Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dai, Y.
Right arrow Articles by Moor, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dai, Y.
Right arrow Articles by Moor, R.
Agricola
Right arrow Articles by Dai, Y.
Right arrow Articles by Moor, R.
Biology of Reproduction 62, 519-532 (2000)
© 2000 Society for the Study of Reproduction, Inc.


Articles

Selective Requirement for Cdc25C Protein Synthesis During Meiotic Progression in Porcine Oocytes

Yanfeng Dai1,a, Caroline Leea, Amanda Hutchingsa, Yunming Suna, and Robert Moora

a Department of Development and Genetics, The Babraham Institute, Cambridge CB2 4AT, United Kingdom


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Fundamental differences between meiosis and mitosis suggest that the shared central cell cycle machinery may be regulated differently during the two division cycles. This paper focuses on unique features of Cdc25C protein function during meiotic progression. We report on the existence of oocyte-specific CDC25C transcripts that differ from their somatic counterparts in the 3' untranslated region. While CDC25C mRNA levels remain constant in fully-grown oocytes, corresponding protein levels increase progressively during maturation to a maximum at metaphase II. Elevation of Cdc25C protein levels in G2-oocytes by mRNA injection failed to increase MPF-kinase levels or to induce premature entry into M-phase. Likewise, antisense-induced arrest of translation (translational arrest) had no effect on chromosome condensation, nucleolar disassembly, or nuclear membrane contraction. By contrast, translational arrest inhibited subsequent events including membrane disassembly and spindle formation. Neither up- nor down-regulation of Cdc25C synthesis after metaphase I plate formation influenced progression to metaphase II. However, translational arrest during metaphase resulted in incomplete chromosome decondensation and abnormal pronuclear membrane assembly after activation. We conclude that Cdc25 protein, translated from unique transcripts, is preferentially located in the oocyte nucleus and is essential for progress through late diakinesis. Subsequently, new synthesis of Cdc25C protein is required for the orderly transition from meiotic to mitotic cell division.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell cycle progression in eukaryotic cells is driven by a protein complex consisting of both a cyclin regulatory subunit and a catalytic subunit derived from the Cdk family of tyrosine kinases [1]. Separate forms of this kinase complex act at different stages during replication and segregation. The most highly characterized of the cell cycle kinases is p34cdc2—maturation promoting factor (MPF kinase)—which underlies progression from the G2- to M-phase. MPF kinase consists of a cyclin B-p34cdc2 complex that is inactive when Thr 14 and Tyr 15 of the cdc2 catalytic subunit are phosphorylated. The dephosphorylation of these residues with the consequent conversion of inactive or pre-MPF into active MPF kinase is a key regulatory step in the progression of mitotic cells from the G2 to M-phase. These key phosphorylation changes to the catalytic subunit of MPF-kinase during mitosis are, in turn, regulated by upstream events in a cell-cycle specific phosphorylation cascade. Genetic analyses in yeast [2] and subsequent experiments in mammalian cells indicate that the tyrosine phosphorylation of cdc2 kinase and its consequent inactivation is regulated by the cooperative action of the wee1 and Mik1 gene products [3, 4]. Conversely, the CDC25 gene, which is involved in potentiating the G2 to M-phase transition in yeast [5], encodes a tyrosine phosphatase that specifically dephosphorylates tyrosine 15 of the cdc2 molecule [6, 7]. Although both wee1 and Cdc25C protein levels remain constant in mammalian cells during mitosis, clear evidence exists of changes in the functional activity of these enzymes during the cell cycle [4,810]. These variations in functional activity appear in turn to be controlled both by phosphorylation changes and the translocation of the proteins between the nuclear and cytoplasmic compartments at specific stages during mitosis [11].

The meiotic cycle in mammalian oocytes differs in a number of significant aspects from mitosis. Thus, oocytes undergo a period of extended meiotic arrest after entering the G2 phase while quiescence in mitotic cells is imposed by progression from G1 to a Go phase of the cell cycle. Furthermore, the strict progression in mitosis from DNA replication in S-phase to chromosome segregation in M-phase is overturned in meiosis, where one M-phase is succeeded not by an S-phase but by a second M-phase. In parallel, checkpoint regulation in meiosis differs from that in mitosis [12]. Finally, while mitosis is universal and produces identical daughter cells, meiosis is restricted to a single reduction division in one cell type only. Although the same set of molecules drives both mitosis and meiosis, differences in the localization and control of the central molecular machinery are thought to account for the observed cell cycle differences outlined above. Our experiments are aimed at testing this hypothesis and identifying the specialized mechanisms that control meiotic, as distinct from mitotic, progression. Changes in both the activity of MPF kinase, and in the levels of its subunits during meiotic progression in porcine oocytes, have been reported previously [13, 14]; current research focuses therefore on the kinases and phosphatases involved in determining the activity of this central machinery. Analysis of the porcine wee1 gene during meiosis showed weak expression in growing oocytes and high expression in associated follicle cells [15]. However, no wee1 mRNA has been detected in fully grown-porcine oocytes by RT-PCR. Furthermore, immunoblot analyses indicate that a strong 50-kDa but no definitive 98-kDa protein is detected using a wee1 rabbit polyclonal antibody raised against human wee1 peptide. We therefore concentrate in the present paper on the role of CDC25 gene products in regulating the 3 major meiotic transitions, namely the entry into metaphase I, the passage from metaphase I to metaphase II, and the exit from metaphase II after activation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Gene Expression and Preparation of Antibodies

Expression of germline-specific CDC25C The standard yeast nomenclature for the CDC25 gene and its products has been used throughout this paper: the wild-type gene is designated as CDC25, the mutant gene as cdc25, and the protein product as Cdc25. The method of cloning CDC25C cDNA from an oocyte-enriched porcine ovary library has been described previously [16]. Expression studies during meiosis have been carried out by RT-PCR. Total RNA from both oocytes and granulosa cells was prepared separately by the AGPC technique [17]. Before reverse transcription, all RNA samples were treated with RNase-free DNase for 15 min at 37°C followed by two cycles of phenol-chloroform extraction and, finally, ethanol precipitation. Reverse transcriptions were carried out using the first strand cDNA synthesis kit (Boehringer, Sussex, UK) according to the manufacturer's instructions. Expression of CDC25C mRNA in follicle cells and oocytes and its deletion after antisense injection was analyzed by RT-PCR using the following 3 sets of primers as appropriate: 1) primers from the coding region of CDC25C (forward) 5'GGAACCTGCTGCTGTTTCAGA3' and (reverse) 5'CAGTCCTGGACTGTTCAA3'; 2) primers from the extended 3' untranslated region of CDC25 mRNA in oocytes (forward) 5'GAGAATCAGCATCATCTG3' and (reverse) 5'TGAGGATCCTTAACCCA3'; and 3) primers from the coding region of cyclin A2 (forward) 5'GGCTGTGAACTACATTGA3' and (reverse) 5'TAGGTCTGGTGAAGGTCC3'.

Preparation of CDC25C mRNA A full-length CDC25C (CDC25-19) cDNA was cloned into a pBluescript SK(-) vector at the EcoRI and XhoI sites and was used thereafter to synthesize capped mRNA by T3 RNA polymerase (Promega, Southampton, UK). Aliquots of CDC25C mRNA (3 µg/µl) were sealed in fine glass vials and maintained at -80°C until required for injection.

cdc25C Antisense constructs Two types of antisense construct were prepared. The first consisted of 7 antisense oligonucleotides, each 17 to 18 nucleotides long and spanning both the coding and noncoding region (Table 1). As controls, comparable mixtures of sense oligonucleotides were also prepared. After synthesis (ABI Oligonucleotide Synthesisers; Applied Biosystems, Warrington, UK) oligonucleotides were ethanol precipitated and then purified by HPLC. Injections were carried out using equimolar mixtures of all 7 sense or antisense oligonucleotides at a final concentration of 3.5 µg/µl.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Nucleotide sequences of 7 sense (control) and 7 antisense constructs injected in equimolar concentrations into pig oocytes for the arrest of CDC25C mRNA translation

To further improve the efficiency of inactivating endogenous CDC25 transcripts we used antisense DNA prepared according to the method of Morgan and colleagues [18]. CDC25C-19 plasmid DNA, linearized by BamHI or XhoI, was used as template DNA and T7 or T3 primer was used as the PCR amplification primer for generation of single strand antisense and sense DNA respectively. PCR conditions were 95°C for 45 sec, 60°C for 40 sec, and 72°C for 1 min 20 seconds for 30 cycles. After amplification, single-stranded DNA was partially digested using DNase under mild conditions (0.5 units DNase per 10 µg DNA at 37°C for 15 min) in order to maximize the yield of fragments (15–50 nucleotides) complementary to the entire mRNA molecule. DNA fragments were extracted once with phenol/chloroform, precipitated with ethanol and ammonium sulphate, and resuspended at 2 µg/µl for injection.

Expression of porcine c-terminus Cdc25C protein and preparation of polyclonal antibodies Specific Cdc25C polyclonal antibodies were prepared against glutathione-s-transferase (GST)-Cdc25C terminus fusion protein using the following strategy. An EcoRI-XhoI cDNA fragment, coding for the final 95 C-terminus amino acids of porcine Cdc25C protein, was prepared from clone CDC25-19 and inserted into a pGEX 5X-1 vector at EcoRI and XhoI sites (Pharmacia, St Albans, Herts, UK) and expressed in XL-I Blue Escherichia coli as a GST fusion protein. The fusion protein was purified by GST affinity column chromatography (Pharmacia) and injected into rabbits as described by Harlow and Lane [19].

Polyclonal antibodies were purified by the affinity chromatography technique of Harlow and Lane [19] but with the following modification. After transfer of protein to Immobilin-P (Millipore Corp., Bedford, MA), the filter was incubated with GST-Cdc25C rabbit antiserum overnight. After extensive washing, the filter was placed, protein side up, on a piece of foil and covered with elution buffer for 1 min. The elution buffer was then aspirated and transferred to a tube containing 1/20 volume of 1 M Tris HCl (pH 8.0). After repeating this process, twice the antibodies were concentrated using the Centricon-3 system (Amicon, Stonehouse, Glos., UK). In addition, a rabbit polyclonal IgG antibody (Cdc25 Hu), raised against a human Cdc25C peptide (carboxy terminus amino acids 454–473) and purchased from Santa Cruz Biotechnology (Santa Cruz, CA), was used for comparative purposes. This antibody did not react with Cdc25A or Cdc25B but is reactive against human, mouse, rat, and pig Cdc25C protein.

Cell Preparation and Microinjection

Oocyte and cell culture Pig ovaries obtained from animals slaughtered at a local abattoir were transported to the laboratory at 25°C and washed extensively; cumulus-oocyte complexes were then aspirated from nonatretic 3- to 5-mm follicles using a 16-gauge needle. Nonatretic follicles were distinguished from atretic counterparts by their color (pink), the translucent nature of their follicle wall, and their extensive vascularization; atretic follicles were by contrast grey, nontranslucent, and poorly vascularized. The oocytes were prepared and cultured using standard procedures described previously [14].

Swiss 3T3 cells were maintained and passaged in DMEM containing 10% newborn calf serum [20]. The mitotic cycles of these cells were synchronized using the serum deprivation protocols described in detail by Corps and Brown [21]. After a lag phase (G1) of 12 h, approximately 95% of cells synthesize DNA (S-phase) in the ensuing 12 h. After a G2-phase of approximately 6 h, most cells enter M-phase by 30–32 h after mitogenic stimulation.

Microinjection of cdc25 mRNA and antisense constructs After removal from follicles, oocytes designated for microinjection were denuded using finely graded pipettes of all but the final 3 to 5 layers of corona cells. All injections were made into the cytoplasm using bevelled micropipettes to minimize damage especially when G2-staged oocytes were injected (K.T. Brown Micro-pipette beveller; Sutter Instruments, CA); a microinjection volume of 7 pl per oocyte was used in all the experiments in this paper. Each experiment consisted of 5 to 10 separate replicated groups; oocytes within groups were divided and injected with either of the following: 1) cdc25 mRNA or PBS only as controls or 2) antisense with sense CDC25 constructs as controls. After injection, oocytes were washed 4 times in dissection medium before being cultured for periods ranging from 14 to 66 h (see Results) in conditions outlined above. To compensate for the removal of most follicle cells before microinjection, freshly prepared sodium pyruvate (40 µg/ml medium) was added to each culture dish. Oocytes designated for activation were stripped of cumulus cells after 48 h culture, washed 4 times in dissection medium, and then activated using procedures described previously [22].

Analytical Procedures

Immunoblot analysis Groups of oocyte at 3 different meiotic cycle stages (G2: directly after removal from the follicle; MI: 26 h after explantation; and MII: 44 h after explantation) were denuded of all associated follicle cells before being dissolved in SDS-PAGE sample buffer [23], heated to 100°C for 3 min, and run on 8–15% linear gradient SDS-polyacrylamide gels. Proteins were transferred to Immobilin-P membrane using a Trans-Blot SD semi-dry transfer cell (Bio-Rad Laboratories, Burcules, CA) for 1 h at 2.5 mA/cm2 in Bjerrum and Schafter-Nielsen transfer buffer.

Filters containing the transferred proteins were blocked for 1 h at room temperature with 15% fetal calf serum in PBS, containing 0.1% Tween 20. Thereafter, filters containing proteins from oocytes at selected stages of meiosis were incubated for 2 h at 20°C with appropriate antibodies. After three 15-min washes in PBS-Tween, all filters were incubated for 1.5 h in 1:1000-diluted horseradish peroxidase-conjugated goat anti-rabbit immunoglobin (Dako, High Wycombe, Bucks, UK), washed extensively in PBS-Tween, and visualized using the ECL Western blotting detection system (Amersham Life Science, UK) and x-ray film (Kodak, Hemel Hempstead, UK). The measurement of MPF kinase activity was carried out using the standard histone H1 kinase assay system. The quantitation of radioactivity in each band on the gels was undertaken using a GS-525 Molecular Imager System (Bio-Rad, Hemel Hempstead, UK).

Confocal microscopy and immunoquantitation The effects of enhancing or ablating Cdc25C protein synthesis in oocytes was evaluated by confocal microscopical analysis of nuclear membrane integrity, chromatin organization, and spindle formation. After manually removing all follicle cells, oocytes were fixed and permeabilized for 1 h in 4% paraformaldehyde and 0.3% Triton X-100 in PBS, washed 4 times in PPB (PBS containing 0.1% PVA and 4% bovine serum albumin), and incubated for 45 min in goat serum diluted 1:9 in PPB. Following an overnight incubation in a humidified chamber at 4°C with the appropriate primary antibody (anti-lamin A/C antibody kindly donated by Dr. M. Stewart, MRC Laboratory of Molecular Biology, Cambridge, UK; anti-tubulin antibody: Sera Lab, Crawley Downs, Surrey, UK; or preimmune serum) oocytes were given three 15-min washes in PPB followed by a 45-min incubation in 2.5% FITC-conjugated goat anti-rat IgG (or other suitable IgG depending on the origin of the primary antibody). After 3 further washes in PPB (3 x 15 min), oocytes were incubated in 0.02% propidium iodide in PPB for 20 min, washed thoroughly, mounted in anti-fade mountant, and examined using a Nikon Diaphot microscope equipped with an MRC 600 laser confocal imaging system (Bio-Rad Laboratories, Cambridge, MA) and associated image processing facility.

For immunolocalization of Cdc25C protein in oocytes and somatic cells, a range of different methods of fixation and permeabilization were compared. In addition to the paraformaldehyde/Triton X-100 method described above (Method 1), 3 other methods were used. Method 2 involved paraformaldehyde fixation followed by permeabilization with Triton X-100 and then methanol at -20°C [24]. In the third method, cells were fixed in 3.7% paraformaldehyde followed by acetone or acetone/methanol (v:v) extraction at -20°C [9, 24]. In the fourth procedure, cells were fixed and permeabilized in 100% methanol. Postfixation antibody staining protocols were kept constant (see above). The results from this methodological comparison showed that the method of fixation did not significantly affect the localization patterns of Cdc25 protein. The results indicated, however, that the most consistent results were obtained when the paraformaldehyde-methanol fixative system was used (see Method 2 above). This method of fixation was used for all the localization studies in this paper.

Mean pixel intensity within the cytoplasm and nucleus of each oocyte was measured using the STATS command menu software associated with the MRC-Bio-Rad 600 system. Nonspecific or background values were determined on oocytes that had been fixed and stained exactly as the experimental groups with the sole exception that the primary antibody was not added to the overnight incubation medium. Analyses were carried out on groups of 30 to 50 oocytes. Treatments were repeated in 3 sets of experiments to reduce microinjection and immunofixation bias.

Statistical Analysis

Subcellular localization of Cdc25 protein Comparisons of mean pixel intensities in the nuclear and cytoplasmic compartments of oocytes stained with Cdc25 antibodies were analyzed using both the Wilcoxon Matched-Paired test and the one-sample t-test. Furthermore, within-treatment comparisons were made to assess whether different data sets could be combined to compare between paired treatments and to test higher order interactions. The statistic used throughout was differences of logs (Y = log[nucleus] - log[cytoplasm]). One-way analysis of variance and two-sample t-tests were used to analyze these results.

Effect of CDC25C gene products on cell cycle parameters The tests for differences in the proportion of oocytes responding between control groups and those microinjected with CDC25C mRNA or cdc25 antisense constructs were carried out using exact tests for 2 x 2 contingency tables (Stat Xact User Manual, Cytel Software Corporation, Cambridge, MA; 1992: chapter 6). Preliminary tests to demonstrate that the different experiments gave consistent results were carried out using the exact test procedure of Zelen [25]. A comparison of the cdc25 sense and PBS controls showed that the two groups did not differ significantly (P > 0.1). For clarity of presentation, the two control groups are combined for each treatment in Tables 3 and 5. Detailed analyses of the effects of control treatments on meiotic progression are, however, given in Tables 4 and 6. The effect of CDC25C mRNA injection on MPF kinase levels were statistically analyzed by a nonorthogonal analysis that estimated the effects of treatment after allowing for gels separately at each time because of unequal replication of each combination of gel and treatment time [26].


View this table:
[in this window]
[in a new window]
 
TABLE 3. Effect of inhibiting translation of CDC25C mRNA at the initiation of maturation on nuclear membrane architecture and chromosome organization during meiotic progression of oocytes


View this table:
[in this window]
[in a new window]
 
TABLE 4. Effect of control microinjection protocols carried out at the initiation of maturation on nuclear membrane architecture and chromatin organization examined 26 h after the initiation of maturation


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
CDC25 Gene Products in Oocytes

Cloning and sequencing of CDC25 The screening of 2 x 106 plaques produced 5 independent CDC25C-positive clones. Clone CDC25C-19, containing a 1.6-kilobase (kb) insert, was shown after sequencing to contain the entire open reading frame and a 45-poly(A) sequence preceded by a hexanucleotide (AATAAA) polyadenylation signal (EMBL Data Library Accession Number X78317). The entire 502 amino acid translation product, including the putative tyrosine phosphate catalytic site, is highly conserved among species: human Cdc25C 84%; hamster Cdc25C 84%; mouse Cdc25C 80%; Drosophila Cdc25 61%; and Schizosaccharomyces pombe Cdc25 58%. Three further clones were later sequenced from both ends, and whilst they proved not to be full length, each contained the same nucleotide sequence in the 3' untranslated region (3' UTR) as CDC25C-19. By contrast, when the fifth clone (cdc25C-2b) was sequenced, the results showed that this transcript was identical to the above 4 clones in all respects except that it contained a 500-basepair (bp) extended 3' UTR (EMBL Data Library Accession Number Y18884).

The cloning data derived from the 5 separate clones shows that 1) two distinct transcripts exist in pig ovaries, 2) differences between the two transcripts are limited to the 3' UTRs, which are either 433 or 836 nucleotides in length, and 3) a poly(A) tail is found at the end of the 3' UTRs of both the short (433 bp) and long (836 bp) transcripts, indicating that each is full length at the 3' UTR region.

Oocytes express germline-specific maternal CDC25C mRNA Oocytes are highly specialized cells that, when fully grown, contain in a stored form the full complement of mRNAs required to support development up to the mid-cleavage transition when the embryonic genome becomes transcriptionally active. To investigate the nature of CDC25 mRNA in its maternal form, RT-PCR was employed using two primers derived from the coding region (forward) (654) 5'GGAACCTGCTGCTGTTTCAGA3' (672) and (reverse) (941) 5'CAGTCCTGGACTGTTCAA3' (924) that generate a 287-bp DNA fragment. The PCR reactions were run at 94°C for 30 sec, 52°C for 30 sec, and 72°C for 35 sec. An amount of cDNA equal to the total RNA in one oocyte was used to set up a 50-µl reaction. After a 40-cycle reaction cycle, 10 µl of the initial reaction volume was run on a 3% agarose gel. The presence of the 287-bp DNA fragment in fully grown G2-staged oocytes (Fig. 1, lanes 1–4) demonstrated that CDC25C was present in these cells as a maternal RNA.



View larger version (60K):
[in this window]
[in a new window]
 
FIG. 1. RT-PCR reaction products derived from oocytes and granulosa cells. The presence of a 287-bp DNA fragment generated from primers located in the coding region of CDC25C is shown in lanes 1–4. The tissue distribution of transcripts with the extended 3' UTR (primers specific to the extended 403-bp 3' UTR) is shown in lanes 5–8. Lane O represents the DNA marker lane. Lanes 1 and 5 are the positive controls using 10 pg of CDC25C-2b plasmid DNA as template. Lanes 2 and 6 are negative controls without addition of DNA template. Granulosa cell reaction products are shown in lanes 3 and 7 and oocyte reaction products in lanes 4 and 8. Attention is directed towards the presence of the long form 3' UTR in oocytes but not in granulosa cells (lane 7) or in other somatic cells (data not shown)

We have previously demonstrated that porcine Mos RNA is a unique maternal transcript with heterogenous 3' UTRs and a tightly restricted germline pattern and stage of expression (Dai Y, Moor RM, unpublished results). Strikingly similar U- and A-rich motifs in the 3' UTRs of c-mos and CDC25C (clone 2b) raise the possibility that the CDC25C transcripts present in clone 2b are, like their Mos counterparts, exclusively expressed in germline cells. To investigate this possibility, two primers specific to CDC25C-2b 3' UTRs (forward) (2258) 5'GAGAATCAGCATCATCTG3' (2276); (reverse) (2498) 5'TGATGGATCCTTAACCCA3' (2470) were synthesized and used for RT-PCR using conditions outline above. The results presented in Figure 1 (lanes 5–8) indicate that CDC25C-2b is a germline-specific transcript.

Intracellular levels of Cdc25 protein are stable during the mitotic cycle but vary during meiosis A purified porcine antibody specific for Cdc25C (Fig. 2) was used to determine the level of Cdc25C protein in somatic cells during the mitotic cell cycle and in oocytes during meiosis. The specificity of the purified porcine GST-Cdc25C antibody was determined using the following criteria. First, the purified GST-Cdc25C antibody recognized pure recombinant porcine Cdc25C protein but failed to respond to either Cdc25A or Cdc25B protein expressed in E. coli as HIS-tagged fusion protein. Cdc25A was a full-length human fusion protein; Cdc25B was a truncated human fusion protein with 70 amino acids deleted from the N-terminal end (human CDC25A and CDC25B clones a gift from Dr. David Beach, Cold Spring Harbor Laboratory, NY); Cdc25C was a full-length porcine fusion protein (Fig. 2). Further evidence was sought to eliminate the possibility that the purified pig Cdc25C antibody was recognizing inclusio' n body proteins from the bacterial system rather than the definitive Cdc25C protein. For this analysis, porcine CDC25C mRNA was translated in a rabbit reticulolysate system and after immunoblotting was probed with the porcine Cdc25C antibody. As shown in Figure 4, a single clean band was detected after in vitro translation that corresponded exactly with a band detected in oocytes injected 20 h previously with CDC25C mRNA. Moreover, the GST-Cdc25C antibody recognized the same oocyte proteins on immunoblots and showed the same immunolocalization pattern as the rabbit polyclonal IgG raised against a human Cdc25C carboxy terminus peptide (Santa Cruz c-20 Cdc25C antibody). Third, absorbed GST-Cdc25C antibody was used as a negative control in immunoblotting and immunolocalization studies. Cdc25C antibody was immunoabsorbed by incubating 250 µg purified GST-Cdc25C protein with 5 µg immunopurified Cdc25C antibody for 48 h at 4°C. A comparison on comparable Western blots of the Cdc25C band detected by porcine Cdc25C polyclonal antibody and its absorbed counterpart (Fig. 3A compared with Fig. 3C) provided evidence of antibody specificity in immunoblot analyses. Thus, the Cdc25C protein bands detected using purified porcine Cdc25C antibody (Fig. 3A) were not detected by antibody that had previously been absorbed with purified GST-Cdc25 fusion protein (Fig. 3C). Similar comparisons were made in immunolocalization experiments using porcine oocytes and confocal microscopy. The results, shown in Figure 7, demonstrate that Cdc25C protein was clearly detected in oocytes when purified Cdc25C antibody was used but that no protein was detected using absorbed antibody. Having established the specificity of our porcine Cdc25C antibody, it was thereafter exclusively used for the remainder of the experiments described in this paper.



View larger version (66K):
[in this window]
[in a new window]
 
FIG. 2. The three Cdc25 proteins (Cdc25A, Cdc25B and Cdc25C), expressed in E. coli as His-tagged fusion proteins were run on identical SDS-PAGE gels and thereafter transferred to nitrocellulose membrane by Western blotting. Identification of the three Cdc25 proteins using mouse anti-His-tag monoclonal antibody is shown in a. The second blot, probed with affinity-purified rabbit anti-pig Cdc25C polyclonal antibody, recognizes Cdc25C protein and nonspecific bacterial proteins but not Cdc25A or Cdc25B (see blot b)



View larger version (50K):
[in this window]
[in a new window]
 
FIG. 4. A Western blot showing the synthesis of Cdc25c protein in G2-stage porcine oocytes injected 20 h previously with CDC25C mRNA. The lanes show bacterially expressed His-tagged Cdc25C fusion protein (lane 1); 30 porcine oocytes injected with pig CDC25C mRNA (lane 2), 30 porcine oocytes injected with buffer as controls (lane 3), and Cdc25C protein translated from pig CDC25C mRNA in a rabbit reticulolysate in vitro translation system (lane 4)



View larger version (51K):
[in this window]
[in a new window]
 
FIG. 3. A) A representative Western blot showing Cdc25C protein levels in 3T3 fibroblasts at different mitotic cycle stages (G0, G1, S, G2, and M), in pig oocytes at different stages of meiosis (GV, MI, MII, and after activation [ACT], 200 oocytes per lane) and in recombinant His-tag pig Cdc25C fusion protein (25C protein). B) Quantitative densitospectrophotometric changes of optical density (O.D.) in Cdc25C protein during meiosis in pig oocytes. The specificity of the anti-Cdc25C antibody was examined by preparing a Western blot identical to that in A, but incubating it thereafter in purified Cdc25C polyclonal antibody previously absorbed with purified GST-Cdc25C fusion protein (C; Cdc25C absorbed)



View larger version (101K):
[in this window]
[in a new window]
 
FIG. 7. Nuclear organization and subcellular localization of Cdc25 protein in control and cdc25 antisense-injected porcine oocytes at different stages of meiosis. All oocytes were stained with propridium iodide (red) for chromatin visualization together with an affinity purified antibody (green) directed against the protein shown on each confocal micrograph. a) Antisense injection at 0 h, fixation at 20 h. b) Sense injection at 0 h, fixation at 26 h. c,d,e) Antisense injection at 0 h, fixation at 22, 26, or 48 h, respectively; arrows show shrunken nuclear membranes. f) Antisense injection at 0 h, fixation at 48 h showing oocyte that had escaped meiotic arrest. g) Antisense injection at 24 h, fixation at 48 h. h) Uninjected control oocytes electroactivated at 48 h and fixed at 66 h. i) Sense injection at 24 h, electroactivation at 48 h, and fixation at 66 h. j,k) Antisense injection at 24 h, electroactivation at 48 h, and fixation at 66 h. l,m) Subcellular localization of Cdc25 protein in G2-stage somatic cells and oocytes, respectively. n) Control G2-stage oocyte exposed to preabsorbed Cdc25 antibody. o) Subcellular localization of Cdc25 protein in antisense-injected (0 h) oocytes fixed at 20 h

A representative immunoblot of Cdc25C protein levels in 3T3 cells and oocytes at each stage of the mitotic and meiotic cycles is shown in Figure 3A. Densitometric analysis of mean band intensities in the Western blots of 3T3 cells (data not shown) confirmed previously published findings [11] by showing that Cdc25C protein levels are low in G0 but are uniformly high in the other 4 mitotic cycle phases. By contrast, densitometric analyses of immunoblots of oocytes using the same affinity purified antibody as used for the 3T3 cell analysis showed that changes in Cdc25C protein levels during meiosis differed markedly from those during mitosis. Thus, in oocytes Cdc25 protein levels were not detectable during the growth phase (data not shown). Fully grown oocytes at late G2 contained a low level of Cdc25 protein, which increased as meiosis progressed to metaphase I and increased further during the metaphase I to metaphase II transition. High levels of Cdc25 protein persisted after eggs were activated. These meiotic cycle changes in Cdc25 protein are seen most clearly after immunoblots were subjected to quantitative evaluation by densitometry (Fig. 3B). It is with the role of these changing intracellular levels of Cdc25 during the entry into metaphase, the passage from metaphase I to metaphase II, and the transition from meiosis to mitosis, that the ensuing studies are involved.

Role of Cdc25c Protein in the G2- to M-phase Transition

The first series of gain and loss of function experiments was carried out to test the hypothesis that the synthesis of Cdc25 protein is required for the full complement of nuclear events associated with entry into metaphase. For quantitative purposes, changes to the oocyte nucleus after manipulation of Cdc25 protein levels have been analyzed using 6 distinctive markers (indicated in parentheses below) of nuclear change that characterize the G2- to M-phase transition in normal oocytes. Thus, nuclei of late G2-staged oocytes contain a prominent nucleoli, dispersed chromatin (dispersed) and a clearly defined uniform nuclear membrane (uniform). In early diakinesis, the nucleolus disappears, the chromatin is condensed but disorganized (condensed), nuclear volume decreases, and the membrane becomes irregular in shape (contracted). In late diakinesis chromosomes are organized into bivalents (bivalents) and the nuclear membrane disassembles (disassembled). In porcine oocytes undergoing maturation in vivo, diakinesis is initiated at 18 to 22 h after the onset of estrus and nuclear membrane disassembly is completed 2 to 4 h later [27].

Premature synthesis of Cdc25 protein does not advance the timing of M-phase entry Oocytes were injected with CDC25C mRNA at the initiation of maturation (24 h before nuclear membrane disassembly) and were examined thereafter for evidence of either increased MPF kinase activity or premature metaphase entry to determine whether the timing of nuclear events during meiosis could be advanced by the premature induction of Cdc25 protein synthesis. That CDC25 mRNA is effectively translated into protein after injection into porcine oocytes was shown by Western blotting (Fig. 4). A single clear band was detected in immunoblots of 30 oocytes injected with CDC25 mRNA (Fig. 4, lane 2); no bands were seen in gels of 30 similar oocytes injected with carrier solution alone (Fig. 4, lane 3). Also shown for comparison is the slightly higher molecular weight HIS-tagged Cdc25c protein expressed in a bacterial system (Fig. 4, lane 1) and the expression product of pig CDC25C mRNA translated in an in vitro rabbit reticulolysate translation system (Fig. 4, lane 4).

Despite the effective up-regulation of newly synthesized Cdc25 protein in fully grown G2-staged oocytes, neither a rise in MPF kinase activity nor entry into M-phase occurred at an earlier stage than that of controls. This was shown firstly by a nonorthogonal analysis of MPF kinase activity, which indicated that no significant differences could be detected at 4, 8, or 16 h between control oocytes and oocytes injected with CDC25 mRNA at explantation. Secondly, statistical analyses showed that no premature chromatin condensation or membrane disassembly was detectable (P > 0.10) when mRNA-injected eggs were compared at 14 h or 17 h after injection with controls injected with diluent alone (Table 2).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Meiotic progression in oocytes injected with CDC25C mRNA at the initiation of maturation and examined by confocal microscopy at 14 h, 17 h, or 48 h, thereafter

Synthesis of Cdc25 protein is required for progress through diakinesis The requirement for new Cdc25 protein synthesis before entry into metaphase was further analyzed by inhibiting endogenous CDC25 mRNA translation by the injection of antisense constructs. The efficiency with which the injection of single-stranded cdc25 antisense DNA ablates endogenous CDC25C mRNA is illustrated in Figure 5. The results demonstrate that virtually all CDC25C mRNA is ablated by antisense DNA. Moreover, published results show that antisense-directed ablation in oocytes is rapid, with over 80% of mRNA cleavage occurring in the first 60 min after antisense injection [28]. Oocytes in the second series of experiments were injected with sense or antisense constructs at the initiation of maturation (G2) or at metaphase I. The injected oocytes were thereafter cultured for different periods of time before harvest for Western blot analysis of Cdc25C protein levels. The quantitative results are presented in Figure 6. Fully grown G2-phase oocytes that were injected with cdc25C antisense constructs at the initiation of maturation (0 h) contained low but detectable levels of Cdc25C protein when examined 24 h later (0–24 h). During the same period of time, Cdc25C protein levels in sense-injected controls had increased almost threefold above the antisense-treated group. It will be recalled that untreated G2-staged oocytes normally contain low levels of Cdc25C protein before the initiation of maturation (Fig. 3A: GV). We suggest, but have not proved, that a significant proportion of the Cdc25C protein detected in oocytes 24 h after antisense injection consists of protein synthesized before the initiation of maturation. As shown in Figure 3B, levels of Cdc25C protein increase from the onset of maturation to metaphase II; a similar increase is observed in control oocytes injected with sense constructs at 0 h or 24 h and harvested at metaphase II (Fig. 6: control groups). By contrast Cdc25C protein levels in oocytes injected with antisense DNA at G2 and harvested 24 h or 48 h later were very low (Fig. 6: 0–24 h and 0–48 h antisense injection). It is evident that oocytes injected at 24 h already contained significant amounts of Cdc25C protein before antisense injection (see Figure 3A: MI). The protein levels in this group at harvest reflected this fact but showed that no further increase in intracellular levels of Cdc25C protein occurred after translation was inhibited at early metaphase I (Fig. 6: 24–48 h antisense injection). Having established the effectiveness and specificity of the antisense DNA approach for CDC25C mRNA inactivation, we next used the technique to study the requirement for new Cdc25 synthesis during meiotic progression. The effect of inhibiting CDC25 translation on nuclear membrane structure and chromatin organization was compared in a series of experiments in which oocytes were injected with cdc25 sense or antisense constructs and then cultured for periods of 20 to 28 h (Table 3, Series A) or 48 to 68 h (Table 3, Series B) before fixation. As is evident from comparisons between groups of oocytes in Series A experiments, the arrest of CDC25 translation is without effect on meiotic progression during the first 20 h of maturation. In both control and treated groups, similar nuclear changes occurred during this period of prometaphase that culminates in early diakinesis. Despite the inhibition of CDC25 synthesis, condensation and aggregation of chromatin together with nuclear membrane shrinkage were all typical of normal nuclear changes during the first 20 h (Fig. 7a). Thereafter, significant differences between sense- and antisense-injected oocytes became apparent; by 22 h, clear bivalent formation characterized oocytes injected with sense constructs and normal metaphase plate formation was apparent in over 80% of these control oocytes by 26 h (Fig. 7b). By contrast, in antisense-injected oocytes, condensed chromatin (Fig. 7c) rather than bivalent formation predominated (P < 0.01 at 22 h and P < 0.001 at 24, 26, and 28 h). Significant differences in nuclear membrane disassembly between sense- and antisense-injected oocytes were not observed until 24 h when nuclear membrane disassembly occurred in sense-injected but not in antisense-injected oocytes (P < 0.001). These highly significant membrane differences (Fig. 7d) persisted, and at 28 h nuclear membrane breakdown was observed in > 90% of sense-injected oocytes but in only 30% of antisense-injected oocytes.



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 5. Analysis by RT-PCR of the efficiency of CDC25 mRNA deletion in oocytes following the injection of cdc25 antisense DNA. Lanes 1–4 serve as controls for the reverse transcription assay and show the levels of cyclin A2 mRNA in cdc 25 antisense injected oocytes. Lanes 5–8 show the levels of CDC 25 mRNA after antisense injection. Lane 0 contains DNA markers; lanes 1 and 5 are positive controls for the PCRs using 10 pg of the CDC25C or pig cyclin A2 plasmid DNA as template; lanes 2 and 6 show RT-PCR products from antisense-injected oocytes; lanes 3 and 7 show negative control of the PCRs without addition of any template DNA; and lanes 4 and 8 show control of antisense injection by injection of sense DNA into oocytes



View larger version (59K):
[in this window]
[in a new window]
 
FIG. 6. Western blot and densitometric analysis of Cdc25C protein levels in antisense DNA-injected oocytes and their controls. A) Western blots probed with purified Cdc25C polyclonal antibody; the arrow points to the Cdc25C protein band. The first two lanes from the left show the levels of Cdc25C protein in paired sets of oocytes (100 per set) injected with antisense or sense constructs at G2 and cultured thereafter for 24–26 h before analysis. Lanes 3 and 4 show similar sets of oocytes injected at G2 and harvested at 48 h postinjection. The final two lanes (right) show the result of injecting cdc25C antisense or sense DNA constructs into oocytes at 24 h and culturing them thereafter to 48 h before harvest. B) The Cdc25C band density of the above blots. The 0–24 h and 0–24 h cont. groups represent the experiment in which oocytes were injected with antisense or sense constructs, respectively, at G2 and harvested 24 h postinjection. Similarly, the 0–48 h and 0–48 h cont. and the 24–48 h and 24–48 h cont. represented, respectively, the experiments in which oocytes were injected G2 and harvested 48 h thereafter or injected at 24 h and harvested 24 h later.

Taken together, the results on chromatin organization and nuclear membrane structure (Table 3, Series A) suggest that in the absence of Cdc25 protein synthesis, meiosis progresses to early diakinesis but is arrested before entry into metaphase (Fig. 7, c and d). It is, furthermore, clear that the selective inhibition of Cdc25c protein synthesis affects meiosis in an entirely different manner from that observed following the arrest of total protein synthesis by cycloheximide supplementation (data not shown). Thus selective inhibition of Cdc25 synthesis results in nuclear membrane shrinkage and the hypercondensation of chromatin; arrest of all protein synthesis over the same period results in the retention of fully expanded G2-type nuclei and no hypercondensation of chromatin.

The experiments summarized in Table 3, Series B, were carried out to determine whether the block at diakinesis induced by cdc25 antisense injection was of a temporary or permanent nature. That arrest at late diakinesis is reversible in some oocytes was shown by injecting oocytes with cdc25 antisense constructs at explantation and maintaining them thereafter for 48 or 66 h in culture. It will be recalled that the results of the first series of experiments (Table 3, Series A) showed that nuclear membrane breakdown is prevented in about 70% of oocytes injected with cdc25 antisense constructs at explantation and examined 24–28 h later (n = 123). In Series B, only 32% of cdc25 antisense-injected oocytes examined at 48 h and 31% examined at 66 h remained blocked in a late diakinesis-like state (Fig. 7e). A statistical analysis of these results showed that the number of antisense-injected oocytes arrested in a diakinesis-like state at 28 h was significantly higher than that at 48 or 66 h (P <= 0.01). Oocytes that escaped from the arrested state underwent complete nuclear membrane breakdown and had formed spindles by 48 h after antisense injection (Fig. 7f).

The validity of the data showing that new Cdc25C protein synthesis is required for the completion of diakinesis depends on the specificity of the antisense approach. cdc25C sense constructs and carrier PBS controls injected in parallel with the antisense constructs provided initial evidence of specificity (see Table 3). However, to validate further the results obtained by antisense arrest of translation during the late G2-phase, an extended series of additional controls was carried out. The results are presented in Table 4. When comparing with uninjected oocytes, statistical analyses showed that neither the insertion of a microinjection needle alone nor the injection of control solutions (random oligonucleotides or cdc25 sense constructs) affected the proportion of oocytes that had undergone nuclear membrane breakdown by 26 h after the initiation of maturation. By contrast, membrane disassembly was blocked in the majority of oocytes injected with cdc25C antisense constructs (P < 0.001). The effect of control micromanipulative procedures on chromatin organization at 26 h after the induction of maturation was, however, more complicated than that on nuclear membrane disassembly. All 3 nonspecific micromanipulative procedures—namely needle insertion, random oligonucleotide injection, and cdc25 sense strand injection—had similar influences on metaphase plate organization. As compared with noninjected oocytes, needle insertion alone significantly increased the proportion of metaphase plate irregularities (P < 0.05). These irregularities were not further increased by the injection of either random oligonucleotides or cdc25C sense constructs. By contrast the injection of cdc25C antisense constructs significantly increased the proportion of oocytes with metaphase plate abnormalities over all other treatments (P < 0.001). Thus, nonspecific effects of micromanipulation during late prophase are without discernible effects on membrane disassembly but interfere to a limited extent with metaphase plate organization (P < 0.05). Injection of cdc25C antisense constructs on the other hand has a highly significant additional inhibitory action on both membrane disassembly (P < 0.001) and metaphase plate organization (P < 0.001).

Role of Cdc25C Protein in Meiotic Progression from Metaphase I to Mitosis

Synthesis of Cdc25C protein during metaphase I is not required for entry into metaphase II Having established in the previous study that the translation of CDC25C mRNA is required for the completion of diakinesis, we next designed experiments to identify the role of Cdc25C protein synthesis during metaphase progression. Specifically, we tested the hypothesis that the high level of Cdc25C protein synthesis during metaphase I (Fig. 3) induces the sharp increase in MPF-kinase activity required for progression from anaphase to metaphase II. Oocytes were injected with cdc25C antisense constructs during early metaphase I (24 h) and were cultured thereafter for a further 24 h, by which time untreated controls had progressed to metaphase II and entered meiotic arrest (Fig. 7g). Over 60% of oocytes in both sham-injected controls and antisense-injected groups progressed to metaphase II at levels comparable to uninjected controls (P > 0.1). As with untreated oocytes, those failing to reach metaphase II either remained in G2-arrest (approximately 10%) or were blocked in metaphase I (data not shown). None of the oocytes at 48 h showed premature assembly of (pro) nuclear membranes (pronuclear membranes absent = 100%), and no premature decondensation of chromatin had occurred (Table 5, series C). Thus, no evidence was obtained to suggest that the inhibition of CDC25C translation during early metaphase I had, in any statistically significant manner, affected meiotic progression from metaphase I to metaphase II.


View this table:
[in this window]
[in a new window]
 
TABLE 5. Effect of inhibiting translation of CDC25C mRNA in early MI (24 h after the initiation of maturation) on subsequent meiotic progression to MII (48 h) and, after activation, to pronuclear formation (66 h)

Synthesis of Cdc25C protein is necessary for the progression from meiosis to mitosis Since the synthesis of Cdc25C protein during M-phase is neither required for chromosome segregation nor for progression to metaphase II, we next examined the translational requirements underlying the final phase of meiotic progression induced by egg activation. The translation of CDC25C mRNA was inhibited by antisense injection in early metaphase I (24 h). Thereafter, oocytes were cultured to metaphase II, electroactivated, and analyzed 18 h later (66 h from the initiation of maturation). Pronuclear formation (Fig. 7h) occurred in over 75% of uninjected controls after electroactivation (data not shown). In sense/PBS-injected control groups, over 70% of eggs (Table 5, Series D) contained fully formed pronuclei with decondensed chromatin by 18 h postactivation (Fig. 7i). By contrast, normal pronuclear development was fivefold lower in antisense-injected eggs than in sham-injected controls (14% vs. 74%: P < 0 .01). Cell cycle progression after activation in cdc25 antisense-injected oocytes was arrested at one of two stages. Activation was followed by a partial loss of metaphase II plate organization but with no (pro) nuclear membrane assembly in 56% of oocytes (Fig. 7j). In a further 21% of oocytes, one or more small aberrant (pro) nuclei were reassembled around chromatin that consistently failed to decondense (Fig. 7k). In the remaining 14% of oocytes, apparently normal pronuclear formation was detected.

Additional control experiments, comparable to those presented earlier (see Table 4), were carried out to determine whether nonspecific effects of oocyte microinjection could themselves adversely affect pronuclear development. The results presented in Table 6 show that neither the insertion of the microinjection needle alone nor the injection of random oligonucleotides or cdc25C sense constructs adversely affected pronuclear membrane formation or chromatin decondensation (P > 0.10; treated groups compared to untreated controls). By contrast both uninjected oocytes and injected controls (needle penetration, random oligonucleotides, or cdc25 sense strand injection) differed significantly from oocytes injected with cdc25C antisense constructs, both with respect to the formation of (pro-) nuclear membranes (P < 0.001) and to the decondensation of chromatin after electroactivation (P < 0.05).


View this table:
[in this window]
[in a new window]
 
TABLE 6. Effect of control microinjection protocols carried out at 24 h (early MI) on the formation of pronuclei in oocytes activated at 48 h and examined at 66 h after the initiation of maturation

Subcellular Localization of Existing and Newly Synthesized Cdc25C Protein in Oocytes

Cdc25 protein is localized in both subcellular compartments during the G2-phase of meiosis This experiment tested the hypothesis that new synthesis of Cdc25C protein is required for progression through diakinesis because only newly synthesized Cdc25C molecules are translocated to their target site in the nucleus. However, before determining whether Cdc25C protein is specifically translocated to the oocyte nucleus before M-phase entry, we validated our antibodies for immunolocalization studies by first re-examining the subcellular localization of Cdc25C protein in somatic cells during the mitotic cycle. The results shown in Figure 7l indicate that Cdc25C is preferentially localized in the cytoplasm of Swiss 3T3 cells during early G2; cytoplasmic localization of Cdc25C protein in 3T3 cells was also observed in the G1- and S-phase of mitosis while nuclear localization was only observed in prometaphase (data not shown). By contrast, localization of Cdc25C protein in G2-phase oocytes removed from ovaries of pigs immediately after slaughter differs sharply from that observed in cultured cells during the phase of exponential growth. In G2-staged ex vivo oocytes, Cdc25C protein is located in both cellular compartments (Fig. 7m) but with a significantly (P < 0.001) higher pixel concentration (immunoreactive protein) in the nucleus (79.5 ± 6.2) than in the cytoplasm (48.9 ± 2.9). Increases in the total intracellular content of Cdc25C protein immediately before nuclear membrane disassembly are reflected by higher levels, but unaltered ratios, of this protein in both the nuclear (114.6 ± 6.5) and cytoplasmic compartments (68.6 ± 3.3 mean pixel intensity ± SEM).

Further validation of our Cdc25C antibody for immunolocalization studies in oocytes was carried out by incubating the antibody with purified Cdc25C protein before use. Thereafter, 26 oocytes obtained at the initiation of maturation and 46 oocytes obtained at 18 h after explantation were fixed and processed in a comparable manner to the above experimental groups, except that immunoabsorbed antibody was used. None of the oocytes that had been stained with immunoabsorbed antibody showed detectable Cdc25 fluorescence (green) in the confocal microscope but were instead intensely stained (red) with propridium iodide only (PI). The excellent specificity of the antibody can be clearly observed by comparing late prophase oocytes (18 h) stained with either normal (Fig. 7m) or immunoabsorbed (Fig. 7n) Cdc25C antibody followed thereafter by propridium iodide (PI) counterstaining.

Newly synthesized Cdc25C protein is preferentially localized in the nucleus The possibility that selectivity exists in determining which Cdc25 proteins are translocated to the nucleus has been studied in an additional experiment by comparing subcellular localization patterns in control oocytes with those in oocytes in which new synthesis was inhibited by antisense injection. In late prophase (20 h), 96% of cdc25C sense or PBS-injected control oocytes (n = 26) contained levels of Cdc25C protein in the nucleus (97.2 ± 6.4 mean pixel density) that were above those (62.3 ± 4.7 pixels) in the cytoplasm (Figure 7m). These results are in agreement with the quantitative data obtained using uninjected oocytes (see immediately preceding Results section). An entirely different subcellular localization pattern was observed in 70% of oocytes (15 out of 23) whose synthesis of new Cdc25C protein was inhibited by cdc25 antisense injection. In the majority of these oocytes (15), no accumulation of Cdc25C protein (Fig. 7o) was observed at 20 h after antisense injection (cytoplasm 59.8 ± 4.7; nucleus 51.2 ± 5.1 pixels). In the remaining 30% of oocytes, Cdc25C levels in the nucleus were highly variable but were all above those in the cytoplasm (cytoplasm 65.1 ± 3.9; nucleus 86.6 ± 9.7 pixels). These results suggest that newly synthesized protein preferentially accumulates in the nucleus and that complete ablation of CDC25C mRNA translation by antisense injection (probably occurring in 70–80% of injected oocytes) prevents the accumulation of Cdc25C in the nucleus of most oocytes.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Whilst the central cell-cycle machinery is highly conserved in all types of cells, different regulatory strategies are used to control mitotic progression from the G2- to the M-phase of the cell cycle. This diversity of regulation during mitosis is best illustrated in Drosophila, where 3 distinct molecular mechanisms regulate mitotic progression during the first 14 cell cycles in embryogenesis [29]. In meiosis, the mechanisms that regulate progression from the G2- to M-phase appear equally as diverse as those involved in regulating this transition during mitosis. Thus, the synthesis of B type cyclin is rate limiting in goldfish oocytes and is therefore thought to act as the regulator of MPF-kinase activity in this species [30, 31]. By contrast, results in Xenopus, clams, and starfish suggest that p34cdc2-cyclin B complexes are continuously present in an inactive form in fully grown G2-staged oocytes. In these species no new synthesis of B-type cyclins is considered necessary for the entry into metaphase, and regulation is imposed through the regulation of the phosphorylated state of p34cdc2 [3234]. Information on the levels of both stored and newly synthesized A- and B-type cyclins in porcine oocytes indicate that neither the synthesis of cyclin B1 nor the A type cyclins is likely alone to regulate the G2- to M-phase transition, although cyclin B2 synthesis may be more important in this respect ([14]; Dai Y and Moor RM, unpublished results). To parallel the studies on cyclin synthesis, attention has been focused in mammals on the regulatory molecules that maintain MPF in an inactive state during the G2-phase. Studies by Mitra and Schultz [35] identified the presence of wee1 transcripts in fully grown mouse oocytes and suggested that a 55-kDa truncated wee1 protein was present in these cells. We have cloned porcine wee1 cDNA from oocyte enriched libraries, constructed appropriate primers, and used RT-PCR in expression studies [15]. Although wee1 mRNA was detected in porcine follicle cells and growing oocytes, none was detected in fully grown oocytes. Likewise, in immunoblots of fully grown oocytes, we failed to detect the definitive wee1 protein. Despite the absence of wee1 mRNA, a 55-kDa protein, comparable to that found in mouse oocytes, was detected in porcine oocytes using the same human anti-wee1 antibody as had been used in the studies of Mitra and Schultz [35]. Should it transpire that the p55 protein is an authentic but truncated wee1 gene product and that the truncation has arisen from an N-terminal deletion [4, 36], this will be particularly important when considering its function in the oocyte since the N-terminal domain of wee1 is known to regulate its substrate specificity and activity in yeast [3]. The potential inhibitory action of wee1 during the cell cycle is, however, counteracted by a stimulatory action of the phosphatase coded for by the CDC25 gene, and it is on the expression, localization, and function of Cdc25 protein during meiosis that the present paper focuses.

Cell-cycle specific analysis in mammalian cells indicates that Cdc25A and Cdc25C perform different functions during mitosis [8, 37, 38]. The role of Cdc25A is closely associated with the G1- to S-phase transition whilst Cdc25C functions predominantly at the G2- to M-phase boundary. During germline development in mice, both CDC25 transcripts are expressed at high levels [39]. Thereafter, CDC25A and CDC25B are differentially expressed during mouse development whilst CDC25C expression in later development has not been determined [39]. We have cloned the CDC25C variant because of its central function in M-phase entry in somatic cells. In addition to the widely expressed CDC25C somatic transcripts, we have also identified an oocyte specific homolog that differs from the mitotic form in the 3' UTR only. We postulate that the extended 3' UTR in germline cells contains the cis-acting regulatory sequences that underpin differences in CDC25 mRNA regulation in oocytes as compared with adjacent somatic cells. Apart from the AAUAAA hexanucleotide signal, it is noteworthy that the oocyte-specific 3' UTR in porcine CDC25C transcripts is devoid of identical U-rich cytoplasmic polyadenylation elements (CPE) to those that act as cis-acting motifs in lower animals [reviewed in 40]. Instead, the extended 3' UTR in porcine CDC25C transcripts contains both a UUUUUAA motif and an A-rich region with close homology to similar motifs in porcine c-mos mRNA [41]. Mutational analysis of these putative regulatory regions of porcine c-mos mRNA are currently being undertaken by us to identify their role in translational control during meiosis.

The levels of Cdc25 protein in fission yeast (S. pombe) and postblastoderm Drosophila embryos increase significantly before entry into M-phase [42, 43]. By contrast, in mammalian somatic cells no significant changes in the levels of Cdc25C protein during the cell cycle have been reported, although cyclical variations in the levels of CDC25 mRNA occur [9, 44, 45]. Whilst Cdc25 protein levels remain constant, both the degree of phosphorylation and the resultant activity of Cdc25 phosphatase increase shortly before entry into M-phase in both Xenopus oocytes and in cultured mammalian cells [10, 46]. Porcine oocytes differ from somatic cells with respect to their intracellular levels of Cdc25C protein. We find that the level of Cdc25C protein is below our level of detection in growing oocytes, is still low but detectable at the initiation of oocyte maturation, and increases to high levels at metaphase I. Furthermore, no changes in the electrophoretic mobility of Cdc25 protein were detected at any stage of meiosis or after CDC25 mRNA injection. These findings could either imply that the phosphorylated state of Cdc25 protein in oocytes does not change significantly during meiosis or alternatively that our affinity-purified antibody recognizes only one phosphorylated state of Cdc25 protein.

The analysis of CDC25C expression in oocytes was undertaken to provide the foundation for our principal objective of identifying the role of Cdc25 protein synthesis in controlling different components of the meiotic cycle. For this purpose we have monitored the effects on chromatin, nuclear membrane, and spindle organization of up- or down-regulating levels of Cdc25 protein in oocytes in the late G2- or M-phase of meiosis. The results of up-regulating Cdc25 protein levels in fully-grown G2-phase mammalian oocytes indicate that this alone is insufficient to drive these cells into metaphase. This finding differs from that in Xenopus oocytes, where rapid nuclear envelope breakdown is induced by the injection of either Drosophila CDC25C mRNA or full-length recombinant Cdc25 protein [7, 47]. In an extension of the earlier studies, Hoffman and colleagues [10] have shown that recombinant Cdc25 protein, in its unphosphorylated form, is incapable of inducing nuclear envelope breakdown, whereas thiophosphorylated Cdc25 induces membrane breakdown in 2 to 3 h. Although our results differ from those in Xenopus, they are in good agreement with the published results on Cdc25 protein up-regulation in mammalian somatic cells. Overexpression of Cdc25 protein in Hela or BHK cells, induced by transfection of epitope-tagged DNA, failed to enhance entry into M-phase [48]. Even direct injection of thiophosphorylated Cdc25 protein into G2-phase somatic cells failed to elicit nuclear membrane disassembly and premature entry into M-phase. The injection of phosphorylated Cdc25 protein did, however, induce slight chromatin condensation together with changes in the shape of the somatic cells [49]. In fully grown oocytes, effective up-regulation of newly synthesized Cdc25 protein failed to induce either premature chromatin condensation or nuclear membrane disassembly. From this we conclude that the timing of the G2 to M-phase transition in the oocytes of higher mammals is not determined primarily by the timing of CDC25 mRNA translation. Coexpression experiments have further strengthened this conclusion. Somatic cells cotransfected with both cyclin B1 and CDC25 underwent chromatin condensation, nuclear membrane disassembly, and spindle formation; alignment of chromosomes on the spindle did not, however, occur [48]. We have repeated those coexpression experiments in oocytes with essentially similar results [Moor R, Dai Y, unpublished results]; our interpretation is that new synthesis of Cdc25 protein in mammalian oocytes is not the key rate-limiting component during late G2-arrest.

While our gain-of-function results demonstrated that the synthesis of Cdc25 protein is insufficient on its own to induce premature entry into M-phase, those experiments were not designed to show whether new synthesis of Cdc25 protein forms part of the complex of changes that drive the meiotic cycle through its different phases of progression. For this purpose we inhibited CDC25C mRNA translation using both the highly effective antisense DNA technique of Morgan and colleagues [18] together with a range of safeguards introduced to reduce the risks associated with antisense inhibition of translation. While it is clear from our extensive series of control experiments that the injection of antisense constructs may not be inhibitory to meiotic progression, this is true only if a number of preconditions are met. Firstly, oligonucleotides require extensive purification before injection [28]; all our synthetic oligonucleotides were chromatographically purified before use to eliminate this cause of nonspecificity. The injection of excessive volumes of fluid (>10 pl) or the use of excessive pressure during injection have also been found by us to induce nonspecific effects on meiotic progression in porcine oocytes. When these criteria are fulfilled, the results of inhibiting CDC25C mRNA translation in G2-stage oocytes show that only events associated with late diakinesis including membrane disassembly, spindle formation, and chromosome alignment fail in the absence of new Cdc25 synthesis. These results can usefully be compared with those in which a partial (rounding-up of cells and some chromatin condensation) but abortive (no nuclear membrane disassembly) G2- to-M-phase transition occurs in somatic cells following the injection of phosphorylated cdc25 protein [49]. The combined results presented above underline the similarities of control in different mammalian cells and, in addition, stress the importance, highlighted by Murray [50], of studying meiotic cycle control in a variety of mammals rather than only in the currently favored small group of lower order animals. Indeed, our experiments indicate that the regulatory role of Cdc25 during the G2-to-M-phase transition in mammalian oocytes appears in some respects to be more similar to that in somatic cells than it is to that in amphibian oocytes.

It is clear from a wide range of somatic cell studies that the compartmental localization of proteins is an important means of cell cycle control [48, 51]. In the case of Cdc25 protein, the published results on subcellular compartmentalization in cultured somatic cells are contradictory at present with some groups claiming that Cdc25 is localized in the nucleus during the G2-phase of mitosis [9, 49, 52] whilst other groups report the reverse [46, 48, 53]. Our results on synchronized populations of Swiss 3T3 cells support those investigators who report that Cdc25 protein is localized in the cytoplasm during the G2-phase of mitosis. During the G2-phase of meiosis, Cdc25 protein is distributed across both cellular compartments of the oocytes but at a 30% higher concentration in the nucleus. However, because of large differences in volume, the total Cdc25 protein content in the cytoplasm is more than 100-fold higher than in the nucleus. The much greater total amount of Cdc25 protein in the cytoplasm supports the biochemical measurements of Izumi and colleagues [46], who showed by cell fractionation that Cdc25C protein is localized predominantly in the cytoplasm of G2-stage Xenopus oocytes. In addition to quantitative changes in the subcellular distribution of Cdc25 protein during the cell cycle, Strausfeld and colleagues [49] emphasized that qualitative changes in the Cdc25 molecule may also be important. These workers showed that the nonphosphorylated form of Cdc25 protein is more highly concentrated in the nucleus than the phosphorylated protein while denatured Cdc25 is localized solely in the cytoplasm. Our results support the concept of qualitative regulation by showing that Cdc25 protein accumulation in oocyte nuclei is associated predominantly with the translocation of newly synthesized molecules. However, uncertainties about our results on the phosphorylated state of Cdc25 protein in oocytes does not enable us to comment on the potential link between phosphorylation and nuclear translocation during meiosis.

The postulated requirement during the metaphase I to metaphase II transition for new Cdc25 synthesis is not supported by the experimental evidence presented in this paper. However, our studies on activated eggs have revealed an unexpected requirement for new Cdc25 protein synthesis in order to support normal pronuclear formation. In the absence of Cdc25 synthesis during the MI to MII transition, both pronuclear membrane assembly and chromatin decondensation are compromised in activated eggs. This novel finding raises the possibility that Cdc25 phosphatase has actions on cell cycle related proteins additional to its well-characterized action on the catalytic subunit of MPF kinase.


    ACKNOWLEDGMENTS
 
We would like to thank Dianne Styles and Karen Waterton for typing and editing the manuscript. The generous assistance of Dr. David Brown with the statistical analyses carried out in this paper is gratefully acknowledged.


    FOOTNOTES
 
First decision: 10 May 1999.

1 Corresponding author: Dr Yanfeng Dai, The Babraham Institute, Department of Development and Genetics, Cambridge CB2 4AT, UK. FAX: 44 (1223) 496030; yanfeng.dai{at}bbsrc.ac.uk Back

Accepted: October 15, 1999.

Received: April 5, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Nurse P. Universal control mechanism regulating onset of M-phase. Nature 1990; 344:503–508.[CrossRef][Medline]
  2. Russell P, Nurse P. Negative regulation of mitosis by wee1+, a gene encoding a protein kinase homolog. Cell 1987; 49:559–567.[CrossRef][Medline]
  3. Parker LL, Atherton-Fessler S, Piwnica-Worms H. Tyrosine kinase P107 wee1 is a dual-specificity kinase that phosphorylates p34cdc2 on tyrosine 15. Proc Natl Acad Sci USA 1992; 89:2917–2921.[Abstract/Free Full Text]
  4. Watanabe N, Broome M, Hunter T. Regulation of the human wee1 Hu CDK tyrosine 15-kinase during the cell cycle. EMBO J 1995; 14: 1878–1891.
  5. Russell P, Nurse P. cdc25+ functions as an inducer in the mitotic control of fission yeast. Cell 1986; 45:145–153.[CrossRef][Medline]
  6. Kumagai A, Dunphy W. The cdc25 protein controls tyrosine dephosphorylation of the cdc2 protein in a cell-free system. Cell 1991; 64:903–914.[CrossRef][Medline]
  7. Gautier J, Solomon MJ, Booher RN, Bazan JR, Kirschner MW. cdc25 is a specific tyrosine phosphatase that directly activates p34cdc2. Cell 1991; 67:197–211.[CrossRef][Medline]
  8. Strausfeld U, Labbe JC, Fesquet D, Cavadore JC, Picard A, Sadhu K, Russell P, Doree M. Dephosphorylation and activation of a p34cdc2/cyclin B complex in vitro by human cdc25 protein. Nature 1991; 351:242–245.[CrossRef][Medline]
  9. Girard F, Strausfeld U, Cavadore JC, Russell P, Fernandez A, Lamb NJC. cdc25 is a nuclear protein expressed constitutively throughout the cell cycle in non transformed mammalian cells. J Cell Biol 1992; 118:785–794.[Abstract/Free Full Text]
  10. Hoffmann I, Clarke PR, Marcote MJ, Karsenti E, Draetta G. Phosphorylation and activation of human cdc25C by cdc2-cyclin B and its involvement in the self-amplification of MPF at mitosis. EMBO J 1993; 12:53–63.[Medline]
  11. Hoffmann I, Karsenti E. The role of cdc25 in checkpoints and feedback controls in the eukaryotic cell cycle. J Cell Sci 1994; 18:75–79.
  12. Fulka J Jr, Moor RM, Fulka J. Sister chromatid separation and the metaphase-anaphase transition in mouse oocytes. Dev Biol 1994; 165:410–417.[CrossRef][Medline]
  13. Christmann L, Jung T, Moor RM. MPF components and meiotic competence in growing pig oocytes. Mol Reprod Dev 1994; 38:85–90.[CrossRef][Medline]
  14. Naito K, Hawkins C, Yamashita M, Nagahama Y, Aoki F, Kohmoto K, Toyoda Y, Moor RM. Association of p34cdc2 and cyclin B1 during meiotic maturation in porcine oocytes. Dev Biol 1995; 168:627–634.[CrossRef][Medline]
  15. Dai Y, Zhang J, Lee J, Moor RM. Molecules involved in the metaphase I to metaphase II transition in mammalian oocytes. In: Gametes: Development and Function. Rome: Serono Symposia Series; 1998: 155–175.
  16. Cui H, Xu WX, Powell DJ, Newman B. Cloning and sequencing of pig cdc25 tyrosine phosphatase cDNA. J Anim Sci 1995; 73:630.[Medline]
  17. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162:156–159.[Medline]
  18. Morgan R, Edge M, Colman A. A more efficient and specific strategy in the ablation of mRNA in Xenopus laevis using mixtures of antisense oligos. Nucleic Acids Res 1993; 21:4615–4620.[Abstract/Free Full Text]
  19. Harlow E, Lane D. In: Antibodies. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1988: 53–135.
  20. Brown KD, Blakeley DM. Inhibition of the binding of I-125-labelled epidermal growth-factor to mouse cells by a mitogen in goat mammary secretions. Biochem J 1983; 212:465–472.[Medline]
  21. Corps AN, Brown KD. Induction of DNA synthesis and cell division in quiescent cells in response to small peptide growth factors. In: McKay I, Leigh I (eds.), Growth Factors: A Practical Approach. Oxford, UK: IRL Press at OUP; 1993.
  22. Sun FZ, Hoyland J, Huang X, Mason WT, Moor RM. A comparison of intracellular changes in porcine eggs after fertilization and electroactivation. Development 1992; 115:947–956.[Abstract]
  23. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970; 227:680–685.[CrossRef][Medline]
  24. Baldin V, Ducommun B. Subcellular localization of human wee1 kinase is regulated during the cell cycle. J Cell Sci 1995; 108:2425–2432.[Abstract]
  25. Zelen M. The analysis of several 2 x 2 contingency tables. Biometrika 1971; 58:129–137.[Abstract/Free Full Text]
  26. Brown D, Rothery P. Models in biology. In: Mathematics, Statistics and Computing. Chichester: John Wiley; 1993: chapter 14.
  27. Motlik J, Fulka J. Breakdown of the germinal vesicle in pig oocytes in vivo and in vitro. J Exp Zool 1976; 198:155–162.[CrossRef][Medline]
  28. Shuttleworth J, Colman A. Antisense oligonucleotide-directed cleavage of mRNA in Xenopus oocytes and eggs. EMBO J 1988; 7:427–434.[Medline]
  29. Edgar BA, Sprenger F, Duronio RJ, Leopold P, O'Farrell PH. Distinct molecular mechanisms regulate cell cycle timing at successive stages of Drosophila embryogenesis. Genes Dev 1994; 8:440–452.[Abstract/Free Full Text]
  30. Hirai T, Yamashdita M, Yoshikuni M, Lou Y-H, Nagaham AY. Cyclin B in fish oocytes: its cDNA and amino acid sequences, appearance during maturation, and induction of p34cdc2 activation. Mol Reprod Dev 1992; 33:131–140.[CrossRef][Medline]
  31. Katsu Y, Yamashita M, Kajiura H, Nagahama Y. Behaviour of the components of maturation-promoting factor, cdc2 kinase and cyclin B, during oocyte maturation of goldfish. Dev Biol 1993; 160:99–107.[CrossRef][Medline]
  32. Gautier J, Maller JL. Cyclin B in Xenopus oocytes: implications for the mechanism of pre-MPF activation. EMBO J 1991; 10:177–182.[Medline]
  33. Kobayashi H, Minshull J, Ford C, Golsteyn R, Poon R, Hunt T. On the synthesis and destruction of A- and B-type cyclins during oogenesis and meiotic maturation in Xenopus laevis. J Cell Biol 1991; 114:755–765.[Abstract/Free Full Text]
  34. Westendorf JM, Swenson KI, Ruderman JV. The role of cyclin B in meiosis I. J Cell Biol 1989; 108:1431–1444.[Abstract/Free Full Text]
  35. Mitra J, Schultz RM. Regulation of the acquisition of meiotic competence in the mouse: changes in the subcellular localization of cdc2, cyclin B1 cdc25C and wee1, and in the concentration of these proteins and their transcripts. J Cell Sci 1996; 109:2407–2415.[Abstract]
  36. McGowan CH, Russell P. Cell cycle regulation of human wee1. EMBO J 1995; 14:2166–2175.[Medline]
  37. Jinno S, Suto K, Nagata A, Igarashi M, Kanaoka Y, Nojima H, Okayama H. cdc25A is a novel phosphatase functioning early in the cell cycle. EMBO J 1994; 13:1549–1556.[Medline]
  38. Hoffmann I, Draetta G, Karsenti E. Activation of the phosphatase activity of human cdc25A by a cdk2-cyclin E dependent phosphorylation at the G1/S transition. EMBO J 1994; 13:4302–4310.[Medline]
  39. Wickramasinghe D, Becker S, Ernst MK, Resnick JL, Centanni JM, Tessarollo L, Grabel LB, Donovan PJ. Two cdc25 homologues are differentially expressed during mouse development. Development 1995; 121:2047–2056.[Abstract]
  40. Stebbins-Boaz B, Richter JD. Translational control during early development. Eukaryotic Gene Experiments 1997; 7:73–94.
  41. Newman B, Dai Y. Transcription of c-mos protooncogene in the pig involves both tissue-specific promoters and alternative polyadenylation sites. Mol Reprod Dev 1996; 4:275–288.
  42. Booher R, Beach D. Involvement of type 1 protein phosphatase encoded by bws1+ in fission yeast mitotic control. Cell 1989; 57:1009–1016.[CrossRef][Medline]
  43. Moreno S, Nurse P, Russell P. Regulation of mitosis by cyclic accumulation of p80cdc25 mitotic inducer in fission yeast. Nature 1990; 344:5649–552.
  44. Sadhu K, Reed SI, Richardson H, Russell P. Human homolog of fission yeast cdc25 mitotic inducer is predominantly expressed in G2. Proc Natl Acad Sci USA 1990; 87:5139–5143.[Abstract/Free Full Text]
  45. Millar JBA, Russell P. The cdc25 M-phase inducer: an unconventional protein phosphatase. Cell 1992; 68:407–410.[CrossRef][Medline]
  46. Izumi T, Walker DH, Maller JL. Periodic changes in phosphorylation of the Xenopus cdc25 phosphatase regulates its activity. Mol Biol Cell 1992; 3:927–939.[Abstract]
  47. Lee MS, Ogg S, Xu M, Parker LL, Donaghue DJ, Maller JM, Piw-nica-Worms H. cdc25+ encodes a protein phosphatase that dephosphorylates p34cdc2. Mol Biol Cell 1992; 3:73–84.[Abstract]
  48. Heald R, McLoughlin M, McKeon F. Human wee1 maintains mitotic timing by protecting the nucleus from cytoplasmically activated cdc2 kinase. Cell 1993; 74:463–474.[CrossRef][Medline]
  49. Strausfeld AU, Fernandez A, Capony JP, Girard F, Lautredou N, Derancourt J, Labbe JC, Lamb NJC. Activation of p34 (cdc2) protein-kinase by microinjection of human cdc25C into mammalian-cells-requirement for prior phosphorylation of cdc25C by per (cdc2) at mitosis on sites phosphorylated. J Biol Chem 1994; 269:5989–6000.[Abstract/Free Full Text]
  50. Murray AW. MAP kinases in meiosis. Cell 1998; 92:157–159.[CrossRef][Medline]
  51. Pines J, Hunter T. The differential localization of human cyclins A and B is due to a cytoplasmic retention signal in cyclin B. EMBO J 1994; 13:3772–3781.[Medline]
  52. Millar JBA, Blevitt J, Gerace L, Sadhu K, Featherstone C, Russell P. p55-cdc25 is a nuclear protein required for the inititation of mitosis in human cells. Proc Natl Acad Sci USA 1991; 88:10500–10504.[Abstract/Free Full Text]
  53. Seki T, Yamashita K, Nishitani H, Takagi T, Russell P, Nishimoto T. Chromosome condensation caused by loss of RCC1 function requires the cdc25C protein that is located in the cytoplasm. Mol Biol Cell 1992; 3:1373–1388.[Abstract]



This article has been cited by other articles:


Home page
ReproductionHome page
L. Gall, D. Le Bourhis, S. Ruffini, C. Boulesteix, and X. Vignon
Unexpected nuclear localization of Cdc25C in bovine oocytes, early embryos, and nuclear-transferred embryos
Reproduction, April 1, 2008; 135(4): 431 - 438.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
X.-Q. Meng, K.-G. Zheng, Y. Yang, M.-X. Jiang, Y.-L. Zhang, Q.-Y. Sun, and Y.-L. Li
Proline-rich tyrosine kinase2 is involved in F-actin organization during in vitro maturation of rat oocyte.
Reproduction, December 1, 2006; 132(6): 859 - 867.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
E. Gershon, D. Galiani, and N. Dekel
Cytoplasmic polyadenylation controls cdc25B mRNA translation in rat oocytes resuming meiosis
Reproduction, July 1, 2006; 132(1): 21 - 31.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
X. Li, Y Qin, S. Wilsher, and W R Allen
Centrosome changes during meiosis in horse oocytes and first embryonic cell cycle organization following parthenogenesis, fertilization and nuclear transfer.
Reproduction, April 1, 2006; 131(4): 661 - 667.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Y. Dai, B. Newman, and R. Moor
Translational Regulation of MOS Messenger RNA in Pig Oocytes
Biol Reprod, November 1, 2005; 73(5): 997 - 1003.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
Y.-K. Cao, Z.-S. Zhong, D.-Y. Chen, G.-X. Zhang, H. Schatten, and Q.-Y. Sun
Cell cycle-dependent localization and possible roles of the small GTPase Ran in mouse oocyte maturation, fertilization and early cleavage
Reproduction, October 1, 2005; 130(4): 431 - 440.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
X. Li, Y. Dai, and W.R. Allen
Influence of Insulin-Like Growth Factor-I on Cytoplasmic Maturation of Horse Oocytes In Vitro and Organization of the First Cell Cycle Following Nuclear Transfer and Parthenogenesis
Biol Reprod, October 1, 2004; 71(4): 1391 - 1396.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
L.-J. Yao, Z.-S. Zhong, L.-S. Zhang, D.-Y. Chen, H. Schatten, and Q.-Y. Sun
Aurora-A Is a Critical Regulator of Microtubule Assembly and Nuclear Activity in Mouse Oocytes, Fertilized Eggs, and Early Embryos
Biol Reprod, May 1, 2004; 70(5): 1392 - 1399.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
T. Kuroda, K. Naito, K. Sugiura, M. Yamashita, I. Takakura, and H. Tojo
Analysis of the Roles of Cyclin B1 and Cyclin B2 in Porcine Oocyte Maturation by Inhibiting Synthesis with Antisense RNA Injection
Biol Reprod, January 1, 2004; 70(1): 154 - 159.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
C. Robert, I. Hue, S. McGraw, D. Gagne, and M.-A. Sirard
Quantification of Cyclin B1 and p34cdc2 in Bovine Cumulus-Oocyte Complexes and Expression Mapping of Genes Involved in the Cell Cycle by Complementary DNA Macroarrays
Biol Reprod, November 1, 2002; 67(5): 1456 - 1464.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
C. Tong, H.-Y. Fan, L. Lian, S.-W. Li, D.-Y. Chen, H. Schatten, and Q.-Y. Sun
Polo-Like Kinase-1 Is a Pivotal Regulator of Microtubule Assembly During Mouse Oocyte Meiotic Maturation, Fertilization, and Early Embryonic Mitosis
Biol Reprod, August 1, 2002; 67(2): 546 - 554.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. P. Venables, M. Ruggiu, and H. J. Cooke
The RNA-binding specificity of the mouse Dazl protein
Nucleic Acids Res., June 15, 2001; 29(12): 2479 - 2483.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dai, Y.
Right arrow Articles by Moor, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dai, Y.
Right arrow Articles by Moor, R.
Agricola
Right arrow Articles by Dai, Y.
Right arrow Articles by Moor, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS