Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Buzzard, J. J.
Right arrow Articles by Wreford, N. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Buzzard, J. J.
Right arrow Articles by Wreford, N. G.
Agricola
Right arrow Articles by Buzzard, J. J.
Right arrow Articles by Wreford, N. G.
Biology of Reproduction 62, 664-669 (2000)
© 2000 Society for the Study of Reproduction, Inc.

Articles

Developmental Expression of Thyroid Hormone Receptors in the Rat Testis1

Jeremy J. Buzzarda,b, John R. Morrisonb, Moira K. O'Bryanb, Qing Songa, and Nigel G. Wreford2,a

a Department of Anatomy and b Institute of Reproduction and Development, Monash University, Clayton, Victoria, 3168, Australia


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RT-PCR
 RESULTS
 DISCUSSION
 REFERENCES
 
Sertoli cell proliferation in the rat is completed by Days 15–20 postnatally. Thyroid hormones appear to regulate the duration of Sertoli cell proliferation, affecting adult Sertoli cell number and hence the capacity of the testis to produce sperm. In the present study, a combination of immunohistochemistry, immunoblot analysis, and reverse transcription-polymerase chain reaction was used to demonstrate the expression pattern of thyroid hormone receptors (TR) in the juvenile and adult rat testis. The results indicated that TR{alpha}1 was expressed in proliferating Sertoli cell nuclei, its expression decreasing coincident with the cessation of proliferation. TR{alpha}2, TR{alpha}3, and TRß1 mRNAs were expressed at low levels during development; however, the corresponding protein was not detected by immunoblot analysis. In addition, TR{alpha}1 was found to be expressed in germ cells from intermediate spermatogonia to mid-cycle pachytene spermatocytes. Immunohistochemistry also demonstrated TR expression in a subset of interstitial cells. The demonstration of TR expression in germ cells undergoing spermatogenic differentiation suggests a possible role for thyroid hormones in the adult testis.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RT-PCR
 RESULTS
 DISCUSSION
 REFERENCES
 
In the rat, Sertoli cells proliferate only during the fetal and early neonatal periods before assuming a terminally differentiated state [1, 2]. The ultimate number of Sertoli cells in the adult testis is determined by both the rate and the duration of the proliferative phase. It has been demonstrated that each Sertoli cell is capable of supporting a limited number of germ cells through to maturity [3–7]; hence Sertoli cell number determines the maximum spermatogenic potential of the testis. The hormonal factors controlling the rate and duration of Sertoli cell proliferation are therefore critical determinants of fertility. Previous studies have demonstrated that FSH is a mitogenic factor during the Sertoli cell proliferative phase [6, 8], while thyroid hormones (triiodothyronine and thyroxine) influence the duration of proliferation [9–13].

Neonatal hypothyroidism has been shown to lead to a prolongation of the period of Sertoli cell proliferation, giving rise to an increase in the numbers of Sertoli and germ cells, and a concomitant increase in testis size [10, 11, 14,15]. Conversely, neonatal hyperthyroidism has been shown to lead to early cessation of Sertoli cell division, giving rise to decreased numbers of Sertoli and germ cells, and consequently a decrease in testis size [12, 16, 17]. Since these conditions influence Sertoli cell number, they also influence the capacity of the testis to produce sperm [3–7, 18].

Thyroid hormone effects are mediated by thyroid hormone receptors (TR), which are members of the steroid receptor superfamily [19]. TR are encoded by two different genes: TR{alpha} and TRß. Alternate splicing leads to the production of several peptide isoforms, five of which have been described: TR{alpha}1, TR{alpha}2, TR{alpha}3, TRß1, and TRß2. TR{alpha}2 and TR{alpha}3, which lack a hormone-binding domain, are thought to function as inhibitors of thyroid hormone action by competition for the binding of thyroid response elements (TRE), resulting in suppression of transcription [20–25].

Early studies suggested that the adult testis is unresponsive to thyroid hormones [26, 27]. This observation was extrapolated to the developing animal, leading to the proposal of indirect mechanisms to explain the effects of thyroid hormones on Sertoli cell proliferation [28]. The cloning of cDNA encoding TR from a human testis expression library provided the first suggestion that thyroid hormones act directly on the testis [29]. Given the known effect of thyroid hormones on Sertoli cell development, a number of studies have investigated TR in the developing testis.

Binding studies have demonstrated specific thyroid hormone binding sites (presumed to be TR) in developing testes and Sertoli cell-enriched extracts. These binding sites were detected at very high levels in the fetus and early neonate, decreasing towards negligible expression at Day 20 postpartum (pp) [30, 31]—a pattern coincident with the proliferative phase of Sertoli cell development. Several molecular techniques have been used to demonstrate the presence of mRNA encoding TR{alpha} isoforms in fetal and neonatal testes [32]. Similar techniques indicate that TRß expression is present but significantly lower than TR{alpha} [32,33]. These studies also suggest that TR expression is absent in the adult testis. In contrast, immunohistochemical data has shown the existence of TR in the adult testis, although the exact cellular localization remains unclear [34–36].

The present study was undertaken to clarify the expression patterns of TR mRNA and protein in the rat testis during development and in the adult. We aimed to determine which TR isoforms are expressed in the developing and adult testis using a combination of reverse transcription (RT)-polymerase chain reaction (PCR) and immunoblot analysis. The localization of TR to nuclei within the seminiferous epithelium was achieved using immunohistochemistry.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RT-PCR
 RESULTS
 DISCUSSION
 REFERENCES
 
Tissue Collection

Male Sprague-Dawley rats were obtained from the Monash Central Animal house where they were kept on a 12L:12D regime with food and water ad libitum. All experiments involving animals were conducted in accordance with the Guide for the Care and Use of Laboratory Animals (1996; National Academy of Science, Washington, DC), and the studies were approved by the Monash University (Victoria, Australia) Department of Anatomy animal ethics committee. Tissue samples were collected from rats at Days 0, 5, 15, 25, and 63 pp. Rats were anesthetized with ether, and their abdominal and thoracic cavities were opened. For RT-PCR and immunoblot studies, testes, liver, kidneys, and/or pituitary gland were removed, snap-frozen with liquid nitrogen, and stored at -75°C until required. For immunohistochemical studies, rats were perfused with heparin (25 000 IU/L; DBL, Melbourne, Australia) saline (0.9% NaCl) followed by PLP fixative (2% w:v paraformaldehyde, 0.075 M L-lysine, and 0.01 M periodate, all from Sigma (St. Louis, MO) via a needle into the left ventricle (pp Days 0 and 5 rats), or a catheter in the descending thoracic aorta (all other ages). The left testis was removed and processed to Paraplast paraffin wax (Oxford Labware, St. Louis, MO) for histology. Sections (5 µm) were cut and mounted on Superfrost Plus slides (Biolab Scientific, Melbourne, Australia) for immunohistochemistry.


   RT-PCR
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RT-PCR
RESULTS
 DISCUSSION
 REFERENCES
 
RNA was extracted from testes and adult (Day 63) liver, kidneys, and brain using TRI reagent (Sigma), a modified form of the RNA extraction reagent designed by Chomczynski [37]. Polyadenylated mRNA was extracted from ~50 µg adult rat pituitary tissue by solid-phase immobilization using Dynabeads oligo (dT)25 magnetic beads (Dynal, Lake Success, CA). RT was performed for 50 min at 42°C using Superscript II (Life Technologies, Rockville, MD), primed with poly(dT) (Pharmacia, Uppsala, Sweden) and random hexamers (Pharmacia). The enzyme was heat-inactivated by incubation at 70°C for 20 min.

PCR primers were designed using previously described TR sequences of human, rat, and mouse origin (Genbank accession numbers: TR{alpha}1, J03819; TR{alpha}2, J03239; TR{alpha}3, X07752; TRß1, J03933; TRß2, M25071). Primers were designed using Primer3 [38] to cross exon-exon boundaries that differed between isoforms (Fig. 1A). Primers were as follows: TR{alpha}1 forward, TAGTCTCCGACGCCATCTTT; TR{alpha}1 reverse, ACTTTCATGTGGAGGAAGCG; TR{alpha}2/3 forward, GGCTGTGCTGCTAATGTCAA; TR{alpha}2/3 reverse, AGACTTCCCGCTTCACCAAG; TRß1 forward, CCAGACTTTCCAGACCGAAG; TRß1 reverse, GCACTGGTTACGGGTGACTT; TRß2 forward, CATGGCCCTGAGTCAGTACA; TRß2 reverse, GCACTGGTTTACGGGTGACTT.



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 1. The expression pattern of TR isoforms determined by RT-PCR. A) An illustration of alternate splicing events affecting the TR{alpha} gene. Labeled arrows show splicing events necessary to generate the isoforms indicated. Translation initiation site (ATG) and in-frame stop codons are shown. Single-head arrows show TR{alpha}1 primers; double-head arrows show TR{alpha}2/3 primers. Note that TR{alpha}3 splices out the 5' end of exon 10. B) Temporal expression pattern of TR isoforms determined by RT-PCR. Testis RNA extracted from animals at ages indicated beneath each lane (in days pp). K and +, RNA extracted from kidney and positive control tissue (brain or liver), respectively; W, water control (no template cDNA included in PCR reaction). Amplicon identity is indicated beside each row. Amplicon sizes: {alpha}1, 289 base pairs (bp); {alpha}2, 318 bp; {alpha}3, 201 bp; ß1, 235 bp

PCR was performed in a 50-µl volume containing 1 unit of Taq polymerase (Pharmacia), 10 mM Tris-HCl, 1.5 mM MgCl2, 50 mM KCl, 0.2 mM dNTPs (Boehringer Mannheim, Mannheim, Germany), 1 µM forward and reverse primers, and 1 µg of cDNA from the RT reaction. The initial denaturation step was at 94°C for 3 min, followed by 35 cycles of denaturation for 30 sec at 94°C, annealing for 30 sec at 58°C, and extension for 1 min at 72°C. The solution was then subjected to 5 min of final extension at 72°C. PCR products were electrophoresed on a 1% agarose gel. Products were cloned using the TA cloning kit (Invitrogen, Carlsbad, CA), and the identity of cloned PCR products was confirmed by sequence analysis (data not shown).

Immunoblot Analysis

Protein was extracted from 100 mg of decapsulated testis tissue collected at various ages. Tissues were homogenized with lysis buffer (50 mM Tris, 0.1% SDS, pH 6.8) containing complete protease inhibitors (Boehringer Mannheim). After centrifugation, protein yield in the supernatant solution was determined by the Bio-Rad protein assay (Bio-Rad, Hercules, CA). Fifty micrograms of protein was run in each well of a 10% polyacrylamide gel alongside 10 µl of Bio-Rad prestained broad-range SDS-PAGE standard. Protein was transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore, Bedford, MA), which was then blocked for 15 min in blocking solution (2% skim milk powder, 0.1% Tween 20 in Tris-buffered saline), before incubation overnight at 4°C in 1:500 sc-772 (Santa-Cruz Biotechnologies, Santa-Cruz, CA) anti-TR{alpha}1 antibody in blocking solution (sc-772 is raised to a full-length TR{alpha}1 protein and is cross-reactive with TR{alpha} and TRß isoforms). The membrane was washed three times before incubation with a 1:10 000 dilution of horseradish peroxidase-conjugated goat anti-rabbit antibody (Silenus Laboratories, Melbourne, Australia) for 1 h at room temperature. Bound antibody was visualized using the enhanced chemiluminescence (ECL) Plus kit (Amersham, Uppsala, Sweden) according to the manufacturer's instructions.

Immunohistochemistry

Slides were dewaxed in three changes of Solvent 3B/2026 (HiChem, Melbourne, Australia), washed in three changes of ethanol, and rehydrated in distilled water. Slides were immersed in 400 ml of citrate buffer (0.01 M sodium citrate, pH 6.0) and microwaved for 10 min at 700 watts [39]. Slides were washed twice with PBS and blocked with CAS-blocking reagent (Zymed, San Francisco, CA) for 30 min at room temperature. All primary antibodies for immunohistochemistry were obtained from Affinity Bioreagents (Golden, CO) and were diluted 1:200 with 10% horse serum in PBS (for MA-216, monoclonal antibody raised to TRß1) or 10% goat serum in PBS (for PA-210 and PA-214, polyclonal antibodies raised to all TR{alpha} isoforms and all TR isoforms, respectively).

Slides treated with MA-216 (hereafter referred to as anti-ß1) were incubated for 14 h at 4°C. Slides treated with PA-210 (anti-{alpha}) or PA-214 (anti-pan) were incubated for 2 h at room temperature. Negative control sections were treated with nonimmune serum diluted in the same manner. All subsequent detection steps were performed as previously described [30]. Sections were counterstained with Mayer's hematoxylin.

Slides were examined with a Leitz Diaplan microscope (Leica, Solms, Germany), and photomicrographs were taken using a Leitz Orthomat E camera. The stages of the cycle in the seminiferous epithelium were classified using the criteria described by Hess [40].


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RT-PCR
 RESULTS
DISCUSSION
 REFERENCES
 
Developmental Expression of TR Isoforms as Determined by RT-PCR and Immunoblot Analysis

Primer specificity was verified by amplification of cDNA from known positive tissue (brain, kidney, liver, and pituitary) from pp Day 63 rats and sequence analysis of the products. At least one TR isoform was amplified from each sample, verifying the validity of cDNA generated by the RT reaction. Previous studies have shown that TRß1 is most highly expressed in liver, kidney, and brain [41], while TRß2 is almost exclusively expressed in the anterior pituitary gland [42]. All TR{alpha} isoforms are highly expressed in the brain, and TR{alpha}1 is also highly expressed in muscle and brown fat [43]. Levels of expression found in testes at various ages were thus compared with expression in adult brain, liver, and pituitary tissue as high-expression controls.

TR{alpha}1 mRNA expression was found to be high at Days 0, 5, and 25 pp, but lower at Day 15 pp and Day 63 pp (Fig. 1B). TR{alpha}2 and TR{alpha}3 mRNA expression decreased steadily from high levels at Day 0 pp until both were undetectable by Day 63 pp. TR{alpha}2 expression appeared to exceed TR{alpha}3 expression at all ages tested (Fig. 1B). TRß1 mRNA was found to be expressed at very low levels at Days 5 and 25 pp but was absent at all other ages surveyed (Fig. 1B). TRß2 expression was absent at all ages (data not shown).

Immunoblot analysis indicated that TR{alpha}1 (indicated by a 47-kDa band) was expressed throughout development and in the adult testis (Fig. 2). TR{alpha}2, TRß1, and TRß2, which would have displayed 55-, 53-, and 58-kDa bands, respectively, were undetectable by immunoblot analysis at any of the ages surveyed. TR{alpha}3, which would exhibit a band of 47 kDa, was undistinguishable from TR{alpha}1. In combination, the RT-PCR and immunoblot analysis of total testis extracts suggests that TR{alpha}1 is the dominant TR isoform regulating testis development.



View larger version (46K):
[in this window]
[in a new window]
  		FIG. 2. Expression pattern of TR determined by Western blotting. Testis protein extracted from rats at ages indicated beneath each lane (in days pp). The bands seen at 47 kDa correspond to TR{alpha}1 protein. Molecular weight is shown on right (Mr x 10-3)

Developmental Expression of TR as Determined by Immunohistochemistry

Expression of TR in Sertoli cells In pp Day 0 and 5 testes, all antibodies resulted in strong staining of Sertoli cell nuclei (Fig. 3, A and B). Faint cytoplasmic staining was observed at Day 0 pp but was less obvious at other ages surveyed. At Day 15 pp, staining of Sertoli cell nuclei became punctate and peripheral (Fig. 3C). At Days 25 and 63 pp, Sertoli cells exhibited little staining, apart from that occasionally observed within the nucleolus (Fig. 3, D–G).



View larger version (101K):
[in this window]
[in a new window]
  		FIG. 3. Expression pattern of TR determined by immunohistochemistry using anti-pan primary antibody. A–E) Days 0, 5, 15, 25, and 63, respectively. Bar = 25 µm. F and G) Day 63 stages VII and X, respectively. Bar = 50 µm. Inset micrographs are of negative control sections. Arrows: Sertoli cell nuclei. G, Gonocyte; ES, elongating spermatid; L, leptotene spermatocyte; P, pachytene spermatocyte; PL, preleptotene spermatocyte; RB, residual body; RS, round spermatid; SG, spermatogonia; Z, zygotene spermatocyte. Brown color indicates positive staining. Note the staining of most interstitial cells at Days 0 and 5 (A and B)

Expression of TR in germ cells At Days 0 and 5 pp, gonocytes were negative for all antibodies tested (Fig. 3, A and B). At later ages, germ cell staining was cell type-specific; staining was first apparent in intermediate (using anti-ß1 and anti-pan antibodies) or type B spermatogonia (using anti-{alpha} antibody), and appeared in pachytene spermatocytes associated with stage III at Day 15 pp (the most advanced germ cells present at this age), and in pachytene spermatocytes in stage VII–IX at Days 25 and 63 pp (Fig. 3, C–G). Some staining was also noted in residual bodies of cytoplasm being phagocytosed by Sertoli cells (Fig. 3F). Cell type specificity was dependent upon the antibody used: anti-pan staining was seen from intermediate spermatogonia to pachytene spermatocytes in stage IX, while anti-ß1 positivity was present only up to zygotene spermatocytes in stage XIII or early pachytene spermatocytes in stage XIV. Figure 4 illustrates the cell type-specific staining patterns observed in relation to the stages of the spermatogenic cycle as described by Dym and Clermont [44].



View larger version (56K):
[in this window]
[in a new window]
  		FIG. 4. Diagram indicating the cell specific staining patterns observed with each of the primary antibodies used. Square hatching, staining with anti-ß1 antibody; horizontal hatching, staining with anti-{alpha} antibody; diagonal hatching, staining with anti-pan antibody. Stages of the cycle are indicated in Roman numerals beneath each lane. Diagram adapted from Dym and Clermont [44]

Expression of TR in interstitial cells Because of the fixation and antigen retrieval protocols used, most interstitial cells could not be characterized by morphological criteria. At Days 0 and 5 pp, almost all interstitial cells were positively stained with each antibody used. At Days 15, 25, and 63 pp, only a small proportion of interstitial cells were positively stained (data not shown). Some vascular endothelial cells were stained at all ages surveyed.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RT-PCR
 RESULTS
 DISCUSSION
REFERENCES
 
In this study, we have demonstrated the expression pattern of TR in the developing and adult rat testis. We found that TR, predominantly TR{alpha}1, are expressed in all Sertoli cells during the proliferative phase of their development. A novel finding is that spermatogenic germ cells between intermediate spermatogonia and pachytene spermatocytes also express TR{alpha}1.

RT-PCR and immunoblot analysis demonstrated that TR{alpha}1 is expressed throughout development and in the adult testis. The fluctuating levels of TR{alpha}1 expression shown by RT-PCR are likely to reflect the dilution of TR-positive cell types by other cells: At Day 15, Sertoli cells appeared to be switching off TR expression, reflected by a weak RT-PCR signal, while at Day 63, TR-positive cells were diluted by large numbers of spermatids. The absence of bands on an immunoblot corresponding to any TR isoform other than TR{alpha}1 suggests that TR{alpha}1 is the predominant isoform expressed in the testis. RT-PCR demonstrated expression of mRNA encoding TR{alpha}2, TR{alpha}3, and TRß1; however, immunoblot data suggests that, if expressed, the corresponding peptide is present at relatively low levels.

Immunohistochemical data clearly show that TR are expressed in Sertoli cell nuclei during their proliferative phase. The punctate staining pattern observed in pp Day 15 Sertoli cells is in agreement with previous studies that report decreasing levels of TR expression in Sertoli cells as the testis approaches Day 20 pp [30, 31]. The absence of immunoreactive TR in Sertoli cell nuclei after this age supports the notion that there is a critical window for modifying thyroid hormone levels to affect Sertoli cells [45].

In light of the effects of thyroid hormone on Leydig cells [46–51], it seems likely that in the interstitium, TR are expressed in Leydig cells. The decreasing TR{alpha}2 and TR{alpha}3 mRNA expression demonstrated by RT-PCR matches the immunohistochemical staining pattern of interstitial cells; however, immunoblot analysis indicates that neither isoform is highly expressed. We therefore conclude that TR-positive interstitial cells primarily express TR{alpha}1 protein but may also express TR{alpha}2 and TR{alpha}3 at low levels.

The immunohistochemical demonstration of TRß1 expression in immature Sertoli cells and spermatogenic germ cells seems to conflict with RT-PCR and immunoblot data demonstrating low levels of TRß1 mRNA and undetectable levels of TRß1 protein in the whole testis. We believe that this disparity is due to the high sensitivity of the immunohistochemical staining method used. This suggests that TRß1 is expressed at very low levels that are redundant in relation to TR{alpha}1 expression. This is further substantiated by the findings of Jannini et al. [32] showing that TRß mRNA is undetectable by Northern, in situ, and ribonuclease (RNase) protection analyses, while Palmero et al. [33] demonstrated that TRß1 is detectable only after 30 cycles of PCR amplification.

Van Haaster et al. [11, 12], and Simorangkir et al. [7] showed that modification of thyroid hormone levels leads to an increase in germ cell degeneration in the juvenile rat. This effect was attributed to the inability of undifferentiated Sertoli cells (in hypothyroid juveniles) to support spermatogenesis, or the lack of sufficient numbers of Sertoli cells (in hyperthyroid animals) to support large numbers of germ cells. The demonstration of TR expression in germ cells leads us to speculate that thyroid hormones could act as a moderator of germ cell survival. The apparent conflict between the demonstration of TR expression in germ cells and the absence of specific thyroid hormone binding sites in the adult testis [30, 31] could be due to the dilution of TR-positive cells by the abundance of TR-negative cells such as round and elongating spermatids and Sertoli cells.

These data indicate that TR{alpha}1 is the predominant TR isoform expressed in the developing and adult testis. The expression of TR in proliferating Sertoli cell nuclei is consistent with its role in regulating the process of Sertoli cell division. The presence of TR in germ cells from intermediate spermatogonia to spermatocytes suggests a possible role in normal spermatogenesis that has yet to be examined.


   ACKNOWLEDGMENTS
 
The authors gratefully acknowledge Mr. Patrick McManamny and Ms. Elizabeth Christy for their technical assistance and Prof. David de Kretser for his helpful discussions.


   FOOTNOTES
 
First decision: 2 September 1999.

1 This work was supported by ARC grants (Grant A09600657 and A09927208). M.K.O.B. is supported by a National Health and Medical Research Council (Australia) post-doctoral fellowship. Back

2 Correspondence: G. Wreford, Department of Anatomy, Monash University, Wellington Road, Clayton, Victoria, 3168, Australia. FAX: 61 3 9905 2766. nigel.wreford{at}med.monash.edu.au Back

Accepted: November 4, 1999.

Received: July 30, 1999.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RT-PCR
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Steinberger A, Steinberger E. Replication pattern of Sertoli cells in maturing rat testis in vivo and in organ culture. Biol Reprod 1971; 4:84–87.[Abstract]
  2. Orth J. Proliferation of Sertoli cells in fetal and postnatal rats: a quantitative autoradiographic study. Anat Rec 1982; 203:485–492.[CrossRef][Medline]
  3. Jones L, Berndtson W. A quantitative study of Sertoli cell and germ cell populations as related to sexual development and ageing in the stallion. Biol Reprod 1986; 35:138–148.[Abstract]
  4. Orth J, Gunsalus G, Lamperti A. Evidence from Sertoli cell depleted rats indicates that spermatid number in adults depends on number of Sertoli cells produced during perinatal development. Endocrinology 1988; 122:787–794.[Abstract/Free Full Text]
  5. Berndtson W, Thompson T. Changing relationships between testis size, Sertoli cell number and spermatogenesis in Sprague-Dawley rats. J Androl 1990; 11:429–435.[Abstract/Free Full Text]
  6. Meachem S, McLachlan R, de Kretser D, Robertson D, Wreford N. Neonatal exposure of rats to recombinant follicle stimulating hormone increases adult Sertoli and spermatogenic cell numbers. Biol Reprod 1996; 54:36–44.[Abstract]
  7. Simorangkir D, Wreford N, De Kretser D. Impaired germ cell development in testes of immature rats with neonatal hypothyroidism. J Androl 1997; 18:186–193.[Abstract/Free Full Text]
  8. Orth JM. The role of follicle-stimulating hormone in controlling Sertoli cell proliferation in testes of fetal rats. Endocrinology 1984; 115:1248–1255.[Abstract/Free Full Text]
  9. Cooke P, Meisami E. Early hypothyroidism in rats causes increased adult testis and reproductive organ size but does not change testosterone levels. Endocrinology 1991; 129:237–243.[Abstract/Free Full Text]
  10. Francavilla S, Cordeschi G, Properzi G, Di Cicco L, Jannini EA, Palmero S, Fugassa E, Loras B, D'Armiento M. Effect of thyroid hormone on the pre- and postnatal development of the rat testis. J Endocrinol 1991; 129:35–42.[Abstract/Free Full Text]
  11. Van Haaster L, De Jong F, Docter R, De Rooij D. The effect of hypothyroidism on Sertoli cell proliferation and differentiation and hormone levels during testicular development in the rat. Endocrinology 1992; 131:1574–1576.[Abstract/Free Full Text]
  12. Van Haaster L, De Jong F, Docter R, De Rooij D. High neonatal triiodothyronine levels reduce the period of Sertoli cell proliferation and accelerate tubular lumen formation in the rat testis, and increase serum inhibin levels. Endocrinology 1993; 133:755–760.[Abstract/Free Full Text]
  13. De Franca LR, Hess RA, Cooke PS, Russell LD. Neonatal hypothyroidism causes delayed Sertoli cell maturation in rats treated with propylthiouracil: evidence that the Sertoli cell controls testis growth. Anat Rec 1995; 242:57–69.[CrossRef][Medline]
  14. Simorangkir DR, de Kretser DM, Wreford NG. Increased numbers of Sertoli and germ cells in adult rat testes induced by synergistic action of transient neonatal hypothyroidism and neonatal hemicastration. J Reprod Fertil 1995; 104:207–213.[Abstract/Free Full Text]
  15. Hess R, Cooke P, Bunick D, Kirby J. Adult testicular enlargement induced by neonatal hypothyroidism is accompanied by increased Sertoli and germ cell numbers. Endocrinology 1993; 132:2607–2613.[Abstract/Free Full Text]
  16. Cooke PS, Zhao YD, Bunick D. Triiodothyronine inhibits proliferation and stimulates differentiation of cultured neonatal Sertoli cells: possible mechanism for increased adult testis weight and sperm production induced by neonatal goitrogen treatment. Biol Reprod 1994; 51:1000–1005.[Abstract]
  17. Palmero S, Prati M, Bolla F, Fugassa E. Tri-iodothyronine directly affects rat Sertoli cell proliferation and differentiation. J Endocrinol 1995; 145:355–362.[Abstract/Free Full Text]
  18. Cooke PS, Hess RA, Porcelli J, Meisami E. Increased sperm production in adult rats after transient neonatal hypothyroidism. Endocrinology 1991; 129:244–248.[Abstract/Free Full Text]
  19. Tsai Ming-Jer, O'Malley B. Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 1994; 63:451–486.[CrossRef][Medline]
  20. Fondell JD, Brunel F, Hisatake K, Roeder RG. Unliganded thyroid hormone receptor {alpha} can target TATA-binding protein for transcriptional repression. Mol Cell Biol 1996; 16:281–287.[Abstract]
  21. Brent GA, Dunn MK, Harney JQ, Gulick T, Larsen PR, Moore DD. Thyroid hormone aporeceptor represses T3-inducible promoters and blocks activity of the retinoic receptor. New Biol 1989; 1:329–336.[Medline]
  22. Damm K, Thompson CC, Evans RM. Protein encoded by v-erbA functions as a thyroid-hormone receptor agonist. Nature 1989; 339:593–597.[CrossRef][Medline]
  23. Graupner G, Wills KW, Tzukerman M, Zhang XK, Pfahl M. Dual regulatory role for thyroid-hormone receptor allows control of retinoic acid receptor activity. Nature 1989; 340:653–656.[CrossRef][Medline]
  24. Sap J, Muñoz A, Schmitt J, Stunnenberg H, Vennström B. Repression of transcription mediated at a thyroid hormone response element by the v-erb-A oncogene product. Nature 1989; 340:242–244.[CrossRef][Medline]
  25. Baniahmad A, Köhne AC, Renkawitz R. A transferable silencing domain is present in the thyroid hormone receptor, in the v-erbA oncogene product and in the retinoic acid receptor. EMBO J 1992; 11:1015–1023.[Medline]
  26. Barker S, Klitgaard H. Metabolism of tissues excised from thyroxine-injected rats. Am J Physiol 1952; 170:81–86.
  27. Oppenheimer J, Schwartz H, Surks M. Tissue differences in the concentration of triiodothyronine nuclear binding sites in the rat: liver, kidney, pituitary, heart, brain, spleen and testis. Endocrinology 1974; 95:897–903.[Abstract/Free Full Text]
  28. Wong C, Dohler K, Muhlen A. Effects of tri-iodothyronine, thyroxine and iso-propyl-di-iodothyronine on thyroid stimulating hormone in serum and pituitary gland and on pituitary concentrations of prolactin, growth hormone, luteinizing hormone and follicle-stimulating hormone in hypothyroid rats. J Endocrinol 1980; 87:255–264.[Abstract/Free Full Text]
  29. Benbrook D, Pfahl M. A novel thyroid hormone receptor encoded by a cDNA clone from a human testis library. Science 1987; 238:788–791.[Abstract/Free Full Text]
  30. Palmero S, Maggiani S, Fugassa E. Nuclear triiodothyronine receptors in rat Sertoli cells. Mol Cell Endocrinol 1988; 58:253–256.[CrossRef][Medline]
  31. Jannini E, Olivieri M, Francavilla S, Gulino A, Ziparo E, D'Armiento M. Ontogenesis of the nuclear 3,5,3'-triiodothyronine receptor in the rat testis. Endocrinology 1990; 126:2521–2526.[Abstract/Free Full Text]
  32. Jannini E, Dolci S, Ulisse S, Nikodem V. Developmental regulation of the thyroid hormone receptor {alpha} mRNA expression in the rat testis. Mol Endocrinol 1994; 8:89–96.[Abstract/Free Full Text]
  33. Palmero S, De Marco P, Fugassa E. Thyroid hormone receptor ß mRNA expression in Sertoli cells isolated from prepubertal testis. J Mol Endocrinol 1995; 14:131–134.[Abstract/Free Full Text]
  34. Tagami T, Nakamura H, Sasaki S, Mori T, Yoshioka H, Yoshida H, Imura H. Immunohistochemical localization of nuclear 3,5,3'-triiodothyronine receptor proteins in rat tissues studied with antiserum against C-ERB A/T3 receptor. Endocrinology 1990; 127:1727–1734.[Abstract/Free Full Text]
  35. Macchia E, Nakai A, Janiga A, Sakurai A, Fisfalen M, Gardner P, Soltani K, DeGroot L. Characterization of site-specific polyclonal antibodies to c-erbA peptides recognizing human thyroid hormone receptors {alpha}1, {alpha}2, and ß and native 3,5,3'-triiodothyronine receptor, and study of tissue distribution of antigen. Endocrinology 1990; 126:3232–3239.[Abstract/Free Full Text]
  36. Falcone M, Miyamoto T, Fierro-Renoy F, Macchia E, DeGroot L. Antipeptide polyclonal antibodies specifically recognize each human thyroid hormone receptor isoform. Endocrinology 1992; 131:2419–2429.[Abstract/Free Full Text]
  37. Chomczynski P. A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. Biotechniques 1993; 15:532–534, 536–537.[Medline]
  38. Rozen A, Skaletsky HJ. Primer3—PCR Primer Design Program. Code available at http://www.genome.wi.mit.edu/genome_software/other/primer3.html; 1996–1997.
  39. Shi S, Chaiwun B, Young L, Cote R, Taylor C. Antigen retrieval technique utilizing citrate buffer or urea solution for immunohistochemical demonstration of androgen receptor in formalin-fixed paraffin sections. J Histochem Cytochem 1993; 41:1599–1604.[Abstract]
  40. Hess R. Quantitative and qualitative characteristics of the stages and transitions in the cycle of the rat seminiferous epithelium: light microscopic observations of perfusion-fixed and plastic-embedded testes. Biol Reprod 1990; 43:525–542.[Abstract]
  41. Koenig R, Warne RL, Brent GA, Herney JW, Larsen PR, Moore DD. Isolation of a cDNA clone encoding a biologically active thyroid hormone receptor. Proc Natl Acad Sci USA 1988; 85:5031–5035.[Abstract/Free Full Text]
  42. Hodin RA, Lazar MA, Wintman BJ, Derling DS, Koenig RJ, Larsen PR, Moore DD, Chin WW. Identification of a thyroid hormone receptor that is pituitary specific. Science 1989; 244:76–79.[Abstract/Free Full Text]
  43. Mitsuhashi TG, Tennyson GE, Nikodem VM. Alternative splicing generates messages encoding rat c-erb A proteins that do not bind thyroid hormones. Proc Natl Acad Sci USA 1988; 85:5804–5808.[Abstract/Free Full Text]
  44. Dym M, Clermont Y. Role of spermatogonia in the repair of the seminiferous epithelium following X-irradiation of the rat testis. Am J Anat 1970; 128:265–282.[CrossRef][Medline]
  45. Cooke PS, Porcelli J, Hess RA. Induction of increased testis growth and sperm production in adult rats by neonatal administration of the goitrogen propylthiouracil (PTU): the critical period. Biol Reprod 1992; 46:146–154.[Abstract]
  46. Hardy M, Kirby J, Hess R, Cooke P. Leydig cells increase their numbers but decline in steroidogenic function in the adult rat after neonatal hypothyroidism. Endocrinology 1993; 132:2417–2240.[Abstract/Free Full Text]
  47. Hardy M, Sharma R, Arambepola N, Sottas C, Russell L, Bunick D, Hess R, Cooke P. Increased proliferation of Leydig cells induced by neonatal hypothyroidism in the rat. J Androl 1996; 17:231–238.[Abstract/Free Full Text]
  48. Antony F, Aruldhas M, Udhayakumar R, Maran R, Govindarajulu P. Inhibition of Leydig cell activity in vivo and in vitro in hypothyroid rats. J Endocrinol 1995; 144:293–300.[Abstract/Free Full Text]
  49. Mendis-Handagama S, Sharma O. Effects of neonatal administration of the reversible goitrogen propylthiouracil on the testis interstitium in adult rats. J Reprod Fertil 1994; 100:85–92.[Abstract/Free Full Text]
  50. Teerds K, de Rooij D, de Jong F, van Haaster L. Development of the adult-type Leydig cell population in the rat is affected by neonatal thyroid hormone levels. Biol Reprod 1998; 59:344–350.[Abstract/Free Full Text]
  51. Mendis-Handagama S, Ariyaratne H, teunissen van Manen K, Haupt R. Differentiation of adult Leydig cells in the neonatal rat testis is arrested by hypothyroidism. Biol Reprod 1998; 59:351–357.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
E. Rijntjes, H. J. M. Swarts, R. Anand-Ivell, and K. J. Teerds
Prenatal induced chronic dietary hypothyroidism delays but does not block adult-type Leydig cell development
Am J Physiol Endocrinol Metab, February 1, 2009; 296(2): E305 - E314.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
M. S. Wagner, S. M. Wajner, and A. L. Maia
The role of thyroid hormone in testicular development and function
J. Endocrinol., December 1, 2008; 199(3): 351 - 365.
[Abstract] [Full Text] [PDF]

Home page
 J AndrolHome page
E. Rijntjes, A. T. Wientjes, H. J. M. Swarts, D. G. de Rooij, and K. J. Teerds
Dietary-Induced Hyperthyroidism Marginally Affects Neonatal Testicular Development
J Androl, November 1, 2008; 29(6): 643 - 653.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
B. Anguiano, N. Aranda, G. Delgado, and C. Aceves
Epididymis Expresses the Highest 5'-Deiodinase Activity in the Male Reproductive System: Kinetic Characterization, Distribution, and Hormonal Regulation
Endocrinology, August 1, 2008; 149(8): 4209 - 4217.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
S. M. Wajner, M. dos Santos Wagner, R. C N Melo, G. G Parreira, H. Chiarini-Garcia, A. C Bianco, C. Fekete, E. Sanchez, R. M Lechan, and A. L. Maia
Type 2 iodothyronine deiodinase is highly expressed in germ cells of adult rat testis
J. Endocrinol., July 1, 2007; 194(1): 47 - 54.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
L. R. Franca, M. O. Suescun, J. R. Miranda, A. Giovambattista, M. Perello, E. Spinedi, and R. S. Calandra
Testis Structure and Function in a Nongenetic Hyperadipose Rat Model at Prepubertal and Adult Ages
Endocrinology, March 1, 2006; 147(3): 1556 - 1563.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
D. R. Holsberger, S. E. Kiesewetter, and P. S. Cooke
Regulation of Neonatal Sertoli Cell Development by Thyroid Hormone Receptor {alpha}1
Biol Reprod, September 1, 2005; 73(3): 396 - 403.
[Abstract] [Full Text] [PDF]

Home page
 MutagenesisHome page
M. M. Dobrzynska, A. Baumgartner, and D. Anderson
Antioxidants modulate thyroid hormone- and noradrenaline-induced DNA damage in human sperm
Mutagenesis, July 1, 2004; 19(4): 325 - 330.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
M.M. Ben Saad and D.L. Maurel
Reciprocal Interaction Between Seasonal Testis and Thyroid Activity in Zembra Island Wild Rabbits (Oryctolagus cuniculus): Effects of Castration, Thyroidectomy, Temperature, and Photoperiod
Biol Reprod, April 1, 2004; 70(4): 1001 - 1009.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y.-Y. Liu, J. J. Schultz, and G. A. Brent
A Thyroid Hormone Receptor {alpha} Gene Mutation (P398H) Is Associated with Visceral Adiposity and Impaired Catecholamine-stimulated Lipolysis in Mice
J. Biol. Chem., October 3, 2003; 278(40): 38913 - 38920.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
W. H. Walker
Molecular Mechanisms Controlling Sertoli Cell Proliferation and Differentiation
Endocrinology, September 1, 2003; 144(9): 3719 - 3721.
[Full Text] [PDF]

Home page
 EndocrinologyHome page
J. J. Buzzard, N. G. Wreford, and J. R. Morrison
Thyroid Hormone, Retinoic Acid, and Testosterone Suppress Proliferation and Induce Markers of Differentiation in Cultured Rat Sertoli Cells
Endocrinology, September 1, 2003; 144(9): 3722 - 3731.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
T. Suzuki, T. Onogawa, N. Asano, H. Mizutamari, T. Mikkaichi, M. Tanemoto, M. Abe, F. Satoh, M. Unno, K. Nunoki, et al.
Identification and Characterization of Novel Rat and Human Gonad-Specific Organic Anion Transporters
Mol. Endocrinol., July 1, 2003; 17(7): 1203 - 1215.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
N. St-Pierre, J. Dufresne, A. A. Rooney, and D. G. Cyr
Neonatal Hypothyroidism Alters the Localization of Gap Junctional Protein Connexin 43 in the Testis and Messenger RNA Levels in the Epididymis of the Rat
Biol Reprod, April 1, 2003; 68(4): 1232 - 1240.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
M. Gehin, M. Mark, C. Dennefeld, A. Dierich, H. Gronemeyer, and P. Chambon
The Function of TIF2/GRIP1 in Mouse Reproduction Is Distinct from Those of SRC-1 and p/CIP
Mol. Cell. Biol., August 15, 2002; 22(16): 5923 - 5937.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
L. O'Donnell, K. M. Robertson, M. E. Jones, and E. R. Simpson
Estrogen and Spermatogenesis
Endocr. Rev., June 1, 2001; 22(3): 289 - 318.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Buzzard, J. J.
Right arrow Articles by Wreford, N. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Buzzard, J. J.
Right arrow Articles by Wreford, N. G.
Agricola
Right arrow Articles by Buzzard, J. J.
Right arrow Articles by Wreford, N. G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS