Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iwatsuki, K.
Right arrow Articles by Shiota, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iwatsuki, K.
Right arrow Articles by Shiota, K.
Agricola
Right arrow Articles by Iwatsuki, K.
Right arrow Articles by Shiota, K.
Biology of Reproduction 62, 1352-1359 (2000)
© 2000 Society for the Study of Reproduction, Inc.


Articles

A Novel Secretory Protein Produced by Rat Spongiotrophoblast1

Ken Iwatsukia, Mikihiko Shinozakia, Weiyong Suna, Shintaro Yagia, Satoshi Tanakaa, and Kunio Shiota2,a

a Laboratory of Cellular Biochemistry, Animal Resource Science/Veterinary Medical Science, University of Tokyo, Bunkyo-ku, Tokyo 113, Japan


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The placenta secretes various factors in stage- and cell-specific manners. We have identified a cDNA encoding a novel protein with 124 amino acids, which was named spongiotrophoblast specific protein (SSP). SSP is highly homologous to mouse 4311, showing 81% and 59% similarity at the nucleotide and amino acid levels, respectively. Northern blot analysis showed that SSP mRNA was first detected on Day 14 of pregnancy, peaked on Day 16, and remained elevated until term. In situ hybridization analysis showed that SSP mRNA was specifically expressed in spongiotrophoblast cells of Day 20 placenta but not in Day 12 placenta. No expression was detected from the differentiated or undifferentiated rat choriocarcinoma Rcho-1 cell line. Native SSP was detected as a 19-kDa molecule by Western blotting in cell extracts prepared from the junctional zone. SSP was predicted to be a secretory protein, because 1) a hydropathy test revealed that SSP contained an N-terminal hydrophobic region and 2) native SSP was also detected in the cultured media of junctional zone explants. To further investigate a potential signal peptide of this protein, sets of recombinant SSP were generated using a COS7 transfection system. The N-terminal amino acid sequence of secreted recombinant SSP confirmed that the N-terminal 17 amino acids had been cleaved to produce a secretory protein. Thus, we have identified and cloned a novel secretory protein, SSP, which is specifically expressed by rat spongiotrophoblast cells during the latter half of pregnancy.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The placenta is a rich source of bioactive molecules such as hormones and cytokines, which play an important role in the maintenance of pregnancy [1, 2]. Mature rat chorioallantoic placenta consists of two major regions: the junctional zone (often referred to as the "basal zone") and the labyrinth zone [3, 4]. The junctional zone lies at the maternal interface of the placenta and is composed of secondary trophoblast giant cells (TGCs), spongiotrophoblast cells, and glycogen cells, all of which are derived from the same placental unit, called the ectoplacental cone [5]. The labyrinth zone lies adjacent to the developing embryo and consists of TGCs, syncytial trophoblast cells, and fetal mesenchyme and vasculature [4]. Within these cell types, TGCs and spongiotrophoblast cells are the major endocrine cells.

TGCs and spongiotrophoblast cells differ in that TGCs undergo a postmitotic endocycle resulting in an amplification of whole genome, whereas spongiotrophoblast cells are proliferative diploids [5, 6]. Despite the unique characteristics of these two cell types, several members of the placental prolactin (PRL) family are expressed in both TGCs and spongiotrophoblast cells in a temporal-specific manner [711]. mRNAs for recently isolated members of the PRL family, for example, prolactin-like protein (PLP)-C, PLP-D, and PLP-H, are detected in both TGCs and spongiotrophoblast cells [10, 12, 13]. The presence of PLP-C in the junctional zone has also been confirmed by immunochemical analysis [14]. Some members of the PRL family, however, are expressed in a cell type-specific manner, suggesting distinctive functions of TGCs and spongiotrophoblast cells during pregnancy. Placental lactogen (PL)-I and PL-II are exclusively expressed in TGCs [15], making these genes useful markers of TGCs. PLP-B, on the other hand, is expressed in spongiotrophoblast cells but not in the TGCs [9]. However, PLP-B is not a spongiotrophoblast-specific protein, as it has been shown to be synthesized also in the maternal decidual cells [16, 17].

Failure of spongiotrophoblast formation caused by null mutation of Mash2 or the epidermal growth factor receptor (EGFR) gene results in embryonic death at midpregnancy [18, 19]. Furthermore, chimeric analysis has shown that spongiotrophoblast is required for development of the labyrinth zone [20]. These studies indicate that spongiotrophoblast contributes to indispensable functions of the placenta and, therefore, is essential for the maintenance of pregnancy. To date, there have been no reports describing rat spongiotrophoblast-specific protein(s), which could be used as a marker for determining the degree of differentiation and function for this cell type.

In a series of experiments searching for spatio-temporally regulated molecules in the rat placenta, we found a cDNA encoding a novel protein. Here, we describe the molecular cloning and characterization of this spongiotropho-blast specific protein (SSP).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Reagents

A pGEM T-vector System was purchased from Promega (Madison, WI). ISOGEN was purchased from Nippon Gene (Toyama, Japan). The digoxigenin (DIG) RNA labeling kit and DIG nucleotide detection kits were purchased from Boehringer Mannheim Yamanouchi (Tokyo, Japan). [{alpha}-32P]dCTP (3000 Ci/mmol) was purchased from Amersham (Tokyo, Japan). Dulbecco's modified Eagle's Medium (DMEM) was purchased from Gibco BRL Life Technology Inc. (New York, NY). Unless otherwise noted, all other chemicals and reagents were purchased from Wako Pure Chemicals (Osaka, Japan).

Cell Lines

The Rcho-1 cell line was a generous gift from Dr. Michael J. Soares (University of Kansas Medical Center, Kansas City, KS). These cells were cultured and induced to differentiate as previously described [12]. The COS7 cell line was purchased from RIKEN Gene Bank (Ibaraki, Japan).

Animal Treatment and Tissue Preparation

Wistar rats were purchased from the Imamichi Institute for Animal Reproduction (Ibaraki, Japan). Rats were kept under a lighting schedule of 14L:10D (lights-on at 0500 h) and were allowed food and water ad libitum. Timed pregnancies (Day 12, 14, 16, 18, or 20 of gestation) and tissue dissections including mechanical separation of the junctional zone from the labyrinth zone were performed as previously described [12, 21].

Placental tissues collected for in situ hybridization and immunohistochemistry were embedded in OCT compound (Miles, Inc., Elkhart, IN), quickly frozen in ice-cold ethanol, and stored at -80°C until use.

Molecular Cloning of SSP cDNA

In a series of experiments exploring stage-specific placental factors by differential display [12, 13, 22], we obtained a cDNA fragment encoding a late pregnancy-specific mRNA. The full-length cDNA was cloned using 5' rapid amplification of cDNA ends (RACE) and subsequent polymerase chain reaction (PCR) as previously described [12]. The cDNA fragments of the PCR products were ligated into pGEM T-vector and transformed in Escherichia coli strain XL-1 blue, and the cDNA sequence was determined as previously described [12]. Data base searches showed that this cDNA encodes a novel protein, which was tentatively named the SSP. A hydropathy test was performed by MacMolly Tetra computer software (version 2.1; Soft Gene, Berlin, Germany).

Detection of SSP mRNA by Northern Blot Analysis and In Situ Hybridization

In situ hybridization was performed as previously described [12]. Briefly, a cDNA fragment of the coding region of SSP (128–448) was subcloned into a pGEM transcription vector by standard techniques, and DIG-labeled probes were generated using a DIG RNA labeling kit. SSP mRNA was detected in tissue sections as previously described using a DIG nucleic-acid detection kit [12]. Expression of PLP-D was also examined at the same time as a positive control for staining of both TGCs and spongiotrophoblast cells. Every section was lightly counterstained with hematoxylin. As a control, one of the adjacent sections was stained with hematoxylin and eosin.

For Northern blot analysis, SSP and PLP-D cDNA subcloned into pGEM plasmids were used as a template to generate 32P-labeled cDNA probes, and hybridization was performed as previously described [12].

Production of Anti-Serum for SSP

SSP glutathione-S-transferase (GST)-fusion protein was produced in E. coli using a GST gene fusion vector system according to the manufacturer's instructions (Pharmacia Biotech, Uppsala, Sweden). Briefly, portions of SSP cDNA (nucleotides 129–448 in Fig. 1) were ligated into pGEX-4T-1 and transformed in XL1-blue. Recombinant protein was induced with 2 mM isopropyl-1-thio-ß-D-galactopyranoside (IPTG) for 3 h, and soluble cell lysate was obtained by ultrasonication followed by centrifugation. The fusion proteins were then purified by a glutathione Sepharose 4B column (Pharmacia Biotech). Approximately 500 µg of purified proteins in water-in-oil adjuvant (Titer Max Gold; CytRx Co., Norcross, GA; 50:50 ratio of protein in phosphate buffer to adjuvant, v:v) was injected intradermally into the back of a New Zealand White rabbit. The same regimen was boosted every 2 wk, and 7 days after the third immunization the rabbit was exsanguinated. The antiserum generated against SSP was examined (at a 1:1000 dilution) for its ability to detect both native and recombinant SSP by Western blot, and native and recombinant proteins were both detected as 19-kDa protein. However, this band was not detected when the antiserum was preadsorbed with GST-SSP fusion protein, indicating that the antiserum was specific for SSP (data not shown). A 30-kDa protein was also detected by the antiserum when used for immunoblotting. This band seemed to be nonspecific since the band also appeared in extracts of cells and cell-lines that did not express SSP mRNA.



