| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Articles |
Calmodulin Kinase II, and Protamines 1 and 21
a Center for Research on Reproduction and Women's Health and Department of Obstetrics and Gynecology, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
calmodulin-dependent kinase II—two transported mRNAs, and protamines 1 and 2—two translationally regulated testicular mRNAs. These data indicate an intracellular association between TB-RBP and specific target mRNAs and suggest an involvement of TB-RBP in microtubule-dependent mRNA transport in the cytoplasm of cells.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
calmodulin-dependent kinase II [6, 7] and ligatin have been shown to associate with microtubules [4, 5, 7–9]. The localization of mRNAs requires specific RNA-protein interactions, often in association with components of the cytoskeleton [3, 10, 11]. Some RNA-binding proteins such as Vg1 [11, 12] localize mRNAs through interactions with both microfilaments and microtubules. In fibroblasts, the majority of poly(A)+ RNA is found juxtaposed to actin filaments [13]. In cultured neurons, over half of the total mRNA is associated with microtubules [14], and localization of axonal mRNAs is dependent upon microtubule associations [15, 16]. In Drosophila oocytes and embryos, a growing number of RNA-binding proteins essential for mRNA localization have been identified [1], and in plants the protein CmPP16 has been proposed to transport mRNA into the phloem [17]. The mammalian homologue of the Drosophila double-stranded RNA-binding protein, staufen, colocalizes with ribonucleoprotein particles in distal hippocampal dendrites [18].
Microtubules have been proposed to serve as the tracks for long-distance translocation of mRNAs, while actin filaments are often involved in local mRNA movement, anchoring, and translation [14]. Understanding the molecular mechanisms responsible for these two localization pathways awaits identification of the numerous proteins that mediate interactions between specific mRNAs and specific structural components of the cytoskeleton.
The testis-brain RNA-binding protein (TB-RBP) is the mouse homologue of the human protein, translin, which functions as a single-stranded DNA-binding protein selectively binding to chromosomal translocation break sequences [19, 20]. Although TB-RBP can also function as a single-stranded DNA-binding protein and is widely expressed in somatic tissues [21], it also shows RNA-binding activity in testis and brain extracts [22]. TB-RBP is a sequence-dependent RNA-binding protein that recognizes a range of conserved sequences (Y and H elements) frequently present in the 3' untranslated regions (UTRs) of mRNAs [23, 24]. We have previously shown that the endogenous TB-RBP in crude brain extracts can bind to microtubules reassembled in vitro [25]. Here we use purified recombinant TB-RBP and affinity-purified antibody to TB-RBP to demonstrate both in vitro and in vivo interactions of TB-RBP with microtubules. We further demonstrate by selective immunoprecipitation a specific interaction between TB-RBP and two brain mRNAs known to be transported along microtubules and two translationally regulated male germ cell mRNAs.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Recombinant TB-RBP was expressed in Escherichia coli as a glutathione-S-transferase (GST)-fusion protein and was purified as described as previously [20]. A highly enriched fraction of tubulin from bovine brain was kindly provided by Dr. K. Boekelheide of Brown University (Providence, RI). A precipitating antibody to TB-RBP (TB-RBP) was raised against mouse recombinant TB-RBP. A nonprecipitating antibody to TB-RBP (KNDS) was raised against the peptide KNDSLRKRYDGLKYDV of TB-RBP [20]. A monoclonal antibody to tubulin, 3F3-G2, was kindly provided by Dr. J. Lessard of the University of Cincinnati (Cincinnati, OH).
Preparation of Microtubule Fractions
Microtubules were prepared from mouse brain according to the method of Tavares et al. [26] with minor modifications. Briefly, three brains were homogenized in 2 ml homogenization buffer (0.1 M PIPES pH 6.6, 1 mM EDTA, 1 mM MgSO4, 0.1 M glycerol, 2 mM PMSF, 10 µg/ml aprotinin, and 10 µg/ml leupeptin). After centrifugation for 30 min at 14 000 rpm at 4°C, the supernatants were centrifuged for 90 min at 135 000 x g at 2°C. The supernatants were supplemented with 1 mM GTP and 20 µM taxol, incubated for 15 min at 37°C to allow microtubule reassembly, and then loaded over 2 ml 15% sucrose (dissolved in homogenization buffer). After centrifugation for 30 min at 54 000 x g at 20°C, the pellets, containing the reassembled microtubules, were washed once with 1 ml homogenization buffer containing 1 mM GTP and 20 µM taxol. Half of the pellets were resuspended in 100 µl SDS buffer in preparation for gel electrophoresis. The remainder of the pellets were extracted with homogenization buffer containing 0.4 M NaCl, 1 mM GTP, and 20 µM taxol, and centrifuged for 20 min at 54 000 x g. The supernatants were saved as the microtubule-associated protein fraction, and the pellets were resuspended in SDS buffer for electrophoretic analysis.
Binding of Recombinant TB-RBP to Microtubules
The procedure of Han et al. [25] was used to study interactions between recombinant TB-RBP and microtubules. TB-RBP (0.8 µg) was incubated with tubulin (13 µg) in 50 µl of 0.35 M glutamate pH 7.5 and 1 mM GTP for 30 min at 37°C, and then centrifuged for 30 min at 200 000 x g. Aliquots of the supernatant (the monomer tubulin fraction) and the pellet (the reassembled microtubules) were dissolved in SDS buffer, and the distribution of TB-RBP was determined by Western blotting as previously described [20]. Tubulin was detected by Coomassie blue staining.
Isolation of TB-RBP-RNA Complexes from Brainand Testis Extracts by Immunoprecipitation
Brain and testis extracts were prepared as described [22], except for the addition of ribonuclease inhibitor (RNasin; 100 U/ml) during homogenization. To immunoprecipitate TB-RBP and its bound mRNAs, extracts (10 mg) were incubated with 60 µl of protein A agarose beads, 60 µl of preimmune serum, and 300 µl of TBS-NP (Tris-buffered saline containing 0.1% Nonidet P-40 for 30 min at 4°C. After centrifugation at 2000 rpm for 2 min, 400 U of RNasin, 500 µl of TBS-NP, 40 µl of protein A agarose, and 36 µg of TB-RBP or KNDS antibodies were added to the supernatant. After incubation overnight at 4°C, the mixtures were centrifuged at 2000 rpm for 2 min, and the pellets were washed four times with 1 ml TBS-NP. The pellets were then suspended in 200 µl of 4 M urea in Tris-EDTA buffer and extracted with phenol/chloroform (1:1) twice and with chloroform once. RNA was precipitated from the supernatants with 0.3 M sodium acetate and a 2.5 volume of 100% ethanol after the addition of 20 µg of E. coli tRNA. The RNA pellet was dissolved in 20 µl of water containing 40 U RNasin and stored at -80°C until use.
Reverse Transcription (RT)-Polymerase Chain Reaction (PCR) Assays
RT-PCR was performed with RNA isolated as described above using the Access RT-PCR kit from Promega (Madison, WI). The primers (ATGGCATCACAGAAGAGACCCTC and CCAGAGCGGCTGTCTCTTCCTCC) were used to specifically detect mouse myelin basic protein (MBP) mRNA. To detect CAMK II mRNA, the primers (GCTACCATCACCTGCACCCGATTCAC and AGTCTGCCAGCTTCACAGCAGCGC) were used. Protamine 1 mRNA was detected with the primers ATGGCCAGATACCGATGCTGCCGC and CTAGTATTTTTTACACCTTATGGT. Protamine 2 mRNA was detected with the primers ATGGTTCGCTACCGAATGAGGAGCC and TTAGTGATGGTGCCTCCTACATTTTCC. TB-RBP mRNA was detected with primers ATGTCTGTGAGCGAGATC and CAGAAAGAGGCACTGAGCTAGCCC. The PCR reactions were carried out in 100 µl with 1 cycle at 44°C for 45 min and at 94°C for 2 min; and 40 cycles of 94°C for 1 min, 54°C for 1 min, and 68°C for 1 min. PCR products were separated by 1.2% agarose gels and visualized by ethidium bromide staining.
Detection of TB-RBP and Microtubule Interactionsby Confocal Microscopy
Germ cells were prepared from mouse testes as described [24]. Briefly, two testes from an adult CD-1 mouse were decapsulated and incubated with 4 ml RPMI 1640 medium containing 2.5 mg collagenase for 12 min at 34°C with gentle shaking. The medium was removed, and the testes were rinsed once with fresh RPMI 1640 and then incubated with 4 ml RPMI 1640 containing 2.5 mg trypsin and 10 µg DNase I for 12 min at 34°C. The tubules were pipetted to disperse the cells, and 3 µg of trypsin inhibitor and 10 µg of DNase I were added. The cells, filtered through a nylon membrane to remove debris and aggregates, were mixed with 10 ml RPMI 1640 containing 0.5% BSA and concentrated by centrifugation for 10 min at 500 rpm. The cell washing was repeated once, and the final preparation of germ cells was resuspended in 5 ml RPMI 1640 at a concentration of about 107 cells/ml.
Germ cells were fixed onto polylysine-coated coverslips by incubation with 4% paraformaldehyde (freshly prepared in PBS) for 10 min at room temperature (RT). The coverslips were briefly rinsed with PBS 4 times, covered with 50 µl of TB-RBP (10 µg/ml) and the 3F3-G2 tubulin antibody (1:100) in blocking solution (Minimum Essential Medium [without bicarbonate] containing 15 mM HEPES pH 7.5, 10% fetal bovine serum, 0.3% Triton X-100, and 0.02% sodium azide), and incubated overnight at 4°C in a nondesiccating environment. After being rinsed 4 times in PBS, the coverslips were covered with 50 µl of blocking solution containing fluorescein isothiocyanate (FITC)-linked anti-rabbit IgG antibody (species-specific, Jackson ImmunoResearch Laboratory, West Grove, PA; 1:100) and biotinylated anti-mouse IgG antibody (species-specific; Amersham International, Buckinghamshire, UK; 1:100) for 30 min at RT. After being washed 4 times in PBS, the coverslips were incubated with 50 µl of blocking solution containing streptavidin conjugated with rhodamine (1:100) for 20 min at RT and then rinsed with PBS. The coverslips were fixed with cold methanol for 10 min, rinsed with PBS, and mounted onto slides. Immunolabeled cultures were sectioned optically using a computer-interfaced, laser scanning microscope (TCS 4D; Leica, Giessen, Germany) fitted with a 488-nm/568-nm/647-nm krypton argon laser. This allowed simultaneous analysis of the fluorescein and rhodamine chromophores.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In order to investigate interactions between TB-RBP and microtubules, a saturating excess of recombinant TB-RBP was incubated with a highly enriched tubulin fraction under conditions in which tubulin reassembles into microtubules [25]. Although some tubulin remained in the supernatant fraction (Fig. 1, lane 1), the majority (about 67%) of tubulin reassembled as microtubules in the pellet after centrifugation (Fig. 1, lane 2). The addition of colcemid (Fig. 1, lanes 3 and 4) or calcium (Fig. 1, lanes 7 and 8) prevented microtubule assembly, leaving most (about 80%) of the tubulin in the supernatant fractions. Normal microtubule assembly occurred in the presence of cytochalasin D (Fig. 1, lanes 5 and 6).
|
Since TB-RBP readily forms dimers and multimers [19,20], it was essential to demonstrate that the TB-RBP in the pellet was bound to microtubules rather than sedimenting as a protein aggregate. The amount of tubulin detected in the pellet in the presence of 2 mM colcemid or 1 mM calcium, two agents that prevent microtubule formation (Fig. 1, lanes 4 and 8), was 4- to 5-fold less than in the control, in which tubulin was reassembled into microtubules (Fig. 1, lane 2). By the criterion of Western blotting, about 20% of the exogenous TB-RBP added in excess of saturation was detected in the pellet after microtubule reassembly (Fig. 1, lanes 2 and 6). In the absence of polymerized tubulin, very little (1–3%) of the TB-RBP was found in the pellet (Fig. 1, lanes 4 and 8). In contrast, when the microfilament depolymerizing agent, cytochalasin D, which does not affect the assembly of microtubules, was substituted for colcemid, the amount of tubulin or TB-RBP in the pellet was not reduced (Fig. 1, lane 6). These data indicate that microtubule assembly was required for TB-RBP sedimentation, suggesting an association of TB-RBP with microtubules rather than sedimentation of TB-RBP as TB-RBP homopolymers [27, 28].
To determine whether TB-RBP is adventitiously bound to microtubules, the binding of TB-RBP to microtubules was examined in the presence of increasing amounts of KCl. Although KCl concentrations to 1 M did not significantly affect the in vitro assembly of microtubules, the amount of TB-RBP bound to microtubules was reduced from about 20% to less than 1% with increasing salt concentrations (Fig. 2, compare lanes 4, 6, and 8 to lane 2). This suggests that the interaction between TB-RBP and microtubules was specific, and not due to nonspecific charge interactions or aggregation of TB-RBP.
|
TB-RBP Was Present in the Microtubule-Associated Protein (MAP) Fraction of Brain Extracts
If TB-RBP is functionally associated with microtubules in cells, it should be present in the MAP fraction. To test this, TB-RBP was assayed in a MAP fraction isolated from control mouse brain cytoplasmic extracts. By Western blotting, TB-RBP was detected in the mouse brain extract (Fig. 3, lane 1), the microtubule fraction (Fig. 3, lane 2), and the MAP fraction (Fig. 3, lane 3). Virtually all of the TB-RBP was released from the microtubule fraction by high salt (Fig. 3, lane 4). We conclude that in mouse brain, endogenous TB-RBP cofractionates with the MAP fraction.
|
TB-RBP and Microtubules Colocalized in Germ Cells
Confocal microscopy was used as a second criterion to establish TB-RBP and microtubule colocalization in cells. Mouse germ cells were fixed onto coverslips, and TB-RBP and tubulin were visualized by indirect fluorescence with antibodies specific to each. TB-RBP (in green) was present throughout the cytoplasm of male germ cells and was especially abundant in a prominent region in the cytoplasm of spermatids (Fig. 4, top panel). Microtubules (in red) were seen throughout the cytoplasm (Fig. 4, middle). TB-RBP and microtubules were seen frequently colocalized in the cytoplasm (see yellow in Fig. 4, bottom panel). Interestingly, part of the cytoplasmic structure highly enriched for TB-RBP also was enriched for tubulin (Fig. 4, bottom panel).
|
TB-RBP Was Bound in Cellular Extracts to Brain mRNAs Encoding MBP and Calmodulin-Dependent Kinase II and to Testicular mRNAs Encoding Protamine 1 and 2
TB-RBP binds to numerous testicular and brain mRNAs containing the conserved Y and H sequence elements [24]. The interactions between TB-RBP and microtubules and the binding of TB-RBP to specific mRNAs [22, 24] suggest an involvement of TB-RBP in mRNA transport. To determine whether TB-RBP is associated with mRNAs containing the Y and H elements in cells, TB-RBP was immunoprecipitated from brain and testis extracts with an affinity-purified antibody to recombinant TB-RBP (TB-RBP), and RNA was isolated from the immunoprecipitates. As a control, a nonprecipitating antibody, KNDS, prepared to a TB-RBP peptide, was substituted for TB-RBP [20].
Since the 3' UTR of MBP mRNA contains conserved sequences recognized by TB-RBP [25] and the CAMK II mRNA can be mislocalized by an antisense oligodeoxynucleotide to the Y element [9], associations between TB-RBP and the mRNAs encoding MBP and CAMK II were looked for in brain extracts. Using standard RT-PCR assays, both MBP mRNA and CAMK II mRNA were detected in control samples of total brain RNA (Fig. 5, lane 4). The MBP and CAMK II mRNAs were also selectively precipitated by affinity-purified antibody to recombinant TB-RBP (Fig. 5, lane 1) but were not precipitated when the nonprecipitating antibody KNDS was used (Fig. 5, lane 2). When mouse testis extracts were analyzed, protamine 1 and 2 mRNAs were detected in control testicular RNA (Fig. 5, lane 4) and in the precipitated RNA fraction (Fig. 5, lane 1). In contrast, mRNAs encoding TB-RBP and the Sertoli cell-expressed gene SGP2, two mRNAs that lack the Y or H element, were not precipitated by TBRP (Fig. 5, lane 1) although both were readily detected in mouse testis extracts (Fig. 5, lane 4). These data indicate that in mouse brain extracts, TB-RBP is bound to the MBP and CAMK II mRNAs, whereas TB-RBP is bound to protamine 1 and 2 mRNAs but not to its own mRNA or SGP2 mRNA in testis extracts.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The association of TB-RBP with microtubules and the sequence-dependent RNA-binding properties of TB-RBP suggest that TB-RBP could play a role in the transportation of mRNAs that contain the Y or H elements [25, 29]. The selective immunoprecipitation of MBP and CAMK II mRNAs from brain extracts and the protamine 1 and 2 mRNAs from testis extracts with an affinity-purified antibody to recombinant TB-RBP supports this. The MBP mRNA contains both the Y and H elements in its 3' UTR [25], while CAMK II mRNA contains a Y element in its coding region [9]. RNA gel shift assays have demonstrated in vitro binding of these mRNAs to TB-RBP [9, 25]. Antisense nucleotides that block the Y element present in CAMK II and ligatin mRNAs disrupt and mislocalize the mRNAs [9]. The presence of TB-RBP in ribonucleoprotein particles of BC1 RNA, a transcript that contains Y and H elements, suggests an involvement of TB-RBP in the distribution of specific mRNAs in neuronal dendrites [30]. These TB-RBP-microtubule interactions are similar to those of the 69-kDa Xenopus Vg1 protein, which shows both RNA-binding activity and microtubule-binding activity [13]. A spermatid perinuclear RNA-binding protein associated with manchettes in vivo also binds to microtubules in vitro [31]. Although we have only monitored for two known transported brain mRNAs encoding MBP and CAMKII, it is likely that many additional RNAs containing Y and/or H elements also form ribonucleoprotein particles containing TB-RBP. In the testis, the protamine 1 and 2 mRNAs are germ cell-specific mRNAs that are stored for seven days before translation [32]. Both bind to TB-RBP in in vitro assays [24], and they were also detected bound to TB-RBP in cell extracts (Fig. 5).
Transported mRNAs may be packed into particles or granules that are translocated along cytoskeletal filaments by complexes of cis-acting RNA elements, motor molecules, and accessory proteins [3, 33, 34]. Actin mRNA [13], MBP mRNA [35], bicoid RNA [36], BC1 RNA [30], Xlsirt, XwntII, and Xcat-2 RNA [11, 37], and Vgl mRNA [38] have been detected in particles. Often, ribonucleoprotein (RNP) particles/granules translocate along microtubules [25, 39]. Tau mRNA, an mRNA that is localized to the cell body and proximal axon region, also binds to microtubules [40]. The translocation of RNPs requires the action of motor proteins such as the kinesins along microtubules [39]. Although it is unlikely that TB-RBP functions as a motor protein, TB-RBP contains two amino acid domains (residues 9–35 and 14–47) showing 55–62% similarity to two segments (amino acids 473–499 and 768–801) of a human kinesin heavy chain [20]. Since suppression of the kinesin heavy chain motor protein alters CAMK II mRNA localization but not the localization of ligatin mRNA, a second transported mRNA [9], different motor proteins are probably used in different transport particles.
In summary, in the nervous system, TB-RBP appears to function as an anchoring protein for RNA to dock onto microtubules, and, in association with other proteins such as the transitional endoplasmic reticulum ATPase and TRAX, it translocates specific mRNAs [41]. In the testis, TB-RBP functions in both intracellular and intercellular mRNA transport in male germ cells [29] as well as facilitating the storage of specific mRNAs in germ cells until their time of translation.
|
FOOTNOTES |
|---|
1 Supported by NIH grant HD 28832. 
2 Correspondence: Norman B. Hecht, Center for Research on Reproduction and Women's Health, University of Pennsylvania School of Medicine, 1310 Biomedical Research Building II/III, 421 Curie Boulevard, Philadelphia, PA 19104. FAX: 215 573 5408; nhecht{at}mail.med.upenn.edu
Accepted: October 15, 1999.
Received: July 6, 1999.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
actin and Trax in male germ cells and the brain. Biochemistry 1999; 38:11261–11270.[CrossRef][Medline]This article has been cited by other articles:
|
|
 |
|
  S. H. Mellon, S. R. Bair, C. Depoix, J.-L. Vigne, N. B. Hecht, and P. B. Brake Translin Coactivates Steroidogenic Factor-1-Stimulated Transcription Mol. Endocrinol., January 1, 2007; 21(1): 89 - 105. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Claussen, R. Koch, Z.-Y. Jin, and B. Suter Functional Characterization of Drosophila Translin and Trax Genetics, November 1, 2006; 174(3): 1337 - 1347. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. F. Mehler and J. S. Mattick Non-coding RNAs in the nervous system J. Physiol., September 1, 2006; 575(2): 333 - 341. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Iguchi, J. W. Tobias, and N. B. Hecht Expression profiling reveals meiotic male germ cell mRNAs that are translationally up- and down-regulated PNAS, May 16, 2006; 103(20): 7712 - 7717. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Stein, W. Bergman, Y. Fang, L. Davison, C. Brensinger, M. B. Robinson, N. B. Hecht, and T. Abel Behavioral and neurochemical alterations in mice lacking the RNA-binding protein translin. J. Neurosci., February 22, 2006; 26(8): 2184 - 2196. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. S. Cho, N. Iguchi, J. Yang, M. A. Handel, and N. B. Hecht Meiotic Messenger RNA and Noncoding RNA Targets of the RNA-Binding Protein Translin (TSN) in Mouse Testis Biol Reprod, October 1, 2005; 73(4): 840 - 847. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Laufman, R. B. Yosef, N. Adir, and H. Manor Cloning and characterization of the Schizosaccharomyces pombe homologs of the human protein Translin and the Translin-associated protein TRAX Nucleic Acids Res., July 25, 2005; 33(13): 4128 - 4139. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. S. Cho, V. M. Chennathukuzhi, M. A. Handel, J. Eppig, and N. B. Hecht The Relative Levels of Translin-associated Factor X (TRAX) and Testis Brain RNA-binding Protein Determine Their Nucleocytoplasmic Distribution in Male Germ Cells J. Biol. Chem., July 23, 2004; 279(30): 31514 - 31523. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Iguchi, H. Tanaka, S. Yamada, H. Nishimura, and Y. Nishimune Control of Mouse hils1 Gene Expression During Spermatogenesis: Identification of Regulatory Element by Transgenic Mouse Biol Reprod, May 1, 2004; 70(5): 1239 - 1245. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Yang, Y. S. Cho, V. M. Chennathukuzhi, L. A. Underkoffler, K. Loomes, and N. B. Hecht Translin-associated Factor X Is Post-transcriptionally Regulated by Its Partner Protein TB-RBP, and Both Are Essential for Normal Cell Proliferation J. Biol. Chem., March 26, 2004; 279(13): 12605 - 12614. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Chennathukuzhi, J. M. Stein, T. Abel, S. Donlon, S. Yang, J. P. Miller, D. M. Allman, R. A. Simmons, and N. B. Hecht Mice Deficient for Testis-Brain RNA-Binding Protein Exhibit a Coordinate Loss of TRAX, Reduced Fertility, Altered Gene Expression in the Brain, and Behavioral Changes Mol. Cell. Biol., September 15, 2003; 23(18): 6419 - 6434. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Yang, V. Chennathukuzhi, K. Miki, D. A. O'Brien, and N. B. Hecht Mouse Testis Brain RNA-Binding Protein/Translin Selectively Binds to the Messenger RNA of the Fibrous Sheath Protein Glyceraldehyde 3-Phosphate Dehydrogenase-S and Suppresses Its Translation In Vitro Biol Reprod, March 1, 2003; 68(3): 853 - 859. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Erdemir, B. Bilican, D. Oncel, C. R. Goding, and U. Yavuzer DNA damage-dependent interaction of the nuclear matrix protein C1D with translin-associated factor X (TRAX) J. Cell Sci., January 1, 2002; 115(1): 207 - 216. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. M. Chennathukuzhi, Y. Kurihara, J. D. Bray, J. Yang, and N. B. Hecht Altering the GTP binding site of the DNA/RNA-binding protein, Translin/TB-RBP, decreases RNA binding and may create a dominant negative phenotype Nucleic Acids Res., November 1, 2001; 29(21): 4433 - 4440. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. M. Chennathukuzhi, Y. Kurihara, J. D. Bray, and N. B. Hecht Trax (Translin-associated Factor X), a Primarily Cytoplasmic Protein, Inhibits the Binding of TB-RBP (Translin) to RNA J. Biol. Chem., April 13, 2001; 276(16): 13256 - 13263. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
