|
|
||||||||
Articles |
a Departments of Animal Science, Infectious Disease and Physiology,
b and Biochemistry and Molecular Biology,
c Oklahoma State University, Stillwater, Oklahoma 74078-6051
d Department of Animal Science, Iowa State University, Ames, Iowa 50011
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Pig conceptuses are noninvasive in utero, forming the diffuse, epitheliochorial placenta of this species [6]. It is hypothesized that glycoproteins present in the glycocalyx on the uterine luminal epithelium aid in attachment of the conceptus to the uterine surface. Previously, this laboratory isolated and characterized a glycoprotein that is homologous to inter-
-trypsin inhibitor heavy chain 4 (I
IH4) [7]. It has been proposed that the I
I family members play a role in extracellular matrix stabilization (see [8]). Heavy chains of the I
I family contain binding sites for calcium, associate with hyaluronan [9], and possess a von Willebrand type A domain that functions as a target for adhesion molecules like integrins, collagen, and heparin (see [10]). Unique in relation to other I
I family members, I
IH4 contains a cleavage site for the serine protease, kallikrein [11]. Kallikrein is an active member in the kininogen-kallikrein-kinin (K-K-K) system in which kallikrein cleaves kininogen to release the vasoactive peptide, bradykinin [12]. The K-K-K system has been shown to be involved in reproductive functions such as ovulation [13] and implantation in the rat [14]. Corthorn and coworkers [15] demonstrated that estrogens play a role in stimulating kallikrein release. Kallikrein has also been shown to cleave porcine plasma I
IH4 into 100- and 35-kDa fragments, further cleaving the 100-kDa into a 70-kDa fragment [16]. A 30-kDa fragment corresponding to the C-terminal of I
IH4 has been detected within the uterine lumen during the time of porcine conceptus elongation and attachment [17]. These results suggest that kallikrein may be present within the uterine lumen of the pig and that it possibly helps regulate alterations in I
IH4 necessary for conceptus attachment and placental development. Therefore the objective of the current study was to determine whether endometrial kallikrein enzymatic activity, protein, and endometrial gene expression are detectable during the estrous cycle and early pregnancy in the pig.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Samples analyzed in the study were collected from animals in the swine herds at Oklahoma State University (experiment 1) and Iowa State University (experiment 2). Cyclic, crossbred gilts of similar age (810 mo) and weight (100130 kg) were checked twice daily for estrous behavior with intact boars. Onset of estrus was considered Day 0 of the estrous cycle. Gilts assigned to be mated were bred naturally with fertile boars at the onset of estrus and 12 h later.
Experiment I: Evaluation of Endometrial Secretory Kallikrein Activity and Gene Expression in Cyclic and Pregnant Gilts
Cyclic gilts (n = 12) and pregnant gilts (n = 11) were hysterectomized on Day 10, 12, or 15 for collection of uterine flushings (UTF) as previously described [18]. Endometrium for RNA extraction was collected from three additional cyclic gilts on Days 0 (n = 1) and 5 (n = 2), as well as from cyclic gilts on Days 10 (n = 4), 12 (n = 4), and 15 (n = 4) and pregnant gilts on Days 10 (n = 3), 12 (n = 4), and 15 (n = 4).
Collection of UTF and Endometrium
After surgical removal of the uterine horns as previously described [18], UTF and endometrium were obtained by isolating one horn and flushing with 20 ml of PBS (pH 7.4). UTF were placed on ice until centrifugation (2500 x g, 10 min; 4°C). After flushing, this horn was cut along its antimesometrial border; endometrium was collected and snap frozen in liquid nitrogen, and tissue was stored at -80°C. The remaining uterine horn was immediately placed in a sterile container and transported on ice for use in explant culture studies. Throughout the culture procedure, sterility was maintained. Endometrium was removed from the mesometrial side and diced into 4 x 4-mm sections. A total of 0.5 g explant tissue was placed in 15 ml Dulbecco's modified Eagle's medium (MEM) (Gibco/Life Sciences, Gaithersburg, MD) and 2% (v:v) antibiotic-antimycotic (Gibco/Life Sciences). After 3 h, medium was replaced with fresh medium to remove serum leaching from the tissue. Endometrial explant cultures were incubated in air on a rocking platform (4 cycles/min) for an additional 24 h in MEM at 37°C. Endometrial explant culture medium (ECM) was centrifuged (2500 x g; 10 min). All tissue and fluid samples were stored at -80°C until analyzed.