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 1. Analysis of SSP. A) Nucleotide and predicted amino acid sequences of SSP. Translation was assumed to begin at the first ATG (nucleotides 76–78) and to continue to the termination codon TAA (nucleotides 449–451). Vertical arrow indicates signal peptide cleavage site as described in the text and Figure 6. Polyadenylation signal sequences are underlined with the thick bar. B) Hydropathy test of SSP. SSP was highly hydrophilic except for the N-terminal amino acids. C) Comparison of deduced amino acid sequences between SSP and cDNA4311. Both amino acids were aligned using the MacMolly Tetra computer program. Upper line represents SSP and lower line indicates 4311. Similarity of these two proteins is 59%

Western Blotting and Immunohistochemistry

Homogenates from the junctional zone and labyrinth zone (15 µg each) were subjected to SDS-PAGE (15%) under reducing conditions. Proteins were transferred to a polyvinylidene difluoride membrane and detected using antiserum against SSP (1:1000) or anti-PLP-C antibody (a generous gift from Dr. Michael J. Soares [14]. For immunohistochemistry, the frozen sections were prepared as described above for in situ hybridization. The Day 12 and Day 20 placenta sections were incubated with antiserum against SSP (1:200), and SSP was detected by use of a Pathostain ABC-POD kit (Wako Pure Chemicals) with a minor modification: the detection color was changed from brown to dark blue by adding Ni+ at the peroxidase reaction. All sections used for immunohistochemistry were lightly counterstained with methyl green.

Placental Explant Culture

Three pieces of junctional zone were dissected from Day 16 placenta and were cultured in 3 ml DMEM supplemented with 100 µg/ml streptomycin and 100 U/ml penicillin, at 37°C in a humidified atmosphere of 95% air-5% CO2. After 36 h of incubation, 8 µl of culture medium was subjected to SDS-PAGE and then Western blotting, and native SSP and PLP-C were detected by anti-SSP antibody and anti-PLP-C antibody, respectively.

Generation of Recombinant Protein by COS7 Cells

In order to examine the functional nature of SSP, three different recombinant proteins for SSP were produced: 1) wild-type, 2) N-terminal Flag-tagged, and 3) C-terminal Flag-tagged proteins. Sets of primers generated for each recombinant protein were as follows—1) forward: GGTAGAATTCGATATGACTCCTACAGTCTTTCTAG, reverse: CGACTCTAGATTACTCTAGCTGTTCCTGTATAGG; 2) forward: GCGAATTCTGCCATACTCCCTGATACC, reverse: TGTCTAGATTACTCTAGCTGTTCCTGTATA; 3) forward: AGAAGCTTGAAGATATGACTCCTACAG, reverse: TTCGGTACCCTCTAGCTGTTCCTG. PCR reactions were performed using each set of primers, and PCR products were ligated into expression vectors pME18S [23], pFlag-CMV2, and pFlag-CMV-5a (Eastman Kodak Co., New Haven, CT), respectively. These plasmids were transfected into COS7 cells by the diethylaminoethyl-dextran method [24]. Three days after transfection, the conditioned medium and the cells were collected. Cell lysates were obtained by suspending the cells in lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 1 mM PMSF, 1% Triton X-100, pH 7.4), and the supernatant was collected after centrifugation at 15 000 x g for 15 min. Then, cell lysates and conditioned medium were subjected to SDS-PAGE (15%) followed by Western blotting.

Purification and Sequencing of Flag-Tagged Recombinant Protein

Two hundred milliliters of COS7-transfected culture medium was collected and subjected to anti-Flag M2 affinity resin (Eastman Kodak Co.) according to the manufacturer's instructions. The purity of the protein was checked by SDS-PAGE (15%) followed by silver staining. Then, the N-terminal amino acid sequence of the purified protein was determined using a LF3200 gas-phase protein sequencer with an on-line analytical HPLC system (Beckman, Fullerton, CA).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Molecular Cloning of a Novel cDNA from the Rat Placenta

During the course of searching for developmentally regulated molecules in the rat placenta, we cloned the full-length cDNA for a novel protein from Day 20 placentae and named it spongiotrophoblast specific protein (SSP). Sequence analysis showed that SSP was highly homologous to mouse 4311 (81% and 59% similarity at the nucleotide and amino acid sequence levels, respectively; Fig. 1C). SSP cDNA contains an open reading frame of 372 bp encoding 124 amino acids, polyadenylation signals (463–468, 682–687), and a poly(A)+ tail (Fig. 1A). The hydropathy test showed that SSP contains a hydrophobic region at its N terminus, while the rest of the portion is hydrophilic (Fig. 1B). SSP does not have a potential possible N-glycosylation site.

SSP mRNA Expression in Placenta and Rcho-1 Cells

Northern blot analysis showed that an SSP cDNA probe hybridized with a 0.8-kilobase mRNA. The expression pattern of SSP mRNA was similar to that of PLP-D: mRNA was not detected on Day 12, was first detected on Day 14, and peaked on Day 16; and the expression level was maintained until term (Fig. 2A, upper and middle panel). No hybridization was seen in the liver (Fig. 2A) or in any other adult tissues examined, such as heart, brain, kidney, small intestine, lung, ovary, and spleen of Day 18 pregnant rats (data not shown).



View larger version (58K):
[in this window]
[in a new window]
 
FIG. 2. Stage- and tissue-specific expression of SSP analyzed by Northern blot analysis. A) Total RNA (20 µg) isolated from placentae on Days 12, 14, 16, 18, 20 and from both male (M) and female (F) livers was separated on a 1% denaturing agarose gel, blotted onto a nylon membrane, and hybridized with either 32P-labeled SSP or PLP-D cDNA probe. SSP mRNA expression was first detected on Day 14, peaked on Day 16, and remained until term. B) Total RNA (20 µg) from undifferentiated (U) or differentiated (D) Rcho-1 cells was examined for both SSP and PLP-D expression. Note that no signal was detected for SSP in either differentiated or undifferentiated Rcho-1 cells. C) Total RNA (20 µg) from junctional zone (JZ) and labyrinth zone (LZ) was analyzed for SSP expression. SSP mRNA expression was restricted to the junctional zone

We next examined SSP mRNA expression in the proliferation and differentiation stages of Rcho-1 cells. An SSP signal was not detected at either cell stage (Fig. 2B, upper panel), but PLP-D mRNA expression was seen when Rcho-1 cells had differentiated to TGC-like cells (Fig. 2B, middle panel). In order to determine tissue specificity of SSP expression, the junctional zone and the labyrinth zone were separated, and total RNA from both regions was subjected to Northern blot analysis (Fig. 2C). The result showed that SSP mRNA expression was restricted to the junctional zone.

Cellular Localization of SSP mRNA

The junctional zone of placenta consists of two major subtypes of the trophoblast cells, TGCs and spongiotrophoblast cells. To determine which cell type possesses SSP mRNA, in situ hybridization analysis was performed. SSP mRNA was specifically localized to spongiotrophoblast cells of the junctional zone on Day 20 of pregnancy (Fig. 3A), while PLP-D expression was seen in both TGCs and spongiotrophoblast cells (Fig. 3B). SSP expression was not seen in decidua, the labyrinth zone, or TGCs. Incubation of an adjacent section with sense RNA probes did not show any specific hybridization (Fig. 3D). SSP mRNA was not detected in any trophoblastic cells on Day 12 of pregnancy (data not shown).



View larger version (153K):
[in this window]
[in a new window]
 
FIG. 3. Cellular localization of SSP mRNA in the placenta (Day 20) demonstrated by in situ hybridization. A) SSP cRNA antisense probe hybridized only to spongiotrophoblast cells (SP). No hybridization was seen in trophoblast giant cells (TGC) or in labyrinth zone cells (LZ) (labels appear on C). B) Expression of another trophoblast marker, PLP-D [12]. PLP-D was expressed in both SP and TGC. C) Hematoxylin and eosin staining. D) Negative control with sense SSP probe. All sections were adjacent sections and were lightly counterstained with hematoxylin. A–D) Bars = 100 µm

Immunohistochemical Analysis

SSP localization was determined by immunohistochemical analysis. SSP was specifically detected within the spongiotrophoblast cell region of the junctional zone on Day 20 of pregnancy (Fig. 4, A and B). No signal was observed in sections from Day 12 placenta (data not shown). These results are consistent with the result of in situ hybridization analysis described above. No specific staining was observed in the control section without antiserum (Fig. 4C).



View larger version (77K):
[in this window]
[in a new window]
 
FIG. 4. Immunohistochemical staining of SSP protein in the placenta. A) The placenta from Day 20 of pregnancy was immunostained using anti-SSP antiserum. B) Detail from A. C) Control, without antiserum. All the sections were counterstained with methyl green. Note that staining for SSP only occurred in spongiotrophoblast cells (SP). EM, Endometrium; JZ, junctional zone; LZ, labyrinth zone; TGC, trophoblast giant cells. Bars = 200 µm (A) and 50 µm (B and C)

Detection of Native SSP in the Placental Lysate and in the Conditioned Medium from the Junctional Zone Explant Culture

We next examined the expression of SSP in placental lysates (Fig. 5A) and in conditioned media of placental explant cultures (Fig. 5B) by Western blotting. Native SSP was detected as a 19-kDa band only in the lysate prepared from the junctional zone (Fig. 5A, left panel). SSP is highly acidic, as analyzed by two-dimensional gel electrophoresis (pI value of 4.0, data not shown). Next, proteins secreted by explants of the junctional zone (Day 16 of pregnancy) were analyzed for SSP expression to determine whether SSP is secreted or not. SSP was detected in the conditioned medium of the explant culture (Fig. 5B, left panel) indicating that SSP is a secretory protein. PLP-C, a secretory protein known to be expressed in the junctional zone, was also detected in the same fraction as SSP (Fig. 5, A and B, right panel).



View larger version (49K):
[in this window]
[in a new window]
 
FIG. 5. Detection of native SSP protein from junctional zone lysate and from junctional zone explant culture medium. A) Day 20 placentae were dissected into labyrinth zone (LZ) or junctional zone (JZ), and homogenate from each region was subjected to SDS-PAGE and immunoblotted with either anti-SSP or anti-PLP-C. The band at 29 kDa in the left panel is a nonspecific band. B) Junctional zones (JZ) of Day 16 placentae were cultured under the conditions described in Materials and Methods. Conditioned medium was collected after 32 h of incubation and subjected to immunoblot analysis as in A. As for control (C), DMEM medium without explants was also tested for immunoblot. Note that PLP-C, a secretory protein specific to the junctional zone, was detected in both cell lysates and explant culture medium of the junctional zone. Upper two arrows in both A and B indicate the band for PLP-C, and the lower arrow indicates the band for SSP

Recombinant SSP Expression and N-Terminal Amino Acid Sequencing

In order to examine whether the N-terminal hydrophobic region functions as a signal peptide, N-terminal Flag-tagged SSP (N-Flag) and C-terminal Flag-tagged SSP (C-Flag) as well as wild-type SSP (Wt) were expressed in COS7 cells by a transient expression system (Fig. 6A). The conditioned media and cell lysates were collected from each transfectant, and the proteins were analyzed by Western blotting using antiserum against SSP (Fig. 6B). Recombinant SSPs corresponding to Wt and C-Flag were detected in both lysates and conditioned media, while N-Flag was detected only in lysates, indicating that N-Flag could not be secreted. This is probably because the N-terminal signal peptide was replaced with Flag-tag. Furthermore, a reduction in SSP molecular mass in conditioned media, as compared with lysates, was observed, supporting the idea that an N-terminal protein processing mechanism exists for SSP.



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 6. Exogenous expression of SSP in COS7 cells and determination of signal peptide cleavage in the recombinant SSP. A) Scheme of three recombinant proteins: Wt, N-Flag, and C-Flag SSP. Shaded boxes show the region for possible signal sequences, and solid boxes show the region for the Flag-tags. For N-Flag, the N-terminal possible signal sequence has been swapped with the Flag-tag. B) Western blot analysis of recombinant proteins with anti-SSP antibody. Recombinant proteins were transiently expressed in COS7 cells, and the conditioned media (CM) or cell lysates (Lys) were subjected to SDS-PAGE followed by immunoblot. Control, no transfection. C) N-Terminal sequencing of purified C-terminal Flag-tagged SSP. In order to directly confirm that the N-terminal signal sequence is cleaved to produce a secretory protein, conditioned medium of COS7 cells transfected with C-Flag SSP was collected, and the recombinant protein was purified. Then N-terminal amino acid sequences were determined by an amino acid sequencer. Upper line shows the deduced amino acid sequence from SSP cDNA, and lower line shows the N-terminal acid sequence of the C-Flag SSP

In order to determine the cleavage site of the signal peptide, C-Flag purified from conditioned medium using anti-Flag M2 antibody column was analyzed for its N-terminal amino acid sequence. The result showed that the 17 N-terminal amino acids were absent in C-Flag SSP (Fig. 6C), suggesting that the N terminus had been cleaved to secrete the protein.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have cloned a cDNA encoding a novel protein, SSP, from the rat placenta. Expression of SSP was restricted to spongiotrophoblast cells and was not detected in any other cells including decidual cells. Spongiotrophoblast cells and TGCs are thought to have differentiated along a distinct lineage pathway [25]. PLP-B has been used as a spongiotrophoblast cell marker; however, it is also expressed in decidua [16, 17]. Other trophoblast cell markers, such as members of placental PRL family, are expressed in both TGCs and spongiotrophoblast cells or TGCs alone [813, 26]. Members of the placental PRL family are expressed by Rcho-1 cell line, which shows characteristics of TGC lineage [12, 13, 27, 28]. The result that SSP expression was not observed in Rcho-1 at either the proliferating or differentiating stage is consistent with the detection of both SSP mRNA and protein only in the spongiotrophoblast cells, but not in TGCs by both in situ hybridization and immunohistochemistry analysis. At present, SSP is the only gene so far identified in the rat whose expression is restricted to spongiotrophoblast cells.

There is an SSP homologue in mice, named 4311, which is also exclusively expressed in spongiotrophoblast cells [29]. Expression of SSP could not be detected earlier than Day 14 of pregnancy, a period at which chorioallantoic placenta has already been formed in the rat. In contrast, 4311 mRNA is expressed on Day 7.5 of pregnancy in the ectoplacental cone, before the formation of chorioallantoic placenta [29]. The expression of 4311 is also seen in the mouse trophoblast cell line at an early stage of differentiation in vitro [30]. Thus, the expression patterns of SSP and 4311 are quite different from each other. Similar to the case in the placental PRL family, there may be SSP family members that are expressed in spongiotrophoblast cells in temporal- and spatial-specific manners.

Von Heijne [31] reported the "weight matrix method" for predicting the cleavage sites of signal peptides. The N-terminal sequence corresponding to the signal peptide is similar between SSP and 4311. According to the weight matrix method, we postulated that SSP signal peptide is cleaved between Ala-1 and Ala+1 (in Fig. 1), generating a 17-amino acid signal peptide and a mature protein of 104 amino acids. This was proved by directly sequencing the N terminus of recombinant SSP expressed in COS7 cells. A signal peptide cleavage was further confirmed by the observation that when the 17 N-terminal amino acids were replaced with Flag-tag, the recombinant SSP was not detected in the conditioned medium although the protein was present in the cytosolic fraction. Therefore, it became clear that the N-terminal hydrophobic region of SSP functions as a signal peptide to secrete SSP. The fact that many members of placental PRL family are present in the maternal circular system [32, 33] and the observation that SSP is a secretory protein suggest that SSP could be detected in the maternal circulation and possibly in the fetus.

The N-terminal amino acid sequence of SSP is highly homologous to that of cathepsin L and cathepsin P, but the similarity is restricted to "pro" regions [34, 35]. Other than these cathepsins and mouse 4311, SSP showed no similarity to known proteins. While SSP is a secretory protein, the primary structure of SSP shows that it does not contain possible glycosylation sites or apparent amino acid motifs from which its function could be speculated. Therefore, SSP may be a new type of a cytokine or hormone specifically expressed in the placenta during pregnancy. Further experiments will be needed to elucidate the biological function of SSP.

SSP is the first molecule to be identified as a specific protein expressed in the rat spongiotrophoblast cells. It has become clear that spongiotrophoblast cells secrete SSP. These findings will not only provide a marker for spongiotrophoblast cells but will also help elucidate the role that spongiotrophoblast cells play during pregnancy.


    FOOTNOTES
 
First decision: 16 September 1999.

1 This work was supported by the Ministry of Education, Science and Culture, Japan (10460121), by the Research for the Future Program, the Japan Society for the Promotion of Science (JSPS-RFTF97L00904), by the Program for Promotion of Basic Research Activities for Innovative Biosciences (PROBRAIN), and by research fellowships from the Japan Society of the Promotion of Science for Young Scientists (to K.I.; 10460121). The complete sequence for spongiotrophoblast specific protein (SSP) has been submitted to GenBank, accession no. AB009890. Back

2 Correspondence: Kunio Shiota, Laboratory of Cellular Biochemistry, Animal Resource Science/Veterinary Medical Science, University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113, Japan. FAX: 81 3 5841 8189; ashiota{at}mail.ecc.u-tokyo.ac.jp Back

3 Current address: Advanced Life Science Institute Inc., Saitama, Japan. Back

Accepted: December 14, 1999.

Received: August 5, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Mitchell MD, Trautman MS, Dudley DJ. Cytokine networking in the placenta. Placenta 1993; 14:249–275.[CrossRef][Medline]
  2. Shiota K, Hirosawa M, Hattori N, Itonori S, Miura R, Noda K, Takahashi M, Ogawa T. Structural and functional aspects of placental lactogens (PLs) and ovarian 20{alpha}-hydroxysteroid dehydrogenase (20{alpha}-HSD) in the rat. Endocr J 1994; 41:S43-S56.
  3. Jollie WP. Fine structural changes in the junctional zone of the rat placenta with increasing gestational age. J Ultrastruct Res 1965; 12:420–438.
  4. Davies J, Glasser SR. Histological and fine structural observations on the placenta of the rat. Acta Anat 1968; 69:542–608.[Medline]
  5. Carney EW, Prideaux V, Lye SJ, Rossant J. Progressive expression of trophoblast-specific genes during formation of mouse trophoblast giant cells in vitro. Mol Reprod Dev 1993; 34:357–368.[CrossRef][Medline]
  6. Ohgane J, Aikawa J, Ogura A, Hattori N, Ogawa T, Shiota K. Analysis of CpG islands of trophoblast giant cells by restriction landmark genomic scanning. Dev Genet 1998; 22:132–140.[CrossRef][Medline]
  7. Campbell WJ, Deb S, Kwok SC, Joslin JA, Soares MJ. Differential expression of placental lactogen-II and prolactin-like protein-A in the rat chorioallantoic placenta. Endocrinology 1989; 125:1565–1574.[Abstract/Free Full Text]
  8. Deb S, Faria TN, Roby KF, Larsen D, Kwok SC, Talamantes F, Soares MJ. Identification and characterization of a new member of the prolactin family, placental lactogen-I variant. J Biol Chem 1991; 266:1605–1610.[Abstract/Free Full Text]
  9. Duckworth ML, Schroedter IC, Friesen HG. Cellular localization of rat placental lactogen II and rat prolactin-like proteins A and B by in situ hybridization. Placenta 1990; 11:143–155.[CrossRef][Medline]
  10. Deb S, Roby KF, Faria TN, Szpirer C, Levan G, Kwok SC, Soares MJ. Molecular cloning and characterization of prolactin-like protein C complementary deoxyribonucleic acid. J Biol Chem 1991; 266:23027–23032.[Abstract/Free Full Text]
  11. Dai G, Liu B, Szpirer C, Levan G, Kwok SC, Soares MJ. Prolactin-like protein-C variant: complementary deoxyribonucleic acid, unique six exon gene structure, and trophoblast cell-specific expression. Endocrinology 1996; 137:5009–5019.[Abstract]
  12. Iwatsuki K, Shinozaki M, Hattori N, Hirasawa K, Itagaki S, Shiota K, Ogawa T. Molecular cloning and characterization of a new member of the rat placental prolactin (PRL) family, PRL-like protein D (PLP-D). Endocrinology 1996; 137:3849–3855.[Abstract]
  13. Iwatsuki K, Oda M, Sun W, Tanaka S, Ogawa T, Shiota K. Molecular cloning and characterization of a new member of the rat placental prolactin (PRL) family, PRL-like protein H. Endocrinology 1998; 139:4976–4983.[Abstract/Free Full Text]
  14. Deb S, Roby KF, Faria TN, Larsen D, Soares MJ. Identification and immunochemical characterization of a major placental secretory protein related to the prolactin-growth hormone family, prolactin-like protein-C. Endocrinology 1991; 128:3066–3072.[Abstract/Free Full Text]
  15. Faria TN, Deb S, Kwok SC, Talamantes F, Soares MJ. Ontogeny of placental lactogen-I and placental lactogen-II expression in the developing rat placenta. Dev Biol 1990; 141:279–291.[CrossRef][Medline]
  16. Croze F, Kennedy TG, Schroedter IC, Friesen HG. Expression of rat prolactin-like protein B in deciduoma of pseudopregnant rat and in decidua during early pregnancy. Endocrinology 1990; 127:2665–2672.[Abstract/Free Full Text]
  17. Cohick CB, Xu L, Soares MJ. Prolactin-like protein-B: heterologous expression and characterization of placental and decidual species. J Endocrinol 1997; 152:291–302.[Abstract/Free Full Text]
  18. Guillemot F, Nagy A, Auerbach A, Rossant J, Joyner AL. Essential role of Mash-2 in extraembryonic development. Nature 1994; 371:333–336.[CrossRef][Medline]
  19. Sibilia M, Wagner EF. Strain-dependent epithelial defects in mice lacking the EGF receptor [published erratum appears in Science 1995 Aug 18;269(5226):909]. Science 1995; 269:234–238.[Abstract/Free Full Text]
  20. Tanaka M, Gertsenstein M, Rossant J, Nagy A. Mash2 acts cell autonomously in mouse spongiotrophoblast development. Dev Biol 1997; 190:55–65.[CrossRef][Medline]
  21. Soares MJ. Developmental changes in the intraplacental distribution of placental lactogen and alkaline phosphatase in the rat. J Reprod Fertil 1987; 79:93–98.[Abstract/Free Full Text]
  22. Liang P, Pardee AB. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 1992; 257:967–971.[Abstract/Free Full Text]
  23. Hattori N, Nukada T, Oda M, Tanaka S, Ogawa T, Shiota K. Evaluation of the role of N-linked oligosaccharides in rat placental lactogen action by site-directed mutagenesis. Endocr J 1998; 45:659–674.[Medline]
  24. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. Transfection using DEAE-dextran. In: Current Protocols in Molecular Biology. New York: John Wiley & Sons; 1996: 9.2.1–9.2.6.
  25. Soares MJ, Faria TN, Hamlin GP, Lu X-J, Deb S. Trophoblast cell differentiation: expression of the placental prolactin family. In: Soares MJ, Handwerger S, Talamantes F (eds.), Trophoblast Cells; Pathways for Maternal-Embryonic Communication. New York: Springer-Verlag; 1993: 43–65.
  26. Roby KF, Deb S, Gibori G, Szpirer C, Levan G, Kwok SC, Soares MJ. Decidual prolactin-related protein. Identification, molecular cloning, and characterization. J Biol Chem 1993; 268:3136–3142.[Abstract/Free Full Text]
  27. Teshima S, Shimosato Y, Koide T, Kuroi M, Kikuchi Y, Aizawa M. Transplantable choriocarcinoma of rats induced by fetectomy and its biological activities. Gann 1983; 74:205–212.[Medline]
  28. Faria TN, Soares MJ. Trophoblast cell differentiation: establishment, characterization, and modulation of a rat trophoblast cell line expressing members of the placental prolactin family. Endocrinology 1991; 129:2895–2906.[Abstract/Free Full Text]
  29. Lescisin KR, Varmuza S, Rossant J. Isolation and characterization of a novel trophoblast-specific cDNA in the mouse. Genes Dev 1988; 2:1639–1646.[Abstract/Free Full Text]
  30. Tanaka S, Kunath T, Hadjantonakis A-K, Nagy A, Rossant J. Promotion of trophoblast stem cell proliferation by FGF4. Science 1998; 282:2072–2075.[Abstract/Free Full Text]
  31. von Heijne G. A new method for predicting signal sequence cleavage sites. Nucleic Acids Res 1986; 14:4683–4690.[Abstract/Free Full Text]
  32. Soares MJ, Muller H, Orwig KE, Peters TJ, Dai G. The uteroplacental prolactin family and pregnancy. Biol Reprod 1998; 58:273–284.[Free Full Text]
  33. Soares MJ, Chapman BM, Rasmussen CA, Dai G, Kamei T, Orwig KE. Differentiation of trophoblast endocrine cells. Placenta 1996; 17:277–289.[CrossRef][Medline]
  34. Conliffe PR, Ogilvie S, Simmen RC, Michel FJ, Saunders P, Shiverick KT. Cloning and expression of a rat placental cDNA encoding a novel cathepsin L-related protein. Mol Reprod Dev 1995; 40:146–156.[CrossRef][Medline]
  35. Katia S-C, Jennifer F, David T, Robert WM. Cathepsin P, a novel protease in mouse placenta. Biochem J 1999; 343:307–309.



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
R. N. Achur, S. T. Agbor-Enoh, and D. C. Gowda
Rat Spongiotrophoblast-specific Protein Is Predominantly a Unique Low Sulfated Chondroitin Sulfate Proteoglycan
J. Biol. Chem., October 27, 2006; 281(43): 32327 - 32334.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. D. Gultice, K. L. Selesniemi, and T. L. Brown
Hypoxia Inhibits Differentiation of Lineage-Specific Rcho-1 Trophoblast Giant Cells
Biol Reprod, June 1, 2006; 74(6): 1041 - 1050.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iwatsuki, K.
Right arrow Articles by Shiota, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iwatsuki, K.
Right arrow Articles by Shiota, K.
Agricola
Right arrow Articles by Iwatsuki, K.
Right arrow Articles by Shiota, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS