12], we suggest that the AE2 isoform is the sperm cell anion exchanger that regulates bicarbonate entry into mature spermatozoa and thus their motility in vivo. These results do not exclude the possibility that AE2 may be required for other functions, e.g., for acrosome reaction during fertilization, which is also known to be bicarbonate dependent. Identification of sperm cell AE as AE2 isoform now makes it possible to study its functional role in sperm cells and in heterologous cells.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Current address: University of Turku, Department of Physiology, Kiinamyllynkatu 10, FIN-20520 Turku, Finland.
Accepted: May 14, 1999.
Received: September 1, 1998.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  N. Satake, R. M. A. Elliott, P. F. Watson, and W. V. Holt Sperm selection and competition in pigs may be mediated by the differential motility activation and suppression of sperm subpopulations within the oviduct J. Exp. Biol., April 15, 2006; 209(8): 1560 - 1572. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. F. Medina, S. Recalde, J. Prieto, J. Lecanda, E. Saez, C. D. Funk, P. Vecino, M. A. van Roon, R. Ottenhoff, P. J. Bosma, et al. Anion exchanger 2 is essential for spermiogenesis in mice PNAS, December 23, 2003; 100(26): 15847 - 15852. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Bohring and W. Krause Immune infertility: towards a better understanding of sperm (auto)-immunity: The value of proteomic analysis Hum. Reprod., May 1, 2003; 18(5): 915 - 924. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Holappa, M. Suokas, P. Soininen, and S. Kellokumpu Identification of the Full-length AE2 (AE2a) Isoform as the Golgi-associated Anion Exchanger in Fibroblasts J. Histochem. Cytochem., February 1, 2001; 49(2): 259 - 270. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