Experiment 2: Evaluation of Conceptus Effects on Uterine Kallikrein
In order to obtain a range of conceptus sizes, uterine horns were flushed in situ on Days 10.5 (n = 2), 11 (n = 8), 11.5 (n = 25), and 12 (n = 8) of pregnancy as previously described [19]. Upon recovery, UTF were centrifuged, and the supernatant was recovered and immediately frozen on dry ice. UTF were stored at -80°C until assayed. Flushings were assigned to classifications based on the largest conceptus size in the litter as follows: < 5 mm (n = 7), 510 mm (n = 14), ovoid and tubular (n = 7), and filamentous (n = 15).
Estradiol-17ß RIA
Estradiol-17ß in UTF was quantified by RIA as previously described [20] and as validated for UTF estradiol-17ß by Wilson and Ford [19]. Samples (100 µl) were assayed in duplicate. The sensitivity of the assay was 2 pg/tube. The intra- and interassay coefficients of variation were 4.5% and 12.2%, respectively.
Microconcentration and Protein Determination
UTF and ECM samples were prepared for enzyme assay by concentrating 4 ml of sample using Centricon 10 microconcentrators (Amicon, Beverly, MA) with a cut-off of Mr 10 000. Protein content of samples was determined by the method of Lowry et al. [21] using BSA as a standard. Concentrated samples were stored at -80°C until analyzed.
Enzyme Assay
The assay of kallikrein followed closely the fluorescence assay procedure described in Zimmerman et al. [22]. A Perkin-Elmer (Norwalk, CT) 650-40 fluorescence spectrophotometer with thermostatically controlled cell holders was maintained near 25°C. Samples were assayed utilizing cuvettes of 2.0 mm and 10.0 mm in the excitation and emission directions, respectively. The short excitation path of these cells reduced self-absorption of the excitation light. Excitation and emission wavelengths were 370 and 460 nm, respectively, and excitation and emission slit-widths were both 5 mm. These wavelengths are not those of maximum excitation and emission of the substrate but, rather, those that give minimal emission of the substrate while still giving substantial fluorescence of the products with the slit-widths used. The assay buffer was 0.10 M Tris-HCl, 0.15 M NaCl, pH 8.0, at room temperature. The substrate, Pro-Phe-Arg-methycoumarylamide (MCA; Sigma Chemical Co., St. Louis, MO), was initially dissolved in dimethyl sulfoxide and diluted to a concentration of 0.87 mM in assay buffer as determined by the absorbance at 351 nm of a diluted sample using an absorptivity of 1.8 x 104 M-1 · cm-1 [23]. Porcine pancreatic kallikrein (Calbiochem, La Jolla, CA) was used to test the assay procedure.
Biological samples and assay substrate were maintained on ice. A standard curve was recorded using the fluorescent cleavage product of MCA, aminomethyl coumarin (Sigma), at 0.20, 0.50, 0.75, 1.00, and 1.50 µM in the fluorescence cuvette prior to measurement of sample. Kallikrein activity of the uterine samples was determined with 40 µl of concentrated UTF or ECM in 250-µl total assay volume containing the buffer and 35 µM of the MCA substrate. Enzyme activities were determined from duplicate measurements of fluorescence versus time using the initial linear portion of the curve. These initial velocity periods usually lasted for about 1 min. These velocities were converted by means of the standard curve to enzyme-specific activities in units of µmol product per minute per milligram of protein.
Specificity of Enzyme Assay
Kallikrein activity in UTF and ECM was validated through addition of the synthetic kallikrein inhibitor, cyclohexylacetyl-phe-arg-ser-val-gln amide (Sigma). The inhibitor was added to a UTF sample of known activity. Briefly, increasing concentrations of inhibitor (0, 1, 25, 50, 75, 100, to 200 mM) were added to enzyme buffer containing 10 µl of 0.87 mM MCA. After 40 µl of UTF sample was added, the cuvette was immediately placed in the fluorescent spectrophotometer, and enzyme activity was recorded as described above.
Western Blot Analysis
UTF and ECM (experiment I) were analyzed by Western blotting for the presence of immunoreactivity to antiserum against human plasma kallikrein (Calbiochem). Polypeptides in UTF and ECM (50 µg total protein) were separated by 12.5% one-dimensional SDS-PAGE [24] and immediately transferred to polyvinylidene fluoride membrane (Millipore Corporation, Bedford, MA) at 150 mA constant current for 35 min. Since antiserum was developed to human plasma kallikrein, human plasma was utilized as a positive control. After electroblotting, the membranes were washed in TBS (20 mM Tris, 500 mM NaCl, pH 7.5) and incubated for 1 h with the first blocking solution of 3% gelatin in TBS. After washing in Tween-TBS (TTBS; 20 mM Tris, 500 mM NaCl, 0.05% Tween 20, pH 7.5) for 10 min, membranes were incubated overnight with the first antibody (1:200 dilution) in 1% gelatin TTBS. The next day, membranes were washed twice in TTBS and twice in TBS, and then immunoreactive polypeptides were detected using the Bio-Rad Immuno-Blot kit (Bio-Rad, Hercules, CA) according to manufacturer's specifications.
RNA Extraction and Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
RNA from endometrium, kidney, muscle, and conceptuses was extracted using Trizol reagent (Gibco/Life Sciences) according to manufacturer's specifications. Total RNA was quantified spectrophotometrically by absorbance at 260 nm. RNA purity was determined from calculations of 260/280 ratios. The extraction procedure consistently yielded 260/280 ratios of 1.72.0, indicating very low protein contamination of total RNA preparation. Integrity of the RNA was checked via gel electrophoresis.
Total RNA was reverse transcribed to cDNA using Moloney murine leukemia virus reverse transcriptase (Promega Corporation, Madison, WI). Quality and quantity of endometrial cDNA was checked by evaluating PCR expression of glyceraldehyde-3-phosphate dehydrogenase as previously described [25].
Kallikrein Primer, Optimization, and Sequencing
Kallikrein primers were first designed to regions of homology between the amino acid sequence of porcine pancreatic kallikrein [26] and human kidney kallikrein [27], as the nucleotide sequence for porcine tissue kallikrein is unknown. The nucleotide sequence of human kidney kallikrein (169603 base pairs [bp]) [27] coinciding with homologous amino acid regions between porcine pancreas and human kidney was utilized to design the 5' TGACTACAGTCCACGACCTCATG and 3' GCAGGTTGGCAGGTGCTGCC primers. The optimal conditions used for kallikrein gene amplification were 25 mM MgCl, 100 µM dNTPs, 250 nM primer. To verify PCR product as glandular kallikrein, pooled cDNA was amplified with the previously described optimal conditions, run on a 4% agarose gel, and stained with ethidium bromide; bands were cut from the gel with a razor blade. The PCR product was then extracted using Qiaquick (Qiagen, Santa Clarita, CA) and was sequenced by the Recombinant DNA/Protein Research Facility at Oklahoma State University. The 109-bp PCR product was determined to be 89% homologous to baboon glandular kallikrein (GenBank accession number L43121). Endometrial and conceptus cDNA samples (3 µg) obtained across the estrous cycle and early pregnancy were amplified by the PCR conditions described above.
Statistical Analysis
Data were statistically analyzed by least-squares ANOVA using the General Linear Models of the Statistical Analysis System [28]. In experiment 1, there was no significant difference in UTF kallikrein activity (P > 0.10) between the uterine horn flushed immediately upon hysterectomy and the uterine horn flushed in the laboratory. Therefore, data from the two horns were combined for analysis. The model used to analyze UTF kallikrein enzymatic activity in UTF and ECM included effects of day, reproductive status, and day x reproductive status interaction. Day comparisons of kallikrein activity in UTF and ECM were analyzed using Wilcoxon's signed-rank test comparing cyclic and pregnant UTF and ECM on each day.
In experiment 2, kallikrein activity and estradiol-17ß content were analyzed with a model that included the effect of conceptus classification. In addition, associations among UTF kallikrein and estradiol-17ß content and conceptus size were analyzed using Spearman correlation coefficients.
| RESULTS |
|---|
|
|
|---|
Specificity of the assay for kallikrein was determined through addition of the specific kallikrein inhibitor, cyclohexylacetyl-phe-arg-ser-val-gln amide, to a sample of UTF containing kallikrein activity. Addition of increasing amounts of inhibitor caused a decrease in kallikrein activity (Fig. 1). Fifty percent inhibition of enzyme activity in the sample was observed at 35 µM, with kallikrein activity completely abolished with addition of 200 µM inhibitor.
|
Experiment 1
There was a significant day x reproductive status interaction (P < 0.001) in kallikrein enzymatic activity in UTF. Kallikrein enzymatic activity in UTF was low on Day 10 of the estrous cycle and during pregnancy (Fig. 2). Enzymatic activity in UTF increased in both cyclic and pregnant animals on Days 12 and 15. Kallikrein activity in Day 12 pregnant UTF was greater (P < 0.06) than that in cyclic UTF. However, on Day 15, cyclic UTF had greater (P < 0.05) kallikrein activity than pregnant UTF.
|
No day x reproductive status interaction was detected for ECM enzymatic activity. Total enzymatic activity in ECM was affected by day (P < 0.09) and reproductive status (P < 0.05). Enzymatic activity in Day 10 cyclic and pregnant ECM (Fig. 3) did not differ; however, endometrial secretion of kallikrein in explant culture was approximately 2-fold greater in Day 12 pregnant than in cyclic gilts. Enzyme activity in ECM declined on Day 15 of the estrous cycle and pregnancy and was not statistically different between cyclic and pregnant gilts.
|
Western Blot Analysis
Antiserum to human plasma kallikrein detected a 50-kDa immunoreactive product in UTF and ECM across Days 10 to 15 of the estrous cycle and early pregnancy. A similar reactive band was present in human plasma. Intensity of immunostaining was variable, but it appeared to increase in Day 12 and Day 15 UTF from either cyclic or pregnant gilts (Fig. 4). In UTF, a 23-kDa immunoreactive product was usually absent on Day 10 of the estrous cycle or pregnancy, but it appeared regardless of reproductive status on Days 12 and 15. The 23-kDa immunoreactive reactive product appeared to correspond to kallikrein enzymatic activity in UTF. Only the 50-kDa immunoreactive product was detected with kallikrein antiserum in ECM, and it was similar between cyclic and pregnant gilts (data not shown).
|
Kallikrein Gene Expression
Endometrial gene expression of glandular kallikrein was detected on Days 0, 5, 10, 12, and 15 of the estrous cycle and in early pregnancy (Fig. 5). Gene expression for kallikrein was also detected in Day 12 porcine conceptuses (large spherical and filamentous), muscle, and kidney (data not presented).
|
Experiment 2
As conceptuses increased in size from 2-mm spheres to filamentous forms, UTF estradiol-17ß content also increased progressively (r = 0.87, P < 0.001; Fig. 6a). Similarly, kallikrein activity in UTF increased progressively with conceptus size (r = 0.47, P < 0.01; Fig. 6b). Further, the amount of UTF kallikrein activity was associated with the content of estradiol-17ß in the same flushings (r = 0.41, P < 0.01).
|
Figure 7 presents the uterine luminal content of estrogen and kallikrein activity when flushings were classified by conceptus size. Uterine luminal content of estradiol-17ß increased (P < 0.01) with conceptus development from 5-mm spherical morphology to tubular and filamentous morphology (Fig. 7). Estradiol-17ß increased 3-fold in the UTF when tubular and filamentous conceptuses were present. Kallikrein enzymatic activity also increased over 3-fold when conceptuses rapidly expanded to filamentous morphology.
|
| DISCUSSION |
|---|
|
|
|---|
In the present study we detected the presence of endometrial kallikrein enzymatic activity, protein, and gene expression during the estrous cycle and early pregnancy of the pig. Antiserum to human plasma kallikrein detected an approximate 50-kDa product in UTF and ECM that was similar to the product in human plasma. Enzymatic activity in the UTF was associated with detection of a 23-kDa product on Days 12 and 15. The 50-kDa product may represent prokallikrein that is cleaved to form the active 23-kDa kallikrein. These data are consistent with the molecular size of tissue kallikreins that are reported to range from 24 to 45 kDa [30]. Kallikrein activity in UTF increased from low activity on Day 10 to a 3-fold increase in activity on Days 12 and 15 of the estrous cycle and pregnancy. Increased enzyme activity occurs in the pig uterine lumen on or shortly after Day 10 of the estrous cycle or pregnancy, as no kallikrein activity in porcine UTF prior to Day 10 was detected in a previous study [31]. The increase in kallikrein activity on Day 12 is temporally associated with the loss of uterine epithelial progesterone receptor, period of maternal recognition of pregnancy, and initial stages of trophoblast attachment in the pig [2]. It is proposed that release of kallikrein into the uterine lumen by estrogen in the rat is involved with events necessary for blastocyst implantation [14, 15]. In the rat, estrogen necessary for implantation comes from developing follicles on the ovary. In the pig, increase in uterine kallikrein enzyme activity occurred in both cyclic and pregnant animals, suggesting that the enzyme could play a role in assisting with opening sites for conceptus attachment through cleavage of I
IH4 as previously suggested by our laboratory [7]. It has been proposed that timing of porcine conceptus attachment to the uterine surface occurs through loss of the suggested antiadhesive molecule, MUC-1, following down-regulation of uterine epithelial progesterone receptor after 810 days of progesterone stimulation [32]. With reduction in MUC-1, the conceptus can interact with adhesion molecules such as integrins, proteoglycans, and heparin [32]. All I
IH contain a von Willebrand type A domain that functions as a target for adhesion molecules [10]. Cleavage of I
IH4 by kallikrein may serve to assist in the initial stages of porcine conceptus attachment.
Analysis of UTF in experiment 2 suggests that the conceptus may enhance kallikrein activity on Day 12 of pregnancy. Although the increase in UTF estradiol-17ß is associated with kallikrein activity, the large increase in uterine kallikrein activity really occurs during conceptus elongation (filamentous stage) throughout the uterine horn. The current design of our studies does not allow us to establish whether the local stimulation of kallikrein activity occurs through either progesterone regulation of the maternal endometrium, conceptus release of estrogen, or another conceptus secretory factor. The presence of kallikrein in Day 12 and Day 15 UTF of cyclic gilts indicates that kallikrein activity is not induced by the conceptus but is associated with normal changes in protein secretion that occurs during this critical period in pregnancy of the pig [33]. During pregnancy, kallikrein activity may be enhanced as the conceptus expands through the uterine lumen on Day 12. However, further experimentation needs to be done for a full understanding of whether and how estrogen may be regulating the kallikrein enzyme activity.
The presence of kallikrein mRNA in the endometrium throughout the cycle suggests that kallikrein may be synthesized and stored until its release or activation on Day 12. Valdes et al. [14] detected glandular kallikrein in secretory vesicles in the rat endometrium. Kallikrein was released from storage vesicles after the stimulation of ovarian estrogen on Day 5 [14]. Production of estradiol-17ß by the pig conceptus would suggest a similar mechanism for the timing or enhanced release of kallikrein into the uterine lumen in the pig, as secretory vesicles are released from the uterine epithelium on Day 12 [2]. Porcine conceptuses also express the gene for tissue kallikrein. Assuming that translation occurs, the conceptus may also contribute to the local effects of kallikrein on the uterine microenvironment. Although we have demonstrated endometrial gene expression for glandular kallikrein, further studies are necessary to determine whether gene expression is altered during the estrous cycle and early pregnancy. Increase in uterine kallikrein could be through increase in gene expression or activation of kallikrein activity from prokallikrein.
Detection of kallikrein activity in the uterus also suggests the possibility of a functional K-K-K system in the porcine uterus as has been documented in the uterus of rodents [14, 34]. Tissue kallikrein cleaves low-molecular weight kininogen and releases kinins, namely bradykinin (see [12]). Kinins have many bioactive properties, including increased blood flow, decreased membrane permeability, contraction of smooth muscle, release of calcium, and release of prostaglandins [12, 35], all of which occur during the time of porcine conceptus elongation and implantation (see [2]). The porcine endometrium expresses and secretes low-molecular weight kininogen (unpublished results), and kinin-ß2 receptor gene expression is increased between Days 10 and 15 of pregnancy in the pig [36]. Therefore, it is possible that kallikrein functions to facilitate attachment, as well as to cleave low-molecular weight kininogen releasing bradykinin on Day 12.
Recently, Lee et al. [37] reported the presence of a unidentified serine protease that degrades several of the insulin-like growth factor binding proteins (IGFBP) present in the pig uterine lumen prior to conceptus elongation. The protease degradation of IGFBPs was absent in pregnant UTF that contained spherical (110 mm) embryos but totally removed IGFBP-2 and -3 when tubular and filamentous conceptuses were present. Kallikrein is a serine protease that could function directly or indirectly through activation of several matrix metalloproteinases to degrade IGFBP [38]. We have detected protease activity to IGFBPs in Day 12 and 15 pregnant and cyclic gilt UTF (unpublished results). Specific inhibitors to kallikrein and matrix metalloproteinases inhibit porcine UTF degradation of recombinant human IGFBP-2, -3, and -5 (unpublished results). Increase in kallikrein enzyme activity after Day 10 could stimulate the release of IGFs from their binding proteins to enhance conceptus growth and estrogen synthesis to establish pregnancy.
Although this study is essentially observational, evidence that kallikrein enzymatic activity in the pig uterine lumen increases at crucial stages in conceptus development suggests that kallikrein may be involved in several biological processes essential to conceptus elongation and trophoblast attachment.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 Correspondence: Rodney D. Geisert, Department of Animal Science, Animal Science Building, Rm 114, Oklahoma State University, Stillwater, OK 74078-6051. FAX: 405 744 7390; geisert{at}okway.okstate.edu ![]()
3 Current address: Department of Animal Science, Iowa State University, Ames, IA 50011. ![]()
Accepted: June 8, 1999.
Received: December 3, 1998.
| REFERENCES |
|---|
|
|
|---|
by the uterine endometrium. Prostaglandins 1977; 14:397401.[CrossRef][Medline]
-trypsin inhibitor heavy chain-like protein in the pig endometrium during the oestrous cycle and early pregnancy. J Reprod Fertil 1998; 114:3543.
-trypsin inhibitor proteoglycan family: a group of proteins binding and stabilizing the extracellular matrix. Eur J Biochem 1998; 252:339346.[Medline]
-trypsin inhibitor, to hyaluronan. J Biol Chem 1995; 270:2665726663.
-inhibitor family: from structure to regulation. Biochem J 1996; 315:19.
-trypsin inhibitor family heavy chain-related protein. J Biochem 1996; 119:577584.
-hydroxylase expression between late preimplantation Meishan and Yorkshire conceptuses. Biol Reprod 1997; 56:380385.[Abstract]This article has been cited by other articles:
![]() |
S C Fernando, J S Buck, M D Ashworth, J W Ross, R D Geisert, and U DeSilva Porcine endometrial and conceptus tissue kallikrein 1, 4, 11, and 14 gene expression. Reproduction, December 1, 2006; 132(6): 939 - 947. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.A. Vonnahme, S.C. Fernando, J.W. Ross, M.D. Ashworth, U. DeSilva, J.R. Malayer, and R.D. Geisert Porcine Endometrial Expression of Kininogen, Factor XII, and Plasma Kallikrein in Cyclic and Pregnant Gilts Biol Reprod, January 1, 2004; 70(1): 132 - 138. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Ross, J. R. Malayer, J. W. Ritchey, and R. D. Geisert Characterization of the Interleukin-1{beta} System During Porcine Trophoblastic Elongation and Early Placental Attachment Biol Reprod, October 1, 2003; 69(4): 1251 - 1259. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Allen, B. R. Zhang, A. M. Hettinger, D. W. Goad, J. R. Malayer, and R. D. Geisert Detection of Bradykinin and Bradykinin-{beta}2 Receptors in the Porcine Endometrium During the Estrous Cycle and Early Pregnancy Biol Reprod, March 1, 2002; 66(3): 574 - 579. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Figueroa, C. Chacón, J. Corthorn, P. Ehrenfeld, W. Müller-Esterl, and G. Valdés Temporospatial Changes of Kinin B2 Receptors During the Estrous Cycle and Pregnancy in the Rat Uterus Biol Reprod, June 1, 2001; 64(6): 1590 - 1599. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |