| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Articles |
a The Women's Research Institute, Wichita, Kansas 67214
b Department of Obstetrics and Gynecology, University of Kansas School of Medicine-Wichita, Wichita, Kansas 67214
c Veterans Affairs Medical Center, Wichita, Kansas 67218
d Department of Biological Sciences, Wichita State University, Wichita, Kansas 67260
e Department of Animal Sciences, Oregon State University, Corvallis, Oregon 97331
f Oregon Regional Primate Research Center, Beaverton, Oregon 97006
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
0.05) in P4 levels after treatment with PR antagonists. These observations support the concept that P4 represses the onset of apoptosis in the CL by a PR-dependent mechanism.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Apoptosis, a significant component of luteal regression, has been described by morphological and biochemical parameters in many domestic species including the pig [21], sheep [22–24], and cow [25–27]. In the ovine and bovine CL, the appearance of internucleosomal fragmentation of DNA (laddering) characteristic of apoptosis is associated with natural as well as PGF2
-induced luteolysis [23,25]. Of considerable interest are the observations that the onset of apoptosis is not evident until P4 levels have declined [23,25]. Whether or not the decline in P4 levels is sufficient to initiate apoptosis in the luteal cells is not known. Furthermore, the presence of specific PR and their blockade by specific PR antagonists in bovine luteal tissue have not been demonstrated. The demonstration of direct effects of P4 on ovarian cells would implicate locally produced P4 as an autocrine factor. It is possible, however, that P4 signaling may not occur as a result of its interaction with the classical PR [28]. Recent experiments in the rat have failed to find PR mRNA in the CL and suggest that in the absence of a PR, P4 may be signaling by either a gamma aminobutyric acid-like receptor [28] or even the glucocorticoid receptor [29].
We hypothesize that P4 signaling through the classical PR regulates the function of the bovine CL. Furthermore, the inhibition of P4 synthesis associated with functional luteal regression may play an important role in the acceleration of structural regression of the CL. The studies presented demonstrate that 1) inhibition of steroid synthesis and removal of P4 accelerated the onset of apoptosis, 2) luteal cells express mRNA and protein for PR, and importantly, 3) specific PR antagonists accelerated apoptotic cell death.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
CL from cows were obtained from a local slaughter facility in accordance with protocols approved by the local institutional animal care and use committee. Bovine CL from early pregnancy (2–3 mo based on fetal crown rump length; < 30 cm) were collected from a local slaughterhouse and transported back to the laboratory in cold medium 199. CL were dispersed with collagenase as previously described [30]. Luteal cells (105/cm2) were incubated in medium 199 (M199; supplemented with 0.1% BSA, 25 mM Hepes, and 25 mM NaHCO3) containing 5% fetal calf serum (FCS) overnight in an atmosphere of humidified air with 5% CO2 at 37°C. Cells were allowed to attach to cell culture flasks and/or dishes (Falcon 6-well or 25-cm2 flasks; Fisher, St. Louis, MO) for at least 24 h. After the initial incubation period, medium was replaced with fresh serum-free medium (supplemented with 0.1% BSA and 5 µg/ml bovine insulin) and incubated for an additional 18 h to allow stabilization of the cells prior to the initiation of treatments.
Inhibition of Steroid Synthesis
Aminoglutethimide, a P450 cholesterol side-chain cleavage inhibitor, was dissolved in dimethyl sulfoxide (DMSO) and added in increasing amounts (up to 0.2 mM) to determine the effective concentrations that inhibit P4 synthesis. The final concentration of DMSO never exceeded 0.05%. The controls received DMSO alone. Results from our preliminary studies demonstrated that treatment with aminoglutethimide produced concentration-dependent inhibition of P4 production (Fig. 1). On the basis of these results, 0.15 mM aminoglutethimide, which completely blocked P4 synthesis, was employed in subsequent experiments. Concentrations of aminoglutethimide in our studies were similar to those used in previous studies of rat granulosa cells in ovarian tissue cultures and shown not to result in acute cell death [31]. To ensure P4 depletion, cultures were treated with the steroid inhibitor for 2 h and then washed two times to remove any endogenously accumulated P4. Fresh media and aminoglutethimide were added back, and the cultures were continued for 48 h. At the end of the incubation period, the medium was collected and frozen immediately for hormone analysis. The cells were scraped, quick frozen, and stored until genomic DNA could be isolated.
|
P4 Replacement
To rule out possible nonspecific effects of aminoglutethimide, we evaluated whether or not exogenous P4 could reverse the effects of aminoglutethimide. To accomplish this, bovine luteal cell cultures prepared as described above were treated with or without (vehicle alone) aminoglutethimide (0.15 mM) ± supplemental P4 (500 ng/ml; dissolved in ethyl alcohol [EtOH]) for 48 h. The final concentration of EtOH was equivalent to 0.05%. At the end of the incubation period the medium was aspirated and frozen immediately for steroid analysis. The cells were scraped, collected, quick frozen, and stored until genomic DNA could be isolated.
Morphological Assessment of Apoptosis
To support the initial experiment, which demonstrated an increased amount of oligonucleosomal DNA laddering, a second experiment was performed utilizing the Hoechst staining technique that distinguishes apoptotic cells on the basis of nuclear condensation, nuclear morphology, and increased fluorescence. To accomplish this, CL were dispersed with collagenase as previously described [30]. Prior to plating, culture dishes were pretreated with 10% FCS in M199 for 1 h. The medium was aspirated, and the dishes were rinsed twice with M199. Luteal cells (105/cm2) were incubated in M199 (supplemented with 0.1% BSA, 25 mM Hepes, and 25 mM NaHCO3) containing 5 µg/ml insulin, 5 µg/ml transferrin, and 5 ng/ml selenium (ITS; Beckton Dickinson, Bedford, MA) in an atmosphere of humidified air with 5% CO2 at 37°C. Cells were allowed to attach to the six-well plates (Falcon; Fisher) for at least 24 h. After the initial incubation period, medium was replaced with fresh serum-free medium (supplemented with 0.1% BSA and ITS). Treatments were the same as described for the initial experiment in which steroid production was inhibited by the addition of 0.15 mM aminoglutethimide with or without P4 and compared to that in the control (vehicle treated) cultures. After the 48-h treatment period the medium was removed; cells were rinsed once, fixed in ice-cold methyl alcohol, and allowed to air dry. The nuclei were stained with Hoechst 33258 dye (Sigma Chemical Co., St. Louis, MO) (0.5 µg/ml in PBS) for 2 min. The dye was aspirated and the dishes were rinsed four times with PBS (5 min each). Treatment effects were determined by counting the number of apoptotic cells and calculating them as a percentage of the total in a single field. Five different fields were assessed in each well. To eliminate any biases, counts were made by two different individuals and compared in order to confirm the accuracy of counting apoptotic and non-apoptotic positive cells.
Isolation of Bovine Luteal PR cDNA
Experiments were performed to determine whether the PR gene was expressed at the RNA level in the bovine CL. Total RNA was isolated from bovine CL collected from cows during the midluteal phase (n = 3) and early pregnancy (n > 3), as well as from the uterus, spleen, heart, and kidney. In addition, dissociated bovine luteal cells originating from CL collected from cows in early pregnancy (n = 3) were subjected to centrifugal elutriation in order to obtain relatively pure fractions of large and small luteal cells [32]. Upon separation, the enriched luteal cell fractions were subjected to RNA isolation [33]. Total RNA was isolated from bovine tissues and cells and reverse transcribed (5 µg/reaction) into first-strand cDNA using random hexamer primers (Boehringer-Mannheim, Indianapolis, IN), oligo(dT) primers (Promega, Madision, WI), and avian myeloblastosis virus reverse transcriptase (Promega, Madison, WI). Oligonucleotide primers were synthesized (sense 5' ccgtaagccagagaatcactt 3' and antisense 5' ttatgatgactccttcatccgc 3') on the basis of the bovine PR sequence obtained from oviductal tissue (accession no. Z86041) and were used for polymerase chain reaction (PCR) amplification of the corresponding bovine luteal cDNA sequences as follows. The first-strand cDNA was subjected to 35 cycles of PCR amplification using the primer set (1-min denaturation at 94°C, 1-min annealing at 50°C, and 2-min extension at 72°C). Amplified products derived from the bovine tissues were resolved in 2% agarose gels and stained with ethidium bromide. After visualization, the amplified product derived from the bovine CL was isolated and subcloned into pGEMT vector for large-scale plasmid preparation and automated DNA sequence analysis performed at the University of Kansas School of Medicine core facility.
Immunohistochemical Analysis of PR
For immunocytochemical studies, the CL from mature heifers were collected by transvaginal lutectomy on Day 8 of the estrous cycle (Day 0: onset of estrus; n = 2). Fresh luteal tissue was mounted in Tissue-Tek II OCT (Miles Inc., Elkhart, IN) and frozen in liquid nitrogen. Immunocytochemistry of PR was performed on microwave-stabilized tissue sections as recently described for estrogen receptor [34]. Cryostat sections (5 µm) were prepared on a Hacker/Bright cryostat (Fairfield, NJ), thaw mounted on gelatin-coated glass slides, placed on ice at 4°C, microwaved for 2 sec, and lightly fixed (0.2% picric acid, 2% paraformaldehyde in PBS) for 10 min. After fixation, slides were rinsed (0–4°C), first with PBS containing 1.5% (w:v) polyvinyl-pyrrolidine (PVP; Mr 360,000; Sigma) and 0.075% (v:v) Brij-35 (Sigma); then PBS with 1.5% PVP and 0.37% (w:v) glycine (Sigma); and lastly 1.5% PVP and 0.1% (w:v) gelatin in PBS. Slides were then treated for 20 min with a nonspecific serum (goat) and next incubated overnight at 0–4°C with the monoclonal anti-PR antibody (JZB-39; 1 µg/ml; provided by Geoffrey Greene, University of Chicago, Chicago, IL). This antibody recognizes the A and B isoforms of the human PR. As a control for nonspecific staining by antibodies of the same subtype as JZB-39 (IgG2a), we substituted a monoclonal antibody directed against an antigen of timothy pollen (AT; 10 µg/ml; provided by Dr. Arthur Malley, Oregon Regional Primate Research Center, Beaverton, OR). After incubation, the primary antibody was subjected to reaction with an anti-rat IgG biotinylated second antibody and detected with an avidin-biotin peroxidase kit (Vector Laboratories, Burlingame, CA). Tissue sections were then lightly counterstained with hematoxylin. Photomicrographs of immunocytochemical preparations were captured with an Optronics DEI-750T digital camera (Goleta, CA) through Zeiss planapochromatic lenses (New York, NY) and printed with a Sony Mavigraph dye sublimation printer (Tokyo, Japan).
Treatment with PR Antagonists
To determine whether endogenous P4 exerted its protective effects via the classical receptor level, dissociated luteal cells were treated with two well-characterized PR antagonists, RU-486 (0.05 µM; Roussel-Uclaf, Romainville, France) and onapristone (5 µM; Schering, Berlin, Germany). RU-486 and onapristone were dissolved in EtOH; the final concentration of EtOH did not exceed 0.05% and 0.01%, respectively. The appropriate vehicle was added to each of the controls. These experiments were performed in the presence of endogenous P4. At the completion of the 48-h incubation period, the medium was removed and saved for hormone analysis. The cells were scraped, transferred to an Eppendorf (Hamburg, Germany) tube, pelleted by centrifugation, quick frozen, and stored until processed.
RIAs
Medium was collected at the termination of all experiments and stored at -20°C for steroid analysis. RIA of P4 was performed in accordance with standard procedures in our laboratory [30].
Extraction of DNA and Analysis
Genomic DNA was prepared as previously described and analyzed for its integrity [35]. The quantity and purity of nucleic acid preparations were estimated by measuring the optical density of each sample (A260/A280). An equivalent amount of genomic DNA (1 µg) from each treatment group was radiolabeled on 3' ends with [-32P]dideoxy-ATP (3000 Ci/mmol; Amersham; now Amersham Pharmacia Biotech, Piscataway, NJ) using terminal transferase (25 U, Boehringer-Mannheim). Labeled DNA samples were separated by electrophoresis through 2% agarose gels (500 ng of labeled DNA per well) for approximately 3.5 h at 65 V. Gels were dried without heat in a slab dryer and exposed to film (X-Omat films at -70°C; Eastman Kodak, Rochester, NY) for autoradiographic analysis. To provide a quantitative estimate of the degree of DNA cleavage among samples, low molecular weight DNA (< 15 kilobases) was excised from the gel, mixed with 3 ml of scintillation fluid (Scintverse BD; Fisher Scientific, Pittsburgh, PA), and counted in a beta counter as previously described [26].
Elutriation
Collagenase-dissociated cells (100 x 106) were resuspended and subjected to centrifugal elutriation using elutriation medium (Ca2+/Mg2+-free Dulbecco's modified Eagle's medium, pH 7.2, 25 mM Hepes, antibiotics, 0.1% BSA, and 0.02 mg/ml deoxyribonuclease) in a Beckman (Palo Alto, CA) J6B centrifuge as previously described [32]. The luteal cells were injected into an elutriation chamber, and the eluates were collected with continuous flow as follows. A 200-ml fraction containing predominantly erythrocytes and endothelial cells (< 10 µm) and a variable degree of small luteal cells was harvested using a flow rate of 16 ml/min at 1800 rpm. A second 200-ml fraction containing predominantly small luteal cells (10–20 µm) was harvested using a flow rate of 16 ml/min at 1400 rpm. A third fraction containing small cell clumps mixed with large cells was collected using a flow rate of 24 ml/min at 1200 rpm. The remaining fraction of highly enriched large cells (< 30 µm), containing less than 5% enucleated cells, was collected using a flow rate of 30 ml/min at 680 rpm. The yield and viability of cells in each fraction were exactly as reported in a previous investigation of large and small luteal cell-specific expression of prostaglandin F2 and LH receptors [32]. The same elutriated cell fractions (n = 3) were used in this study for the purpose of generating cDNA for the isolation of a PR fragment.
RNA Isolation
Total RNA was isolated by the guanidine isothiocyanate-phenol-chloroform extraction procedure [33] as described previously [23]. The purity and quantity of RNA was estimated by measuring the optical density of each sample (A260/A280).
Data Analysis and Presentation
All experiments were repeated at least three times with cell preparations prepared from separate animals for each experiment. A representative autoradiogram provides qualitative presentation of internucleosomal DNA laddering, whereas the results of the quantitative analysis are presented in graph form. The quantitative results represent the mean ± SEM of combined data from replicated experiments. Statistical differences were determined by one-way ANOVA followed by Scheffe's test. Significance was assigned at P < 0.05.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Aminoglutethimide treatment of luteal cells inhibited the synthesis of P4 in a concentration-dependent manner (Fig. 1). Based on 3' end-labeling of the DNA, levels of apoptosis were elevated (P < 0.05) with the addition of aminoglutethimide for 48 h. Therefore, a second experiment was designed to confirm the specificity of aminoglutethimide and to determine whether P4 had anti-apoptotic capacity. Supplementation with P4 (500 ng/ml) in the presence of the steroid inhibitor blocked (P < 0.05) the apoptosis induced by aminoglutethimide (Fig. 2).
|
Morphological Assessment of Apoptotic Cells and Cell Numbers
Similar to our results obtained in the previous experiment utilizing the 3' end-labeling technique, the numbers of apoptotic cells were increased (P < 0.001) after the inhibition of steroid synthesis as determined by the Hoechst staining technique (Fig. 3). In agreement with results from the previous experiment, the addition of P4 to the aminoglutethimide-treated cell cultures abrogated (P < 0.001) the increase in the number of apoptotic cells observed in those cultures treated with aminoglutethimide alone. There was no difference (P > 0.05) in the number of apoptotic cells in the P4-treated as compared to the control (vehicle-treated) cell cultures, nor were there any differences between the control (vehicle-treated) and the aminoglutethimide + P4 groups. It is of interest to recognize that there was a range of 5–8% of the cells that were undergoing apoptotic cell death as characterized by this method in the control cell cultures.
|
On the basis of the total number of cells quantified in 5 separate fields within each well in response to different treatments, we observed no significant difference (P > 0.05) in the total number of cells in response to treatments as compared to the controls (data not shown).
Isolation of PR cDNA
To determine whether the PR was expressed in the bovine CL, we utilized the reverse transcription (RT)-PCR technique. The primers employed were based on bovine oviduct PR sequence (accession no. #Z86041) and generated the predicted 380-base pair PCR product. Preliminary restriction analysis based on the known sequence resulted in the predicted fragments, and subsequent sequence analysis (data not shown) showed that the isolated cDNA encoded the bovine PR. The PCR product was evident in bovine CL collected from both pregnant and nonpregnant cows (Fig. 4A). In addition, we observed the 380-base pair fragment in samples derived from enriched large and small steroidogenic luteal cell fractions obtained by elutriation (Fig. 4A). There was also evidence of the PR in the ovary, lung, uterus, heart, and kidney (Fig. 4B). Little if any product was observed in tissue samples derived from the spleen (Fig. 4B). Furthermore, the partial cDNA isolated from the bovine CL was 100% homologous to that previously isolated from the bovine oviduct (accession no. Z86041) and 89%, 97%, and 88% homologous to that in the human, sheep, and rabbit, respectively (accession nos. M15716, Z66555, M14547).
|
Immunohistochemical Identification of PR
Immunostaining for PR in bovine CL is depicted in Figure 5. Specific nuclear staining with JZB-39 was evident in the large luteal cells and was detectable in some of the small luteal cells. No specific nuclear staining was detected by the nonspecific antibody AT. Cytoplasmic staining by JZB-39 was considered to be nonspecific since it was also present in sections treated with AT. Specific nuclear staining for PR was not detected in the endothelial cells of the luteal capillaries or in some of the small luteal cells. Localization of PR immunostaining was similar in the two animals tested; overall, this pattern of JZB-39 staining was identical to that reported previously for the monkey CL [34].
|
Treatment with PR Antagonists
To determine whether the anti-apoptotic effect of P4 was mediated by the PR, luteal cell cultures were treated with RU-486 and onapristone, two known PR antagonists. The addition of RU-486 to bovine luteal cell cultures resulted in an increase in oligonuclesomal DNA fragmentation as compared to that in the vehicle-treated controls (Fig. 6A). Similar to observations after treatment with RU-486, the addition of onapristone resulted in an increase in apoptotic cell death (Fig. 6B). We observed no difference (P > 0.05) in the levels of P4 in control cultures or cultures (260 ± 33 ng/ml) treated with RU-486 (277 ± 25 ng/ml) or onapristone (248 ± 14 ng/ml) at the 48-h time point.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
in relation to prostaglandin E is altered after P4 supplementation [17]. With the onset of luteal regression there is an increase in luteal apoptotic activity, which is associated with decreased circulating P4 levels [23,25]. Therefore, it seems likely that P4 itself may have anti-apoptotic activity [8]. Our results suggest that P4 may directly affect luteal cell apoptosis. Aminoglutethimide, an inhibitor of P450 cholesterol side-chain cleavage, effectively reduced P4 synthesis and increased oligonucleosomal DNA fragmentation in luteal cell cultures. It is unlikely that the increase in oligonucleosomal DNA fragmentation was due to some toxic effect of aminoglutethimide, since the addition of P4 to aminoglutethimide-treated cultures inhibited the increase in apoptosis. Our results are consistent with a previous report by Duffy et al. [36] demonstrating that inhibition of luteal P4 synthesis by the 3ß-hydroxysteroid dehydrogenase inhibitor, trilostane, resulted in lower serum P4 levels as well as premature luteal regression in the monkey. Those observations were based on histological indices of tissues derived from in vivo studies [36], whereas our data are based on biochemical parameters of cell death and morphological assessment based on a nuclear stain. Our results support the idea that P4 may play an active role in the inhibition of luteal regression by a direct effect on the CL.
The mechanism by which P4 maintains luteal function is unknown. The PR has been identified in primate and sheep luteal tissue [5]; however, the mechanism or signaling pathway by which P4 exerts its action on the CL of the domestic species has not been demonstrated. To determine whether or not the action of P4 is the result of a steroid-receptor interaction, we treated luteal cells with two different PR antagonists. Addition of RU-486 (mifepristone) resulted in an increase in apoptosis. This interaction provided evidence supporting a role for P4-initiated luteotropic activity at the receptor level. Onapristone, a more sensitive inhibitor of PR activity, also increased apoptosis in luteal cell cultures, further supporting this concept of steroid ligand-receptor interaction. However, other mechanisms may explain our results. Onapristone and RU-486 have the potential to inhibit glucocorticoid receptors at high levels. In fact, a recent study suggested that in the absence of any conclusive evidence for the presence of PR in the rat CL, P4 effects are mediated via the glucocorticoid receptor [29]. On the basis of the relatively low concentrations of PR antagonists used in this study and our demonstration of PR mRNA in bovine luteal cells, we do not feel that the P4 or the PR antagonists are working via the glucocorticoid receptor. Additional experiments will be required to determine whether or not the glucocorticoid receptor is involved in bovine luteal cell death. Additionally, recent evidence suggests that P4 may act via nonclassical receptor target sites by binding to the plasma membrane [28]. Regardless of the exact mechanism, our results clearly demonstrate that removal of P4 and treatment with antagonists of PRs lead to apoptosis in vitro.
Our data demonstrate that the message encoding the PR is present in the bovine CL, which is similar to the human, monkey, and pig CL. In contrast, the PR is not present in the rat CL and is only transiently expressed in the follicle just prior to ovulation [29]. Given the fact that the bovine CL is composed of steroidogenic and nonsteroidogenic cells [37,38], it was necessary to consider whether or not specific cell types within the CL express the PR. Previous evidence in the primate has shown that the PR is present in the steroid-producing cells of the CL [6,12,13,39,40]. We initially hypothesized that P4 itself may somehow regulate P4 synthesis in the large cell. Given the anti-apoptotic nature of P4, if P4 is signaling via the large luteal cell, this may in part explain why the large luteal cells succumb sequentially to the apoptotic process after the nonsteroidogenic and small luteal cells undergo their demise during luteal regression [24]. The present study, however, demonstrates that PR mRNA is expressed in both the large and small steroidogenic cells of the bovine CL. These data must be interpreted with caution, for it is well known that although the steroidogenic cell fractions are relatively pure, the potential for limited contamination exists. Nevertheless, the abundance of the fragment observed following PCR suggests that the PR message is expressed in both cell types. Previous immunohistochemical studies in the monkey indicated that not all luteal cells demonstrating positive staining for 3ß-hydroxysteroid dehydrogenase stained positive for the PR [12]. This is further supported by our results, which provide evidence that although the PR is present in luteal cells during midluteal phase, not all steroidogenic luteal cells express the PR. On the basis of our data with a limited number of samples, the majority of the PR-positive cells appeared to be of the large luteal cell subtype. The physiological ramifications of this phenomenon are yet to be investigated. Thus, by inhibiting P4 synthesis in the CL or luteal tissue, the increase in cell death may be limited to those cells that express the PR. This may explain, in part, the limited increase in apoptosis associated with P4 removal or PR antagonists. In addition, the modest increases in low molecular weight DNA laddering observed in response to PR antagonists may be due in part to an underestimation of total cell death. In the methodology used in this study, only those cells remaining adhered to the culture dishes were analyzed. Further studies are needed to characterize those specific populations of luteal cells expressing the PR and undergoing apoptosis. Likewise, characterizing the PR subtype expressed throughout the estrous cycle may help us to understand the role of P4 in luteal cell fate.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported in part by NIH RO1-HD35934, Wesley Medical Research Institute, KURI, and the Department of Veterans Affairs. 
2 Correspondence: Bo R. Rueda, The Women's Research Institute, Department of Ob/Gyn, The University of Kansas School of Medicine-Wichita, 1010 N. Kansas, Wichita, KS 67214-3199. Fax: 316 293 1881; brueda{at}kumc.edu
Accepted: September 20, 1999.
Received: December 11, 1998.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Dom Anim Endocrinol 1990; 7:229–238.[CrossRef][Medline]-hydroxysteroid dehydrogenase expression in the rat corpus luteum through the glucocorticoid receptor. Endocrinology 1997; 138:4497–4500. and luteinizing hormone receptors in different bovine luteal cell types. Biol Reprod 1998; 58:849–856.This article has been cited by other articles:
|
|
 |
|
  P. A. Friberg, D.G. J. Larsson, and H. Billig Dominant Role of Nuclear Progesterone Receptor in the Control of Rat Periovulatory Granulosa Cell Apoptosis Biol Reprod, June 1, 2009; 80(6): 1160 - 1167. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bowolaksono, R. Nishimura, T. Hojo, R. Sakumoto, T. J. Acosta, and K. Okuda Anti-Apoptotic Roles of Prostaglandin E2 and F2alpha in Bovine Luteal Steroidogenic Cells Biol Reprod, August 1, 2008; 79(2): 310 - 317. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. E. Henkes, B. T. Sullivan, M. P. Lynch, R. Kolesnick, D. Arsenault, M. Puder, J. S. Davis, and B. R. Rueda Acid sphingomyelinase involvement in tumor necrosis factor {alpha}-regulated vascular and steroid disruption during luteolysis in vivo PNAS, June 3, 2008; 105(22): 7670 - 7675. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Nishimura, J. Komiyama, Y. Tasaki, T. J. Acosta, and K. Okuda Hypoxia Promotes Luteal Cell Death in Bovine Corpus Luteum Biol Reprod, March 1, 2008; 78(3): 529 - 536. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Hou, E. W. Arvisais, C. Jiang, D.-b. Chen, S. K. Roy, J. L. Pate, T. R. Hansen, B. R. Rueda, and J. S. Davis Prostaglandin F2{alpha} Stimulates the Expression and Secretion of Transforming Growth Factor B1 Via Induction of the Early Growth Response 1 Gene (EGR1) in the Bovine Corpus Luteum Mol. Endocrinol., February 1, 2008; 22(2): 403 - 414. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Stormshak and C. V. Bishop BOARD-INVITED REVIEW: Estrogen and progesterone signaling: Genomic and nongenomic actions in domestic ruminants J Anim Sci, February 1, 2008; 86(2): 299 - 315. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Li, F. Jimenez-Krassel, A. Bettegowda, J. J Ireland, and G. W Smith Evidence that the preovulatory rise in intrafollicular progesterone may not be required for ovulation in cattle J. Endocrinol., March 1, 2007; 192(3): 473 - 483. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. N. Fru, C. A. VandeVoort, and C. L. Chaffin Mineralocorticoid Synthesis During the Periovulatory Interval in Macaques Biol Reprod, October 1, 2006; 75(4): 568 - 574. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. Peluso Multiplicity of Progesterone's Actions and Receptors in the Mammalian Ovary Biol Reprod, July 1, 2006; 75(1): 2 - 8. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Peluso, A. Pappalardo, R. Losel, and M. Wehling Progesterone Membrane Receptor Component 1 Expression in the Immature Rat Ovary and Its Role in Mediating Progesterone's Antiapoptotic Action Endocrinology, June 1, 2006; 147(6): 3133 - 3140. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Cai and C. Stocco Expression and Regulation of Progestin Membrane Receptors in the Rat Corpus Luteum Endocrinology, December 1, 2005; 146(12): 5522 - 5532. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Peluffo, K. A. Young, and R. L. Stouffer Dynamic Expression of Caspase-2, -3, -8, and -9 Proteins and Enzyme Activity, But Not Messenger Ribonucleic Acid, in the Monkey Corpus Luteum during the Menstrual Cycle J. Clin. Endocrinol. Metab., April 1, 2005; 90(4): 2327 - 2335. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Xu, S. Takekida, N. Ohara, W. Chen, R. Sitruk-Ware, E. D. B. Johansson, and T. Maruo Progesterone Receptor Modulator CDB-2914 Down-Regulates Proliferative Cell Nuclear Antigen and Bcl-2 Protein Expression and Up-Regulates Caspase-3 and Poly(Adenosine 5'-Diphosphate-ribose) Polymerase Expression in Cultured Human Uterine Leiomyoma Cells J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 953 - 961. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Okuda, A. Korzekwa, M. Shibaya, S. Murakami, R. Nishimura, M. Tsubouchi, I. Woclawek-Potocka, and D. J. Skarzynski Progesterone Is a Suppressor of Apoptosis in Bovine Luteal Cells Biol Reprod, December 1, 2004; 71(6): 2065 - 2071. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Quirk, R. G. Cowan, and R. M. Harman Progesterone Receptor and the Cell Cycle Modulate Apoptosis in Granulosa Cells Endocrinology, November 1, 2004; 145(11): 5033 - 5043. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. J. Diaz and M. C. Wiltbank Acquisition of Luteolytic Capacity: Changes in Prostaglandin F2{alpha} Regulation of Steroid Hormone Receptors and Estradiol Biosynthesis in Pig Corpora Lutea Biol Reprod, May 1, 2004; 70(5): 1333 - 1339. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Takiguchi, N. Sugino, K. Esato, A. Karube-Harada, A. Sakata, Y. Nakamura, H. Ishikawa, and H. Kato Differential Regulation of Apoptosis in the Corpus Luteum of Pregnancy and Newly Formed Corpus Luteum after Parturition in Rats Biol Reprod, February 1, 2004; 70(2): 313 - 318. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Quirk, R. G. Cowan, R. M. Harman, C.-L. Hu, and D. A. Porter Ovarian follicular growth and atresia: The relationship between cell proliferation and survival J Anim Sci, January 1, 2004; 82(13_suppl): E40 - 52. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Cannon, M. G. Petroff, and J. L. Pate Effects of Prostaglandin F2{alpha} and Progesterone on the Ability of Bovine Luteal Cells to Stimulate T Lymphocyte Proliferation Biol Reprod, August 1, 2003; 69(2): 695 - 700. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Wang, C. Xiao, and A. K. Goff Progesterone-Modulated Induction of Apoptosis by Interferon-Tau in Cultured Epithelial Cells of Bovine Endometrium Biol Reprod, February 1, 2003; 68(2): 673 - 679. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. A. Goyeneche, R. P. Deis, G. Gibori, and C. M. Telleria Progesterone Promotes Survival of the Rat Corpus Luteum in the Absence of Cognate Receptors Biol Reprod, January 1, 2003; 68(1): 151 - 158. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Jo, C.M. Komar, and J.E. Fortune Gonadotropin Surge Induces Two Separate Increases in Messenger RNA for Progesterone Receptor in Bovine Preovulatory Follicles Biol Reprod, December 1, 2002; 67(6): 1981 - 1988. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. C. Chen, J.-H. Lin, L.-S. Wu, Y.-F. Tsai, T. H. Su, C. J. Chen, and T. J. Chen Luteotropic Roles of Prolactin in Early Pregnant Hamsters Biol Reprod, July 1, 2002; 67(1): 8 - 13. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. F. Carambula, T. Matikainen, M. P. Lynch, R. A. Flavell, P. B. Dias Goncalves, J. L. Tilly, and B. R. Rueda Caspase-3 Is a Pivotal Mediator of Apoptosis during Regression of the Ovarian Corpus Luteum Endocrinology, April 1, 2002; 143(4): 1495 - 1501. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. L. Chaffin and R. L. Stouffer Role of gonadotrophins and progesterone in the regulation of morphological remodelling and atresia in the monkey peri-ovulatory follicle Hum. Reprod., December 1, 2000; 15(12): 2489 - 2495. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Friedman, S. Weiss, N. Levy, and R. Meidan Role of Tumor Necrosis Factor {alpha} and Its Type I Receptor in Luteal Regression: Induction of Programmed Cell Death in Bovine Corpus Luteum-Derived Endothelial Cells Biol Reprod, December 1, 2000; 63(6): 1905 - 1912. [Abstract] [Full Text]
|
|
|
|
|
|
E.Ch. Svensson, E. Markström, M. Andersson, and H. Billig Progesterone Receptor-Mediated Inhibition of Apoptosis in Granulosa Cells Isolated from Rats Treated with Human Chorionic Gonadotropin Biol Reprod, November 1, 2000; 63(5): 1457 - 1464. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
