|
|
||||||||
Articles |
a Laboratory of Cellular Biochemistry, Animal Resource Science/Veterinary Medical Science, University of Tokyo, Bunkyo-ku, Tokyo 113, Japan
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
TGCs and spongiotrophoblast cells differ in that TGCs undergo a postmitotic endocycle resulting in an amplification of whole genome, whereas spongiotrophoblast cells are proliferative diploids [5, 6]. Despite the unique characteristics of these two cell types, several members of the placental prolactin (PRL) family are expressed in both TGCs and spongiotrophoblast cells in a temporal-specific manner [711]. mRNAs for recently isolated members of the PRL family, for example, prolactin-like protein (PLP)-C, PLP-D, and PLP-H, are detected in both TGCs and spongiotrophoblast cells [10, 12, 13]. The presence of PLP-C in the junctional zone has also been confirmed by immunochemical analysis [14]. Some members of the PRL family, however, are expressed in a cell type-specific manner, suggesting distinctive functions of TGCs and spongiotrophoblast cells during pregnancy. Placental lactogen (PL)-I and PL-II are exclusively expressed in TGCs [15], making these genes useful markers of TGCs. PLP-B, on the other hand, is expressed in spongiotrophoblast cells but not in the TGCs [9]. However, PLP-B is not a spongiotrophoblast-specific protein, as it has been shown to be synthesized also in the maternal decidual cells [16, 17].
Failure of spongiotrophoblast formation caused by null mutation of Mash2 or the epidermal growth factor receptor (EGFR) gene results in embryonic death at midpregnancy [18, 19]. Furthermore, chimeric analysis has shown that spongiotrophoblast is required for development of the labyrinth zone [20]. These studies indicate that spongiotrophoblast contributes to indispensable functions of the placenta and, therefore, is essential for the maintenance of pregnancy. To date, there have been no reports describing rat spongiotrophoblast-specific protein(s), which could be used as a marker for determining the degree of differentiation and function for this cell type.
In a series of experiments searching for spatio-temporally regulated molecules in the rat placenta, we found a cDNA encoding a novel protein. Here, we describe the molecular cloning and characterization of this spongiotropho-blast specific protein (SSP).
| MATERIALS AND METHODS |
|---|
|
|
|---|
A pGEM T-vector System was purchased from Promega (Madison, WI). ISOGEN was purchased from Nippon Gene (Toyama, Japan). The digoxigenin (DIG) RNA labeling kit and DIG nucleotide detection kits were purchased from Boehringer Mannheim Yamanouchi (Tokyo, Japan). [
-32P]dCTP (3000 Ci/mmol) was purchased from Amersham (Tokyo, Japan). Dulbecco's modified Eagle's Medium (DMEM) was purchased from Gibco BRL Life Technology Inc. (New York, NY). Unless otherwise noted, all other chemicals and reagents were purchased from Wako Pure Chemicals (Osaka, Japan).
Cell Lines
The Rcho-1 cell line was a generous gift from Dr. Michael J. Soares (University of Kansas Medical Center, Kansas City, KS). These cells were cultured and induced to differentiate as previously described [12]. The COS7 cell line was purchased from RIKEN Gene Bank (Ibaraki, Japan).
Animal Treatment and Tissue Preparation
Wistar rats were purchased from the Imamichi Institute for Animal Reproduction (Ibaraki, Japan). Rats were kept under a lighting schedule of 14L:10D (lights-on at 0500 h) and were allowed food and water ad libitum. Timed pregnancies (Day 12, 14, 16, 18, or 20 of gestation) and tissue dissections including mechanical separation of the junctional zone from the labyrinth zone were performed as previously described [12, 21].
Placental tissues collected for in situ hybridization and immunohistochemistry were embedded in OCT compound (Miles, Inc., Elkhart, IN), quickly frozen in ice-cold ethanol, and stored at -80°C until use.
Molecular Cloning of SSP cDNA
In a series of experiments exploring stage-specific placental factors by differential display [12, 13, 22], we obtained a cDNA fragment encoding a late pregnancy-specific mRNA. The full-length cDNA was cloned using 5' rapid amplification of cDNA ends (RACE) and subsequent polymerase chain reaction (PCR) as previously described [12]. The cDNA fragments of the PCR products were ligated into pGEM T-vector and transformed in Escherichia coli strain XL-1 blue, and the cDNA sequence was determined as previously described [12]. Data base searches showed that this cDNA encodes a novel protein, which was tentatively named the SSP. A hydropathy test was performed by MacMolly Tetra computer software (version 2.1; Soft Gene, Berlin, Germany).
Detection of SSP mRNA by Northern Blot Analysis and In Situ Hybridization
In situ hybridization was performed as previously described [12]. Briefly, a cDNA fragment of the coding region of SSP (128448) was subcloned into a pGEM transcription vector by standard techniques, and DIG-labeled probes were generated using a DIG RNA labeling kit. SSP mRNA was detected in tissue sections as previously described using a DIG nucleic-acid detection kit [12]. Expression of PLP-D was also examined at the same time as a positive control for staining of both TGCs and spongiotrophoblast cells. Every section was lightly counterstained with hematoxylin. As a control, one of the adjacent sections was stained with hematoxylin and eosin.
For Northern blot analysis, SSP and PLP-D cDNA subcloned into pGEM plasmids were used as a template to generate 32P-labeled cDNA probes, and hybridization was performed as previously described [12].
Production of Anti-Serum for SSP
SSP glutathione-S-transferase (GST)-fusion protein was produced in E. coli using a GST gene fusion vector system according to the manufacturer's instructions (Pharmacia Biotech, Uppsala, Sweden). Briefly, portions of SSP cDNA (nucleotides 129448 in Fig. 1) were ligated into pGEX-4T-1 and transformed in XL1-blue. Recombinant protein was induced with 2 mM isopropyl-1-thio-ß-D-galactopyranoside (IPTG) for 3 h, and soluble cell lysate was obtained by ultrasonication followed by centrifugation. The fusion proteins were then purified by a glutathione Sepharose 4B column (Pharmacia Biotech). Approximately 500 µg of purified proteins in water-in-oil adjuvant (Titer Max Gold; CytRx Co., Norcross, GA; 50:50 ratio of protein in phosphate buffer to adjuvant, v:v) was injected intradermally into the back of a New Zealand White rabbit. The same regimen was boosted every 2 wk, and 7 days after the third immunization the rabbit was exsanguinated. The antiserum generated against SSP was examined (at a 1:1000 dilution) for its ability to detect both native and recombinant SSP by Western blot, and native and recombinant proteins were both detected as 19-kDa protein. However, this band was not detected when the antiserum was preadsorbed with GST-SSP fusion protein, indicating that the antiserum was specific for SSP (data not shown). A 30-kDa protein was also detected by the antiserum when used for immunoblotting. This band seemed to be nonspecific since the band also appeared in extracts of cells and cell-lines that did not express SSP mRNA.
|
Western Blotting and Immunohistochemistry
Homogenates from the junctional zone and labyrinth zone (15 µg each) were subjected to SDS-PAGE (15%) under reducing conditions. Proteins were transferred to a polyvinylidene difluoride membrane and detected using antiserum against SSP (1:1000) or anti-PLP-C antibody (a generous gift from Dr. Michael J. Soares [14]. For immunohistochemistry, the frozen sections were prepared as described above for in situ hybridization. The Day 12 and Day 20 placenta sections were incubated with antiserum against SSP (1:200), and SSP was detected by use of a Pathostain ABC-POD kit (Wako Pure Chemicals) with a minor modification: the detection color was changed from brown to dark blue by adding Ni+ at the peroxidase reaction. All sections used for immunohistochemistry were lightly counterstained with methyl green.
Placental Explant Culture
Three pieces of junctional zone were dissected from Day 16 placenta and were cultured in 3 ml DMEM supplemented with 100 µg/ml streptomycin and 100 U/ml penicillin, at 37°C in a humidified atmosphere of 95% air-5% CO2. After 36 h of incubation, 8 µl of culture medium was subjected to SDS-PAGE and then Western blotting, and native SSP and PLP-C were detected by anti-SSP antibody and anti-PLP-C antibody, respectively.
Generation of Recombinant Protein by COS7 Cells
In order to examine the functional nature of SSP, three different recombinant proteins for SSP were produced: 1) wild-type, 2) N-terminal Flag-tagged, and 3) C-terminal Flag-tagged proteins. Sets of primers generated for each recombinant protein were as follows1) forward: GGTAGAATTCGATATGACTCCTACAGTCTTTCTAG, reverse: CGACTCTAGATTACTCTAGCTGTTCCTGTATAGG; 2) forward: GCGAATTCTGCCATACTCCCTGATACC, reverse: TGTCTAGATTACTCTAGCTGTTCCTGTATA; 3) forward: AGAAGCTTGAAGATATGACTCCTACAG, reverse: TTCGGTACCCTCTAGCTGTTCCTG. PCR reactions were performed using each set of primers, and PCR products were ligated into expression vectors pME18S [23], pFlag-CMV2, and pFlag-CMV-5a (Eastman Kodak Co., New Haven, CT), respectively. These plasmids were transfected into COS7 cells by the diethylaminoethyl-dextran method [24]. Three days after transfection, the conditioned medium and the cells were collected. Cell lysates were obtained by suspending the cells in lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 1 mM PMSF, 1% Triton X-100, pH 7.4), and the supernatant was collected after centrifugation at 15 000 x g for 15 min. Then, cell lysates and conditioned medium were subjected to SDS-PAGE (15%) followed by Western blotting.
Purification and Sequencing of Flag-Tagged Recombinant Protein
Two hundred milliliters of COS7-transfected culture medium was collected and subjected to anti-Flag M2 affinity resin (Eastman Kodak Co.) according to the manufacturer's instructions. The purity of the protein was checked by SDS-PAGE (15%) followed by silver staining. Then, the N-terminal amino acid sequence of the purified protein was determined using a LF3200 gas-phase protein sequencer with an on-line analytical HPLC system (Beckman, Fullerton, CA).
| RESULTS |
|---|
|
|
|---|
During the course of searching for developmentally regulated molecules in the rat placenta, we cloned the full-length cDNA for a novel protein from Day 20 placentae and named it spongiotrophoblast specific protein (SSP). Sequence analysis showed that SSP was highly homologous to mouse 4311 (81% and 59% similarity at the nucleotide and amino acid sequence levels, respectively; Fig. 1C). SSP cDNA contains an open reading frame of 372 bp encoding 124 amino acids, polyadenylation signals (463468, 682687), and a poly(A)+ tail (Fig. 1A). The hydropathy test showed that SSP contains a hydrophobic region at its N terminus, while the rest of the portion is hydrophilic (Fig. 1B). SSP does not have a potential possible N-glycosylation site.
SSP mRNA Expression in Placenta and Rcho-1 Cells
Northern blot analysis showed that an SSP cDNA probe hybridized with a 0.8-kilobase mRNA. The expression pattern of SSP mRNA was similar to that of PLP-D: mRNA was not detected on Day 12, was first detected on Day 14, and peaked on Day 16; and the expression level was maintained until term (Fig. 2A, upper and middle panel). No hybridization was seen in the liver (Fig. 2A) or in any other adult tissues examined, such as heart, brain, kidney, small intestine, lung, ovary, and spleen of Day 18 pregnant rats (data not shown).
|
We next examined SSP mRNA expression in the proliferation and differentiation stages of Rcho-1 cells. An SSP signal was not detected at either cell stage (Fig. 2B, upper panel), but PLP-D mRNA expression was seen when Rcho-1 cells had differentiated to TGC-like cells (Fig. 2B, middle panel). In order to determine tissue specificity of SSP expression, the junctional zone and the labyrinth zone were separated, and total RNA from both regions was subjected to Northern blot analysis (Fig. 2C). The result showed that SSP mRNA expression was restricted to the junctional zone.
Cellular Localization of SSP mRNA
The junctional zone of placenta consists of two major subtypes of the trophoblast cells, TGCs and spongiotrophoblast cells. To determine which cell type possesses SSP mRNA, in situ hybridization analysis was performed. SSP mRNA was specifically localized to spongiotrophoblast cells of the junctional zone on Day 20 of pregnancy (Fig. 3A), while PLP-D expression was seen in both TGCs and spongiotrophoblast cells (Fig. 3B). SSP expression was not seen in decidua, the labyrinth zone, or TGCs. Incubation of an adjacent section with sense RNA probes did not show any specific hybridization (Fig. 3D). SSP mRNA was not detected in any trophoblastic cells on Day 12 of pregnancy (data not shown).
|
Immunohistochemical Analysis
SSP localization was determined by immunohistochemical analysis. SSP was specifically detected within the spongiotrophoblast cell region of the junctional zone on Day 20 of pregnancy (Fig. 4, A and B). No signal was observed in sections from Day 12 placenta (data not shown). These results are consistent with the result of in situ hybridization analysis described above. No specific staining was observed in the control section without antiserum (Fig. 4C).
|
Detection of Native SSP in the Placental Lysate and in the Conditioned Medium from the Junctional Zone Explant Culture
We next examined the expression of SSP in placental lysates (Fig. 5A) and in conditioned media of placental explant cultures (Fig. 5B) by Western blotting. Native SSP was detected as a 19-kDa band only in the lysate prepared from the junctional zone (Fig. 5A, left panel). SSP is highly acidic, as analyzed by two-dimensional gel electrophoresis (pI value of 4.0, data not shown). Next, proteins secreted by explants of the junctional zone (Day 16 of pregnancy) were analyzed for SSP expression to determine whether SSP is secreted or not. SSP was detected in the conditioned medium of the explant culture (Fig. 5B, left panel) indicating that SSP is a secretory protein. PLP-C, a secretory protein known to be expressed in the junctional zone, was also detected in the same fraction as SSP (Fig. 5, A and B, right panel).
|
Recombinant SSP Expression and N-Terminal Amino Acid Sequencing
In order to examine whether the N-terminal hydrophobic region functions as a signal peptide, N-terminal Flag-tagged SSP (N-Flag) and C-terminal Flag-tagged SSP (C-Flag) as well as wild-type SSP (Wt) were expressed in COS7 cells by a transient expression system (Fig. 6A). The conditioned media and cell lysates were collected from each transfectant, and the proteins were analyzed by Western blotting using antiserum against SSP (Fig. 6B). Recombinant SSPs corresponding to Wt and C-Flag were detected in both lysates and conditioned media, while N-Flag was detected only in lysates, indicating that N-Flag could not be secreted. This is probably because the N-terminal signal peptide was replaced with Flag-tag. Furthermore, a reduction in SSP molecular mass in conditioned media, as compared with lysates, was observed, supporting the idea that an N-terminal protein processing mechanism exists for SSP.
|
In order to determine the cleavage site of the signal peptide, C-Flag purified from conditioned medium using anti-Flag M2 antibody column was analyzed for its N-terminal amino acid sequence. The result showed that the 17 N-terminal amino acids were absent in C-Flag SSP (Fig. 6C), suggesting that the N terminus had been cleaved to secrete the protein.
| DISCUSSION |
|---|
|
|
|---|
There is an SSP homologue in mice, named 4311, which is also exclusively expressed in spongiotrophoblast cells [29]. Expression of SSP could not be detected earlier than Day 14 of pregnancy, a period at which chorioallantoic placenta has already been formed in the rat. In contrast, 4311 mRNA is expressed on Day 7.5 of pregnancy in the ectoplacental cone, before the formation of chorioallantoic placenta [29]. The expression of 4311 is also seen in the mouse trophoblast cell line at an early stage of differentiation in vitro [30]. Thus, the expression patterns of SSP and 4311 are quite different from each other. Similar to the case in the placental PRL family, there may be SSP family members that are expressed in spongiotrophoblast cells in temporal- and spatial-specific manners.
Von Heijne [31] reported the "weight matrix method" for predicting the cleavage sites of signal peptides. The N-terminal sequence corresponding to the signal peptide is similar between SSP and 4311. According to the weight matrix method, we postulated that SSP signal peptide is cleaved between Ala-1 and Ala+1 (in Fig. 1), generating a 17-amino acid signal peptide and a mature protein of 104 amino acids. This was proved by directly sequencing the N terminus of recombinant SSP expressed in COS7 cells. A signal peptide cleavage was further confirmed by the observation that when the 17 N-terminal amino acids were replaced with Flag-tag, the recombinant SSP was not detected in the conditioned medium although the protein was present in the cytosolic fraction. Therefore, it became clear that the N-terminal hydrophobic region of SSP functions as a signal peptide to secrete SSP. The fact that many members of placental PRL family are present in the maternal circular system [32, 33] and the observation that SSP is a secretory protein suggest that SSP could be detected in the maternal circulation and possibly in the fetus.
The N-terminal amino acid sequence of SSP is highly homologous to that of cathepsin L and cathepsin P, but the similarity is restricted to "pro" regions [34, 35]. Other than these cathepsins and mouse 4311, SSP showed no similarity to known proteins. While SSP is a secretory protein, the primary structure of SSP shows that it does not contain possible glycosylation sites or apparent amino acid motifs from which its function could be speculated. Therefore, SSP may be a new type of a cytokine or hormone specifically expressed in the placenta during pregnancy. Further experiments will be needed to elucidate the biological function of SSP.
SSP is the first molecule to be identified as a specific protein expressed in the rat spongiotrophoblast cells. It has become clear that spongiotrophoblast cells secrete SSP. These findings will not only provide a marker for spongiotrophoblast cells but will also help elucidate the role that spongiotrophoblast cells play during pregnancy.
| FOOTNOTES |
|---|
1 This work was supported by the Ministry of Education, Science and Culture, Japan (10460121), by the Research for the Future Program, the Japan Society for the Promotion of Science (JSPS-RFTF97L00904), by the Program for Promotion of Basic Research Activities for Innovative Biosciences (PROBRAIN), and by research fellowships from the Japan Society of the Promotion of Science for Young Scientists (to K.I.; 10460121). The complete sequence for spongiotrophoblast specific protein (SSP) has been submitted to GenBank, accession no. AB009890. ![]()
2 Correspondence: Kunio Shiota, Laboratory of Cellular Biochemistry, Animal Resource Science/Veterinary Medical Science, University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113, Japan. FAX: 81 3 5841 8189; ashiota{at}mail.ecc.u-tokyo.ac.jp ![]()
3 Current address: Advanced Life Science Institute Inc., Saitama, Japan. ![]()
Accepted: December 14, 1999.
Received: August 5, 1999.
| REFERENCES |
|---|
|
|
|---|
-hydroxysteroid dehydrogenase (20
-HSD) in the rat. Endocr J 1994; 41:S43-S56.This article has been cited by other articles:
![]() |
R. N. Achur, S. T. Agbor-Enoh, and D. C. Gowda Rat Spongiotrophoblast-specific Protein Is Predominantly a Unique Low Sulfated Chondroitin Sulfate Proteoglycan J. Biol. Chem., October 27, 2006; 281(43): 32327 - 32334. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Gultice, K. L. Selesniemi, and T. L. Brown Hypoxia Inhibits Differentiation of Lineage-Specific Rcho-1 Trophoblast Giant Cells Biol Reprod, June 1, 2006; 74(6): 1041 - 1050. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |