Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vonnahme, K. A.
Right arrow Articles by Geisert, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vonnahme, K. A.
Right arrow Articles by Geisert, R. D.
Agricola
Right arrow Articles by Vonnahme, K. A.
Right arrow Articles by Geisert, R. D.
Biology of Reproduction 61, 1235-1241 (1999)
© 1999 Society for the Study of Reproduction, Inc.


Articles

Detection of Kallikrein Gene Expression and Enzymatic Activity in Porcine Endometrium During the Estrous Cycle and Early Pregnancy1

Kimberly A. Vonnahme3,a, Jerry R. Malayerb, H. Olin Spiveyc, Stephen P. Fordd, Archie Cluttera, and Rodney D. Geisert2,a

a Departments of Animal Science, Infectious Disease and Physiology, b and Biochemistry and Molecular Biology, c Oklahoma State University, Stillwater, Oklahoma 74078-6051 d Department of Animal Science, Iowa State University, Ames, Iowa 50011


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Porcine conceptuses rapidly elongate within the uterine horns prior to the period of placental attachment. During the time of elongation, secretion of estrogen by the developing conceptuses occurs for the establishment of pregnancy through maintenance of corpora lutea and facilitation of placental attachment. Factors associated with the uterine luminal epithelium accentuate embryo attachment by allowing close contact between the conceptus and the uterine epithelium. Kallikrein, a serine protease, may be involved with the timing of conceptus expansion and placental attachment to the uterine surface. The objective of this study was to evaluate kallikrein enzymatic activity, protein, and gene expression in the pig during the estrous cycle and early pregnancy. Enzymatic activity was first detected in uterine flushings (UTF) on Day 12 of the estrous cycle and pregnancy. Activity was enhanced on Day 12 of pregnancy compared to that in cyclic gilts, with a reversal of increased kallikrein activity in cyclic compared to pregnant flushings on Day 15. Western blot analysis with antiserum to human plasma kallikrein detected a 50-kDa product similar to human plasma kallikrein from Day 10 to Day 15 of the estrous cycle and pregnancy. Kallikrein enzymatic activity in UTF was associated with the presence of a 23-kDa reactive product. Gene expression of kallikrein as determined by reverse transcription-polymerase chain reaction indicated the presence of kallikrein mRNA in the porcine endometrium and conceptuses. Results indicate that an increase in uterine luminal kallikrein activity occurs during the estrous cycle at a period that corresponds to rapid conceptus elongation during pregnancy of the pig. The present information suggests that kallikrein may play a role in opening the window for establishment of pregnancy in the pig.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
During early pregnancy, porcine conceptuses undergo a rapid morphological transformation from a 10-mm sphere to a long filamentous thread within the course of a few hours on Day 12 of gestation [1]. This process is associated with the release of conceptus estradiol-17ß, which serves as the signal for maternal recognition of pregnancy in the pig [2]. Synthesis and release of estrogen by the porcine conceptus alter uterine secretion of proteins [3], prostaglandins [4], uterine blood flow [5], and uterine cellular morphology [1, 6]. Although a great amount of information is available pertaining to the influence of porcine conceptus estradiol-17ß on endometrial secretory activity, the factor or factors induced by conceptus estradiol-17ß to orchestrate uterine changes conducive to conceptus development and survival are not fully understood.

Pig conceptuses are noninvasive in utero, forming the diffuse, epitheliochorial placenta of this species [6]. It is hypothesized that glycoproteins present in the glycocalyx on the uterine luminal epithelium aid in attachment of the conceptus to the uterine surface. Previously, this laboratory isolated and characterized a glycoprotein that is homologous to inter-{alpha}-trypsin inhibitor heavy chain 4 (I{alpha}IH4) [7]. It has been proposed that the I{alpha}I family members play a role in extracellular matrix stabilization (see [8]). Heavy chains of the I{alpha}I family contain binding sites for calcium, associate with hyaluronan [9], and possess a von Willebrand type A domain that functions as a target for adhesion molecules like integrins, collagen, and heparin (see [10]). Unique in relation to other I{alpha}I family members, I{alpha}IH4 contains a cleavage site for the serine protease, kallikrein [11]. Kallikrein is an active member in the kininogen-kallikrein-kinin (K-K-K) system in which kallikrein cleaves kininogen to release the vasoactive peptide, bradykinin [12]. The K-K-K system has been shown to be involved in reproductive functions such as ovulation [13] and implantation in the rat [14]. Corthorn and coworkers [15] demonstrated that estrogens play a role in stimulating kallikrein release. Kallikrein has also been shown to cleave porcine plasma I{alpha}IH4 into 100- and 35-kDa fragments, further cleaving the 100-kDa into a 70-kDa fragment [16]. A 30-kDa fragment corresponding to the C-terminal of I{alpha}IH4 has been detected within the uterine lumen during the time of porcine conceptus elongation and attachment [17]. These results suggest that kallikrein may be present within the uterine lumen of the pig and that it possibly helps regulate alterations in I{alpha}IH4 necessary for conceptus attachment and placental development. Therefore the objective of the current study was to determine whether endometrial kallikrein enzymatic activity, protein, and endometrial gene expression are detectable during the estrous cycle and early pregnancy in the pig.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals

Samples analyzed in the study were collected from animals in the swine herds at Oklahoma State University (experiment 1) and Iowa State University (experiment 2). Cyclic, crossbred gilts of similar age (8–10 mo) and weight (100–130 kg) were checked twice daily for estrous behavior with intact boars. Onset of estrus was considered Day 0 of the estrous cycle. Gilts assigned to be mated were bred naturally with fertile boars at the onset of estrus and 12 h later.

Experiment I: Evaluation of Endometrial Secretory Kallikrein Activity and Gene Expression in Cyclic and Pregnant Gilts

Cyclic gilts (n = 12) and pregnant gilts (n = 11) were hysterectomized on Day 10, 12, or 15 for collection of uterine flushings (UTF) as previously described [18]. Endometrium for RNA extraction was collected from three additional cyclic gilts on Days 0 (n = 1) and 5 (n = 2), as well as from cyclic gilts on Days 10 (n = 4), 12 (n = 4), and 15 (n = 4) and pregnant gilts on Days 10 (n = 3), 12 (n = 4), and 15 (n = 4).

Collection of UTF and Endometrium

After surgical removal of the uterine horns as previously described [18], UTF and endometrium were obtained by isolating one horn and flushing with 20 ml of PBS (pH 7.4). UTF were placed on ice until centrifugation (2500 x g, 10 min; 4°C). After flushing, this horn was cut along its antimesometrial border; endometrium was collected and snap frozen in liquid nitrogen, and tissue was stored at -80°C. The remaining uterine horn was immediately placed in a sterile container and transported on ice for use in explant culture studies. Throughout the culture procedure, sterility was maintained. Endometrium was removed from the mesometrial side and diced into 4 x 4-mm sections. A total of 0.5 g explant tissue was placed in 15 ml Dulbecco's modified Eagle's medium (MEM) (Gibco/Life Sciences, Gaithersburg, MD) and 2% (v:v) antibiotic-antimycotic (Gibco/Life Sciences). After 3 h, medium was replaced with fresh medium to remove serum leaching from the tissue. Endometrial explant cultures were incubated in air on a rocking platform (4 cycles/min) for an additional 24 h in MEM at 37°C. Endometrial explant culture medium (ECM) was centrifuged (2500 x g; 10 min). All tissue and fluid samples were stored at -80°C until analyzed.

Experiment 2: Evaluation of Conceptus Effects on Uterine Kallikrein

In order to obtain a range of conceptus sizes, uterine horns were flushed in situ on Days 10.5 (n = 2), 11 (n = 8), 11.5 (n = 25), and 12 (n = 8) of pregnancy as previously described [19]. Upon recovery, UTF were centrifuged, and the supernatant was recovered and immediately frozen on dry ice. UTF were stored at -80°C until assayed. Flushings were assigned to classifications based on the largest conceptus size in the litter as follows: < 5 mm (n = 7), 5–10 mm (n = 14), ovoid and tubular (n = 7), and filamentous (n = 15).

Estradiol-17ß RIA

Estradiol-17ß in UTF was quantified by RIA as previously described [20] and as validated for UTF estradiol-17ß by Wilson and Ford [19]. Samples (100 µl) were assayed in duplicate. The sensitivity of the assay was 2 pg/tube. The intra- and interassay coefficients of variation were 4.5% and 12.2%, respectively.

Microconcentration and Protein Determination

UTF and ECM samples were prepared for enzyme assay by concentrating 4 ml of sample using Centricon 10 microconcentrators (Amicon, Beverly, MA) with a cut-off of Mr 10 000. Protein content of samples was determined by the method of Lowry et al. [21] using BSA as a standard. Concentrated samples were stored at -80°C until analyzed.

Enzyme Assay

The assay of kallikrein followed closely the fluorescence assay procedure described in Zimmerman et al. [22]. A Perkin-Elmer (Norwalk, CT) 650-40 fluorescence spectrophotometer with thermostatically controlled cell holders was maintained near 25°C. Samples were assayed utilizing cuvettes of 2.0 mm and 10.0 mm in the excitation and emission directions, respectively. The short excitation path of these cells reduced self-absorption of the excitation light. Excitation and emission wavelengths were 370 and 460 nm, respectively, and excitation and emission slit-widths were both 5 mm. These wavelengths are not those of maximum excitation and emission of the substrate but, rather, those that give minimal emission of the substrate while still giving substantial fluorescence of the products with the slit-widths used. The assay buffer was 0.10 M Tris-HCl, 0.15 M NaCl, pH 8.0, at room temperature. The substrate, Pro-Phe-Arg-methycoumarylamide (MCA; Sigma Chemical Co., St. Louis, MO), was initially dissolved in dimethyl sulfoxide and diluted to a concentration of 0.87 mM in assay buffer as determined by the absorbance at 351 nm of a diluted sample using an absorptivity of 1.8 x 104 M-1 · cm-1 [23]. Porcine pancreatic kallikrein (Calbiochem, La Jolla, CA) was used to test the assay procedure.

Biological samples and assay substrate were maintained on ice. A standard curve was recorded using the fluorescent cleavage product of MCA, aminomethyl coumarin (Sigma), at 0.20, 0.50, 0.75, 1.00, and 1.50 µM in the fluorescence cuvette prior to measurement of sample. Kallikrein activity of the uterine samples was determined with 40 µl of concentrated UTF or ECM in 250-µl total assay volume containing the buffer and 35 µM of the MCA substrate. Enzyme activities were determined from duplicate measurements of fluorescence versus time using the initial linear portion of the curve. These initial velocity periods usually lasted for about 1 min. These velocities were converted by means of the standard curve to enzyme-specific activities in units of µmol product per minute per milligram of protein.

Specificity of Enzyme Assay

Kallikrein activity in UTF and ECM was validated through addition of the synthetic kallikrein inhibitor, cyclohexylacetyl-phe-arg-ser-val-gln amide (Sigma). The inhibitor was added to a UTF sample of known activity. Briefly, increasing concentrations of inhibitor (0, 1, 25, 50, 75, 100, to 200 mM) were added to enzyme buffer containing 10 µl of 0.87 mM MCA. After 40 µl of UTF sample was added, the cuvette was immediately placed in the fluorescent spectrophotometer, and enzyme activity was recorded as described above.

Western Blot Analysis

UTF and ECM (experiment I) were analyzed by Western blotting for the presence of immunoreactivity to antiserum against human plasma kallikrein (Calbiochem). Polypeptides in UTF and ECM (50 µg total protein) were separated by 12.5% one-dimensional SDS-PAGE [24] and immediately transferred to polyvinylidene fluoride membrane (Millipore Corporation, Bedford, MA) at 150 mA constant current for 35 min. Since antiserum was developed to human plasma kallikrein, human plasma was utilized as a positive control. After electroblotting, the membranes were washed in TBS (20 mM Tris, 500 mM NaCl, pH 7.5) and incubated for 1 h with the first blocking solution of 3% gelatin in TBS. After washing in Tween-TBS (TTBS; 20 mM Tris, 500 mM NaCl, 0.05% Tween 20, pH 7.5) for 10 min, membranes were incubated overnight with the first antibody (1:200 dilution) in 1% gelatin TTBS. The next day, membranes were washed twice in TTBS and twice in TBS, and then immunoreactive polypeptides were detected using the Bio-Rad Immuno-Blot kit (Bio-Rad, Hercules, CA) according to manufacturer's specifications.

RNA Extraction and Reverse Transcription-Polymerase Chain Reaction (RT-PCR)

RNA from endometrium, kidney, muscle, and conceptuses was extracted using Trizol reagent (Gibco/Life Sciences) according to manufacturer's specifications. Total RNA was quantified spectrophotometrically by absorbance at 260 nm. RNA purity was determined from calculations of 260/280 ratios. The extraction procedure consistently yielded 260/280 ratios of 1.7–2.0, indicating very low protein contamination of total RNA preparation. Integrity of the RNA was checked via gel electrophoresis.

Total RNA was reverse transcribed to cDNA using Moloney murine leukemia virus reverse transcriptase (Promega Corporation, Madison, WI). Quality and quantity of endometrial cDNA was checked by evaluating PCR expression of glyceraldehyde-3-phosphate dehydrogenase as previously described [25].

Kallikrein Primer, Optimization, and Sequencing

Kallikrein primers were first designed to regions of homology between the amino acid sequence of porcine pancreatic kallikrein [26] and human kidney kallikrein [27], as the nucleotide sequence for porcine tissue kallikrein is unknown. The nucleotide sequence of human kidney kallikrein (169–603 base pairs [bp]) [27] coinciding with homologous amino acid regions between porcine pancreas and human kidney was utilized to design the 5' TGACTACAGTCCACGACCTCATG and 3' GCAGGTTGGCAGGTGCTGCC primers. The optimal conditions used for kallikrein gene amplification were 25 mM MgCl, 100 µM dNTPs, 250 nM primer. To verify PCR product as glandular kallikrein, pooled cDNA was amplified with the previously described optimal conditions, run on a 4% agarose gel, and stained with ethidium bromide; bands were cut from the gel with a razor blade. The PCR product was then extracted using Qiaquick (Qiagen, Santa Clarita, CA) and was sequenced by the Recombinant DNA/Protein Research Facility at Oklahoma State University. The 109-bp PCR product was determined to be 89% homologous to baboon glandular kallikrein (GenBank accession number L43121). Endometrial and conceptus cDNA samples (3 µg) obtained across the estrous cycle and early pregnancy were amplified by the PCR conditions described above.

Statistical Analysis

Data were statistically analyzed by least-squares ANOVA using the General Linear Models of the Statistical Analysis System [28]. In experiment 1, there was no significant difference in UTF kallikrein activity (P > 0.10) between the uterine horn flushed immediately upon hysterectomy and the uterine horn flushed in the laboratory. Therefore, data from the two horns were combined for analysis. The model used to analyze UTF kallikrein enzymatic activity in UTF and ECM included effects of day, reproductive status, and day x reproductive status interaction. Day comparisons of kallikrein activity in UTF and ECM were analyzed using Wilcoxon's signed-rank test comparing cyclic and pregnant UTF and ECM on each day.

In experiment 2, kallikrein activity and estradiol-17ß content were analyzed with a model that included the effect of conceptus classification. In addition, associations among UTF kallikrein and estradiol-17ß content and conceptus size were analyzed using Spearman correlation coefficients.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Kallikrein Enzymatic Activity

Specificity of the assay for kallikrein was determined through addition of the specific kallikrein inhibitor, cyclohexylacetyl-phe-arg-ser-val-gln amide, to a sample of UTF containing kallikrein activity. Addition of increasing amounts of inhibitor caused a decrease in kallikrein activity (Fig. 1). Fifty percent inhibition of enzyme activity in the sample was observed at 35 µM, with kallikrein activity completely abolished with addition of 200 µM inhibitor.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 1. Kallikrein enzymatic activity expressed as fluorescent units (FU) in a Day 15 pregnant UTF after addition of 1, 25, 50, 75, 100, or 200 µM of the synthetic kallikrein inhibitor, cyclohexylacetyl-phe-arg-ser-val-gln amide

Experiment 1

There was a significant day x reproductive status interaction (P < 0.001) in kallikrein enzymatic activity in UTF. Kallikrein enzymatic activity in UTF was low on Day 10 of the estrous cycle and during pregnancy (Fig. 2). Enzymatic activity in UTF increased in both cyclic and pregnant animals on Days 12 and 15. Kallikrein activity in Day 12 pregnant UTF was greater (P < 0.06) than that in cyclic UTF. However, on Day 15, cyclic UTF had greater (P < 0.05) kallikrein activity than pregnant UTF.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 2. Kallikrein enzyme activity in porcine UTF collected from cyclic and pregnant gilts on Days 10, 12, and 15. Columns with different superscripts are significantly different (P < 0.01)

No day x reproductive status interaction was detected for ECM enzymatic activity. Total enzymatic activity in ECM was affected by day (P < 0.09) and reproductive status (P < 0.05). Enzymatic activity in Day 10 cyclic and pregnant ECM (Fig. 3) did not differ; however, endometrial secretion of kallikrein in explant culture was approximately 2-fold greater in Day 12 pregnant than in cyclic gilts. Enzyme activity in ECM declined on Day 15 of the estrous cycle and pregnancy and was not statistically different between cyclic and pregnant gilts.



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 3. Kallikrein enzyme activity in endometrial culture media of uterine tissue collected from cyclic and pregnant gilts on Days 10, 12, and 15. a,bMean ± SEM within a day are significantly different (P < 0.01)

Western Blot Analysis

Antiserum to human plasma kallikrein detected a 50-kDa immunoreactive product in UTF and ECM across Days 10 to 15 of the estrous cycle and early pregnancy. A similar reactive band was present in human plasma. Intensity of immunostaining was variable, but it appeared to increase in Day 12 and Day 15 UTF from either cyclic or pregnant gilts (Fig. 4). In UTF, a 23-kDa immunoreactive product was usually absent on Day 10 of the estrous cycle or pregnancy, but it appeared regardless of reproductive status on Days 12 and 15. The 23-kDa immunoreactive reactive product appeared to correspond to kallikrein enzymatic activity in UTF. Only the 50-kDa immunoreactive product was detected with kallikrein antiserum in ECM, and it was similar between cyclic and pregnant gilts (data not shown).



View larger version (78K):
[in this window]
[in a new window]
 
FIG. 4. Western blot analysis of polypeptides in UTF from gilts taken on Days 10, 12, and 15 of the estrous cycle (C) and pregnancy (P). Human plasma (h-plasma) was used as a positive control

Kallikrein Gene Expression

Endometrial gene expression of glandular kallikrein was detected on Days 0, 5, 10, 12, and 15 of the estrous cycle and in early pregnancy (Fig. 5). Gene expression for kallikrein was also detected in Day 12 porcine conceptuses (large spherical and filamentous), muscle, and kidney (data not presented).



View larger version (50K):
[in this window]
[in a new window]
 
FIG. 5. Endometrial gene expression of glandular kallikrein on Days 0, 5, 10, 12, 15 of the estrous cycle (C) and Days 10, 12, 15 of pregnancy (P)

Experiment 2

As conceptuses increased in size from 2-mm spheres to filamentous forms, UTF estradiol-17ß content also increased progressively (r = 0.87, P < 0.001; Fig. 6a). Similarly, kallikrein activity in UTF increased progressively with conceptus size (r = 0.47, P < 0.01; Fig. 6b). Further, the amount of UTF kallikrein activity was associated with the content of estradiol-17ß in the same flushings (r = 0.41, P < 0.01).



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 6. a) Estradiol-17ß content associated with embryos of different sizes. b) Kallikrein activity associated with embryos of different sizes

Figure 7 presents the uterine luminal content of estrogen and kallikrein activity when flushings were classified by conceptus size. Uterine luminal content of estradiol-17ß increased (P < 0.01) with conceptus development from 5-mm spherical morphology to tubular and filamentous morphology (Fig. 7). Estradiol-17ß increased 3-fold in the UTF when tubular and filamentous conceptuses were present. Kallikrein enzymatic activity also increased over 3-fold when conceptuses rapidly expanded to filamentous morphology.



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 7. Comparison of kallikrein activity (open column) and estradiol-17ß (hatched column) content in UTF-containing conceptuses < 5 mm, 5–10 mm, ovoid and tubular (O/T), and filamentous (F). For estradiol-17ß content, values with different superscripts differ (P < 0.01); for kallikrein activity, values with different superscripts differ (P < 0.05)


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Porcine conceptuses undergo a rapid morphological change from a 10-mm sphere to a thin, filamentous thread within 4 h on Day 12 of gestation [1, 29]. During this rapid transformation, conceptuses secrete estradiol-17ß into the uterine lumen, which alters the uterine milieu [2]. Conceptus estradiol-17ß stimulates changes in endometrial morphology and secretory activity that are necessary for maintenance of pregnancy and conceptus attachment. However, the mechanism by which estradiol-17ß invokes these changes has not been completely elucidated.

In the present study we detected the presence of endometrial kallikrein enzymatic activity, protein, and gene expression during the estrous cycle and early pregnancy of the pig. Antiserum to human plasma kallikrein detected an approximate 50-kDa product in UTF and ECM that was similar to the product in human plasma. Enzymatic activity in the UTF was associated with detection of a 23-kDa product on Days 12 and 15. The 50-kDa product may represent prokallikrein that is cleaved to form the active 23-kDa kallikrein. These data are consistent with the molecular size of tissue kallikreins that are reported to range from 24 to 45 kDa [30]. Kallikrein activity in UTF increased from low activity on Day 10 to a 3-fold increase in activity on Days 12 and 15 of the estrous cycle and pregnancy. Increased enzyme activity occurs in the pig uterine lumen on or shortly after Day 10 of the estrous cycle or pregnancy, as no kallikrein activity in porcine UTF prior to Day 10 was detected in a previous study [31]. The increase in kallikrein activity on Day 12 is temporally associated with the loss of uterine epithelial progesterone receptor, period of maternal recognition of pregnancy, and initial stages of trophoblast attachment in the pig [2]. It is proposed that release of kallikrein into the uterine lumen by estrogen in the rat is involved with events necessary for blastocyst implantation [14, 15]. In the rat, estrogen necessary for implantation comes from developing follicles on the ovary. In the pig, increase in uterine kallikrein enzyme activity occurred in both cyclic and pregnant animals, suggesting that the enzyme could play a role in assisting with opening sites for conceptus attachment through cleavage of I{alpha}IH4 as previously suggested by our laboratory [7]. It has been proposed that timing of porcine conceptus attachment to the uterine surface occurs through loss of the suggested antiadhesive molecule, MUC-1, following down-regulation of uterine epithelial progesterone receptor after 8–10 days of progesterone stimulation [32]. With reduction in MUC-1, the conceptus can interact with adhesion molecules such as integrins, proteoglycans, and heparin [32]. All I{alpha}IH contain a von Willebrand type A domain that functions as a target for adhesion molecules [10]. Cleavage of I{alpha}IH4 by kallikrein may serve to assist in the initial stages of porcine conceptus attachment.

Analysis of UTF in experiment 2 suggests that the conceptus may enhance kallikrein activity on Day 12 of pregnancy. Although the increase in UTF estradiol-17ß is associated with kallikrein activity, the large increase in uterine kallikrein activity really occurs during conceptus elongation (filamentous stage) throughout the uterine horn. The current design of our studies does not allow us to establish whether the local stimulation of kallikrein activity occurs through either progesterone regulation of the maternal endometrium, conceptus release of estrogen, or another conceptus secretory factor. The presence of kallikrein in Day 12 and Day 15 UTF of cyclic gilts indicates that kallikrein activity is not induced by the conceptus but is associated with normal changes in protein secretion that occurs during this critical period in pregnancy of the pig [33]. During pregnancy, kallikrein activity may be enhanced as the conceptus expands through the uterine lumen on Day 12. However, further experimentation needs to be done for a full understanding of whether and how estrogen may be regulating the kallikrein enzyme activity.

The presence of kallikrein mRNA in the endometrium throughout the cycle suggests that kallikrein may be synthesized and stored until its release or activation on Day 12. Valdes et al. [14] detected glandular kallikrein in secretory vesicles in the rat endometrium. Kallikrein was released from storage vesicles after the stimulation of ovarian estrogen on Day 5 [14]. Production of estradiol-17ß by the pig conceptus would suggest a similar mechanism for the timing or enhanced release of kallikrein into the uterine lumen in the pig, as secretory vesicles are released from the uterine epithelium on Day 12 [2]. Porcine conceptuses also express the gene for tissue kallikrein. Assuming that translation occurs, the conceptus may also contribute to the local effects of kallikrein on the uterine microenvironment. Although we have demonstrated endometrial gene expression for glandular kallikrein, further studies are necessary to determine whether gene expression is altered during the estrous cycle and early pregnancy. Increase in uterine kallikrein could be through increase in gene expression or activation of kallikrein activity from prokallikrein.

Detection of kallikrein activity in the uterus also suggests the possibility of a functional K-K-K system in the porcine uterus as has been documented in the uterus of rodents [14, 34]. Tissue kallikrein cleaves low-molecular weight kininogen and releases kinins, namely bradykinin (see [12]). Kinins have many bioactive properties, including increased blood flow, decreased membrane permeability, contraction of smooth muscle, release of calcium, and release of prostaglandins [12, 35], all of which occur during the time of porcine conceptus elongation and implantation (see [2]). The porcine endometrium expresses and secretes low-molecular weight kininogen (unpublished results), and kinin-ß2 receptor gene expression is increased between Days 10 and 15 of pregnancy in the pig [36]. Therefore, it is possible that kallikrein functions to facilitate attachment, as well as to cleave low-molecular weight kininogen releasing bradykinin on Day 12.

Recently, Lee et al. [37] reported the presence of a unidentified serine protease that degrades several of the insulin-like growth factor binding proteins (IGFBP) present in the pig uterine lumen prior to conceptus elongation. The protease degradation of IGFBPs was absent in pregnant UTF that contained spherical (1–10 mm) embryos but totally removed IGFBP-2 and -3 when tubular and filamentous conceptuses were present. Kallikrein is a serine protease that could function directly or indirectly through activation of several matrix metalloproteinases to degrade IGFBP [38]. We have detected protease activity to IGFBPs in Day 12 and 15 pregnant and cyclic gilt UTF (unpublished results). Specific inhibitors to kallikrein and matrix metalloproteinases inhibit porcine UTF degradation of recombinant human IGFBP-2, -3, and -5 (unpublished results). Increase in kallikrein enzyme activity after Day 10 could stimulate the release of IGFs from their binding proteins to enhance conceptus growth and estrogen synthesis to establish pregnancy.

Although this study is essentially observational, evidence that kallikrein enzymatic activity in the pig uterine lumen increases at crucial stages in conceptus development suggests that kallikrein may be involved in several biological processes essential to conceptus elongation and trophoblast attachment.


    ACKNOWLEDGMENTS
 
The authors would like to thank Mr. Steve Welty for the care and feeding of the animals utilized in the study. Appreciation is expressed to Melanie Allen, Amy Baue, Melissa Diederich, Mike Looper, and Thea Pratt for their assistance with surgeries. The authors would like to thank the Oklahoma State University Recombinant DNA/Protein Resource Facility for the synthesis of synthetic nucleotides and DNA sequencing.


    FOOTNOTES
 
1 This research was supported by NRICGP/USDA grants 92-37203-7953, 98-35203-6224, and TRIP grant awarded to R.D.G. Back

2 Correspondence: Rodney D. Geisert, Department of Animal Science, Animal Science Building, Rm 114, Oklahoma State University, Stillwater, OK 74078-6051. FAX: 405 744 7390; geisert{at}okway.okstate.edu Back

3 Current address: Department of Animal Science, Iowa State University, Ames, IA 50011. Back

Accepted: June 8, 1999.

Received: December 3, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Geisert RD, Brookbank JW, Roberts RM, Bazer FW. Establishment of pregnancy in the pig: II. Cellular remodeling of the porcine blastocyst during elongation on day 12 of pregnancy. Biol Reprod 1982; 27:941–955.[CrossRef][Medline]
  2. Geisert RD, Zavy MT, Moffatt RJ, Blair RM, Yellin T. Embryonic steroids and the establishment of pregnancy in pigs. J Reprod Fertil Suppl 1990; 40:293–305.[Medline]
  3. Roberts RM, Trout WE, Mathialagan N, Stallings-Mann M, Ling P. Uterine secretory activity and embryonic development. In: Bavister BD (ed.), Preimplantation Embryo Development. New York: Springer-Verlag; 1993: 229–243.
  4. Bazer FW, Thatcher WW. Theory of maternal recognition of pregnancy in swine based on estrogen controlled endocrine versus exocrine secretion of prostaglandin F2{alpha} by the uterine endometrium. Prostaglandins 1977; 14:397–401.[CrossRef][Medline]
  5. Ford SP, Christenson RK, Ford JJ. Uterine blood flow and uterine arterial, venous and lumenal concentrations of oestrogens on days 11, 13, and 15 after oestrus in pregnant and non-pregnant sows. J Reprod Fertil 1982; 64:185–190.[Abstract/Free Full Text]
  6. Keys JL, King GL. Microscopic examination of porcine conceptus-maternal interface between days 10 and 19 of pregnancy. Am J Anat 1990; 188:221–238.[CrossRef][Medline]
  7. Geisert RD, Yelich JV, Pratt T, Pomp D. Expression of an inter-{alpha}-trypsin inhibitor heavy chain-like protein in the pig endometrium during the oestrous cycle and early pregnancy. J Reprod Fertil 1998; 114:35–43.[Abstract/Free Full Text]
  8. Bost F, Diarra-Mehrpour M, Martin J-P. Inter-{alpha}-trypsin inhibitor proteoglycan family: a group of proteins binding and stabilizing the extracellular matrix. Eur J Biochem 1998; 252:339–346.[Medline]
  9. Zhao M, Yoneda M, Ohashi Y, Kurono S, Iwata H, Ohnuki Y, Kimata K. Evidence for the covalent binding of SHAP, heavy chains of inter-{alpha}-trypsin inhibitor, to hyaluronan. J Biol Chem 1995; 270:26657–26663.[Abstract/Free Full Text]
  10. Salier JP, Rouet P, Raguenez G, Daveau M. The inter-{alpha}-inhibitor family: from structure to regulation. Biochem J 1996; 315:1–9.
  11. Nishimura H, Kakizaki I, Muta T, Sasaki N, Pu PX, Yamashita T, Nagasawa S. cDNA and deduced amino acid sequence of human PK-120, a plasma kallikrein-sensitive glycoprotein. FEBS Lett 1995; 357:207–211.[CrossRef][Medline]
  12. Bhoola KD, Figueroa CD, Worthy K. Bioregulation of kinins: kallikreins, kininogens, and kininases. Pharmacol Rev 1992; 44:1–80.[Medline]
  13. Gao X, Greenbaum LM, Mahesh VB, Brann DW. Characterization of the kinin system in the ovary during ovulation in the rat. Biol Reprod 1992; 47:945–951.[Abstract]
  14. Valdes G, Figueroa CD, Corthorn J. Temporospatial changes of kallikrein-like enzymes during the estrous cycle and pregnancy in the rat uterus. Biol Reprod 1996; 55:236–245.[Abstract]
  15. Corthorn J, Figueroa C, Valdes G. Estrogen and lumenal stimulation of rat uterine kallikrein. Biol Reprod 1997; 56:1432–1438.[Abstract]
  16. Hashimoto K, Tobe T, Sumiya J, Sano Y, Choi-Miura N, Ozawa A, Yasue H, Tomita M. Primary structure of the pig homologue of human IHRP: inter-{alpha}-trypsin inhibitor family heavy chain-related protein. J Biochem 1996; 119:577–584.[Abstract/Free Full Text]
  17. Geisert RD, Dixon MJ, Pratt T, Schmitt RAM, Lessley BA, McCann JP. Isolation and characterization of a 30-kDa endometrial glycoprotein synthesized during the estrous cycle and early pregnancy of the pig. Biol Reprod 1995; 53:1038–1050.[Abstract]
  18. Gries LK, Geisert RD, Zavy MT, Garrett JE, Morgan GL. Uterine secretory alterations coincident with embryonic mortality in the gilt after exogenous estrogen administration. J Anim Sci 1989; 67:276–284.
  19. Wilson ME, Ford SP. Differences in trophectoderm mitotic rate and P450 17{alpha}-hydroxylase expression between late preimplantation Meishan and Yorkshire conceptuses. Biol Reprod 1997; 56:380–385.[Abstract]
  20. Anderson LH, Christenson LK, Christenson RK, Ford SP. Investigations into the control of litter size in swine: II. Comparisons of morphological and functional diversity between Chinese and American breeds. J Anim Sci 1993; 71:1566–1571.[Abstract]
  21. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurements with the folin phenol reagent. J Biol Chem 1951; 193:265–271.[Free Full Text]
  22. Zimmerman M, Yurewicz E, Patel G. A new fluorogenic substrate for chymotrypsin. Anal Biochem 1976; 70:253–262.
  23. Haugland RP. Handbook of Fluorescent Probes and Research Chemicals. Eugene, OR: Molecular Probes; 1992.
  24. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970; 227:680–685.[CrossRef][Medline]
  25. Yelich JV, Pomp D, Geisert RD. Detection of transcripts for retinoic acid receptors, retinol-binding protein, and transforming growth factors during rapid trophoblastic elongation in the porcine conceptus. Biol Reprod 1997; 57:286–294.[Abstract]
  26. Bode W, Bartels K, Kutzbach C, Schmitt-Kastner G, Barkunik H. Refined A X-ray crystal structure of porcine pancreatic kallikrein A, a specific trypsin-like serine proteinase. Crystallization, structure determination, crystallographic refinement, structure and its comparison with bovine trypsin. J Mol Biol 1983; 164:237–282.[CrossRef][Medline]
  27. Baker AR, Shine J. Human kidney kallikrein: cDNA cloning and sequence analysis. DNA 1985; 4:445–450.[Medline]
  28. SAS. SAS User's Guide: Statistics (version 5 Ed.) Cary, NC: Statistical Analysis System Institute Inc.; 1985.
  29. Anderson LL. Growth, protein content and distribution of early pig embryos. Anat Rec 1978; 190:896–902.
  30. Rusiniak ME, Back N. Kallikrein-kininogen-kinin system. In: Meyers RA (ed.), Molecular Biology and Biotechnology: A Comprehensive Desk Reference. New York, NY: VCH Publishers, Inc.; 1995: 483–490.
  31. Vonnahme KA, Spivey HO, Pratt T, Geisert RD. Detection of kallikrein activity in endometrial culture media and uterine flushings of cyclic and pregnant gilts. Biol Reprod 1997: 56(suppl 1):142.
  32. Burghardt RC, Bowen JA, Newton GR, Bazer FW. Extracellular matrix and the implantation cascade in pigs. In: Foxcroft GR, Geisert RD, Doberska C (eds.), Control of Pig Reproduction. Cambridge: Cambridge University Press; 1997: 151–164.
  33. Vallet JL, Christenson RK, Trout WF, Klemke HG. Conceptus, progesterone, and breed effects on uterine protein secretion in swine. J Anim Sci 1998; 76:2657–2670.[Abstract/Free Full Text]
  34. Brann DW, Greenbaum L, Mahesh VB, Gao X. Changes in kininogens and kallikrein in the plasma, brain, and uterus during the pregnancy in the rat. Endocrinology 1995; 136:46–51.[Abstract]
  35. Cooper CL, Shaffer JE, Malik KU. Mechanism of action of angiotensin II and bradykinin on prostaglandin synthesis and vascular tone in isolated rat kidney: effect of Ca++ antagonists and calmodulin inhibitors. Circ Res 1985; 56:97–108.[Abstract/Free Full Text]
  36. Allen MJ, Vonnahme KA, Malayer JR, Geisert RD. Endometrial kinin-ß2 receptor gene expression during the porcine estrous cycle and early pregnancy. Biol Reprod 1998; 58(suppl):193.
  37. Lee CY, Green ML, Simmen RCM, Simmen FA. Proteolysis of insulin-like growth factor-binding proteins (IGFBPs) within the pig uterine lumen associated with peri-implantation conceptus development. J Reprod Fertil 1998; 112:369–377.[Abstract/Free Full Text]
  38. Salamonsen LA, Woolley DE. Matrix metalloproteinases and their tissue inhibitors in endometrial remodelling and menstruation. Reprod Med Rev 1996; 5:185–203.



This article has been cited by other articles:


Home page
ReproductionHome page
S C Fernando, J S Buck, M D Ashworth, J W Ross, R D Geisert, and U DeSilva
Porcine endometrial and conceptus tissue kallikrein 1, 4, 11, and 14 gene expression.
Reproduction, December 1, 2006; 132(6): 939 - 947.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
K.A. Vonnahme, S.C. Fernando, J.W. Ross, M.D. Ashworth, U. DeSilva, J.R. Malayer, and R.D. Geisert
Porcine Endometrial Expression of Kininogen, Factor XII, and Plasma Kallikrein in Cyclic and Pregnant Gilts
Biol Reprod, January 1, 2004; 70(1): 132 - 138.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. W. Ross, J. R. Malayer, J. W. Ritchey, and R. D. Geisert
Characterization of the Interleukin-1{beta} System During Porcine Trophoblastic Elongation and Early Placental Attachment
Biol Reprod, October 1, 2003; 69(4): 1251 - 1259.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. R. Allen, B. R. Zhang, A. M. Hettinger, D. W. Goad, J. R. Malayer, and R. D. Geisert
Detection of Bradykinin and Bradykinin-{beta}2 Receptors in the Porcine Endometrium During the Estrous Cycle and Early Pregnancy
Biol Reprod, March 1, 2002; 66(3): 574 - 579.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
C. D. Figueroa, C. Chacón, J. Corthorn, P. Ehrenfeld, W. Müller-Esterl, and G. Valdés
Temporospatial Changes of Kinin B2 Receptors During the Estrous Cycle and Pregnancy in the Rat Uterus
Biol Reprod, June 1, 2001; 64(6): 1590 - 1599.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vonnahme, K. A.
Right arrow Articles by Geisert, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vonnahme, K. A.
Right arrow Articles by Geisert, R. D.
Agricola
Right arrow Articles by Vonnahme, K. A.
Right arrow Articles by Geisert, R. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS