Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Doherty, A. S.
Right arrow Articles by Schultz, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doherty, A. S.
Right arrow Articles by Schultz, R. M.
Agricola
Right arrow Articles by Doherty, A. S.
Right arrow Articles by Schultz, R. M.
Biology of Reproduction 62, 1526-1535 (2000)
© 2000 Society for the Study of Reproduction, Inc.


Articles

Differential Effects of Culture on Imprinted H19 Expression in the Preimplantation Mouse Embryo1

Adam S. Dohertya,b, Mellissa R.W. Mannb, Kimberly D. Tremblay3,b, Marisa S. Bartolomeib, and Richard M. Schultz2,a

a Department of Biology and b Howard Hughes Medical Institute and Department of Cell and Developmental Biology, University of Pennsylvania, Philadelphia, Pennsylvania 19104


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The H19 gene is imprinted with preferential expression from the maternal allele. The putative imprinting control region for this locus is hypermethylated on the repressed paternal allele. Although maternal-specific expression of H19 is observed in mouse blastocysts that develop in vivo, biallelic expression has been documented in embryos and embryonic stem cells experimentally manipulated by in vitro culture conditions. In this study the effect of culture on imprinted H19 expression and methylation was determined. After culture of 2-cell embryos to the blastocyst stage in Whitten's medium, the normally silent paternal H19 allele was aberrantly expressed, whereas little paternal expression was observed following culture in KSOM containing amino acids (KSOM+AA). Analysis of the methylation status of a CpG dinucleotide located in the upstream imprinting control region revealed a loss in methylation in embryos cultured in Whitten's medium but not in embryos cultured in KSOM+AA. Thus, H19 expression and methylation were adversely affected by culture in Whitten's medium, while the response of H19 to culture in KSOM+AA approximated more closely the in vivo situation. It is unlikely that biallelic expression of H19 following culture in Whitten's medium is a generalized effect of lower methylation levels, since the amount of DNA methyltransferase activity and the spatial distribution of Dnmt1 protein were similar in in vivo-derived and cultured embryos. Moreover, imprinted expression of Snrpn was maintained following culture in either medium, indicating that not all imprinted genes are under the same stringent imprinting controls. The finding that culture conditions can dramatically, but selectively, affect the expression of imprinted genes provides a model system for further study of the linkage between DNA methylation and gene expression.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Over 30 genes in the mammalian genome are preferentially expressed from a single parental allele. These genes are controlled by the process of genomic imprinting that marks the parental alleles and governs this unusual expression pattern [1, 2]. Although how the alleles are designated with their parental identity is the focus of intense investigation, the molecular marking mechanism that underlies the differential gene expression remains to be elucidated. What is clear, however, is that errors that result in loss-of-imprinting are associated with diseases such as Prader-Willi and Angelman syndromes and tumors such as Wilms' tumor [37].

The mouse H19 gene is one of the most highly characterized and studied imprinted genes. This gene, which does not encode a protein product and is transcribed exclusively from the maternal allele [8, 9], is located in a large cluster of imprinted genes on the distal end of mouse chromosome 7 [10, 11]. H19 and the oppositely imprinted Igf2 gene are located 90 kilobases (kb) apart and share regulatory elements crucial to the imprinting of both genes [1214]. H19 exhibits all the properties that thus far have been hypothesized as central to the imprinting mechanism, including differential chromatin structure, asynchronously replicating alleles, and locus-specific repetitive elements [1519]. Perhaps the most compelling and best-characterized candidate for the H19 imprinting mark is differential DNA methylation. The repressed paternal allele of H19 is hypermethylated over a 7-kb region that includes 4 kb of upstream flanking sequence and the transcription unit [2022] (Fig. 1). A 2-kb segment of this region located from -2 kb to -4 kb relative to the start of transcription is hypermethylated in sperm and on the paternal allele in somatic tissues throughout development, including the period of genome-wide demethylation that occurs during preimplantation, and is the candidate for harboring the allele-specific imprinting mark [23]. Deletion of this region from the endogenous locus leads to loss-of-imprinting of H19 and Igf2 on both parental alleles [14]. In addition to stably marking an allele, DNA methylation can also serve to inhibit gene activity, since hypermethylated DNA is typically transcriptionally repressed. This linkage between DNA methylation and repression of transcription appears to be mediated through the methyl-CpG-binding protein MeCP2 that interacts with a histone deacetylase complex [24, 25].



View larger version (8K):
[in this window]
[in a new window]
 
FIG. 1. Location of CpG dinucleotides in the upstream region of the H19 gene. A 4-kb region upstream of the transcription start site (arrow) is depicted on the top line. CpG dinucleotides cleaved by the methylation-sensitive restriction endonuclease HhaI (Hh, vertical line above gene line) are indicated. Other restriction endonuclease sites include EcoRI (R), BamHI (B), and SacI (S). The bottom line shows the location of all CpG dinucleotides found in the upstream region (accession no. U19619 [19]). The differentially methylated domain (filled box) is hypermethylated on the paternal allele. The PCR primers used to assay methylation of the Hh5 site are indicated beneath the top line

Definitive proof that allele-specific methylation confers imprinting to the H19 gene requires the ability to manipulate methylation at this locus. Genome-wide demethylation has been achieved through the use of DNA methyltransferase 1 (Dnmt1) mutant mice. Prior to their death at approximately 11 days of gestation, homozygous mutant mice have dramatically reduced levels of overall DNA methylation and, consistent with a role for DNA methylation in imprinting, exhibit perturbations in imprinted expression of H19, as well as other imprinted genes [26]. This experiment, however, indirectly tested the effect of methylation at the H19 locus, since the methylation status of the entire genome is affected.

The in vitro culture of mouse embryos provides another opportunity to test the role of epigenetic marking on imprinted gene expression. Although monoallelic expression of H19 from the maternal genome is observed in mouse blastocysts that develop in vivo and at subsequent stages of development [23], there are a few reports that describe the biallelic expression of H19 in embryos and embryonic stem cells. For example, embryos generated by fertilization in vitro and then cultured to the early blastocyst stage were reported to experience variability in imprinting with a subset of blastocysts showing biallelic expression of H19 [27]. Therefore, repression of the paternal allele may be unstable during extended culture.

In the present study, we report that the expression of H19 can be experimentally manipulated by in vitro culture conditions. Culture of 2-cell embryos to the blastocyst stage in Whitten's medium results in biallelic H19 expression in these blastocysts, whereas monoallelic maternal H19 expression is maintained following culture of 2-cell embryos to the blastocyst stage in KSOM containing amino acids (KSOM+AA). Moreover, a reduction in methylation of upstream H19 sequences occurs after culture in Whitten's medium, but not after culture in KSOM+AA. It is unlikely that the biallelic expression of H19 after culture in Whitten's medium is a generalized effect of lower methylation patterns, since DNA methyltransferase activity is maintained in Whitten's medium, and the imprinting of another gene, Snrpn, is also maintained.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Generation of Congenic B6(CAST 727–71) Mice

For allele-specific expression studies, F1 hybrid mice were derived from crosses with C57BL/6J (B6) (The Jackson Laboratory, Bar Harbor, ME) and B6(CAST-H19) mice [19]. The latter served as a source of the Mus musculus castaneus (CAST) H19 allele. For allele-specific expression studies involving the Snrpn gene, we produced a new strain of mice (B6[CAST 727–71]) that is CAST for a region encompassing two imprinted domains on chromosome 7 (Snrpn [27.6 cM] and H19 [69 cM]) on a B6 background. CAST mice were crossed with B6 mice, and the F1 hybrid progeny were subsequently mated to B6 mice. Progeny inheriting a CAST H19 and Snrpn allele were again bred to B6 mice. Mice that were heterozygous at the H19 and Snrpn loci were then intercrossed, and progeny were selected that were homozygous for the CAST H19 and Snrpn alleles. Backcross and intercross progeny were genotyped with the microsatellite markers (Research Genetics, Huntsville, AL) D7Mit198 (27 cM), D7Mit211 (27 cM), D7Mit222 (52 cM), D7Mit207 (65.5 cM), and D7Mit140 (71 cM) and the p57KIP2 gene (69 cM) to select for animals that were CAST for a region extending from 27 to 71 cM. The p57KIP2 gene was used to determine the genotype of the H19 imprinted domain. The amplification reaction contained 100 ng tail DNA, single-strength polymerase chain reaction (PCR) buffer II (10 mM Tris-HCl, pH 8.3, 50 mM KCl [Perkin Elmer, Foster City, CA]), 1.5 mM MgCl2, 100 µM dNTP each, 0.2 µM forward and reverse primer, and 0.5 U AmpliTaq DNA polymerase (Perkin Elmer). The p57KIP2 forward and reverse primers were 5'TACACCTTGGGACCAGCGTACTCC'3 (MMU20553; position 1304–1281) and 5'CGGACGATGGAAGAACTCTGG3' (MMU20553; position 1138–1158), respectively. PCR amplification consisted of 32 cycles, 94°C for 45 sec, 55°C for 45 sec, 72°C for 60 sec with an elongation cycle 72°C for 7 min. The resulting amplicons were subjected to gel electrophoresis in a 12% polyacrylamide gel using single-strength TBE (89 mM Tris-borate, 4 mM EDTA) to resolve the strain-specific PCR fragments. The p57KIP2 primers amplify a product of 167 base pairs (bp). Restriction digestion with TaqI allows for identification of a polymorphism in CAST (cytosine) at position 1256. Cleavage products are 118 bp and 49 bp in length. The B6 PCR amplification product is undigested since a thymine is present at this site.

Oocyte and Embryo Collection and Embryo Culture

Fully grown, germinal vesicle-intact oocytes were collected from mice 44–48 h after injection with 5 IU eCG [28]; metaphase II-arrested ovulated eggs were collected from mice injected with 5 IU eCG and then 5 IU hCG 44–48 h later [29]. One-cell, two-cell, eight-cell, morula, and blastocyst stage embryos were flushed with MEM/Hepes (bicarbonate-free minimal essential medium [Earle's salt] supplemented with pyruvate [100 µg/ml], gentamicin [10 µg/ml], polyvinylpyrrolidone [PVP; 3 mg/ml], and 25 mM Hepes, pH 7.3) from the oviducts/uteri of superovulated and mated mice 21 h, 48 h, 72 h, 80 h, and 96 h post-hCG, respectively, as previously described [30]. The embryos were then transferred to 50-µl drops of either Whitten's medium [31] or KSOM containing amino acids (KSOM+AA) [32] and cultured to the blastocyst stage at 37°C in an atmosphere of 5% CO2, 5% O2, 90% N2. Inner cell masses (ICM) were obtained by immunosurgery as previously described [33]. Mice were used according to a protocol approved by the Institutional Animal Care and Use Committee.

Isolation of RNA and Reverse Transcription-PCR for Analysis of the Temporal and Spatial Pattern of H19 Expression

RNA was isolated from oocytes/embryos recovered from CF-1 females (Harlan Sprague-Dawley; Harlan Industries, Indianapolis, IN) that were mated with B6D2/F1 males (The Jackson Laboratory) and prepared for reverse transcription (RT)-PCR using gene-specific primers as previously described [34]. In these experiments, ß-globin mRNA was added prior to RNA isolation; the ß-globin mRNA served as an internal standard for the efficiency of the RNA isolation and RT-PCR reactions [34]. The amount of cDNA product was measured in the linear region of semi-log plots of the amount of PCR product as a function of cycle number. This method permits the comparison of relative changes in the abundance of a particular transcript [34].

RT reactions were carried out as previously described using 28 oocyte/embryo equivalents, i.e., 28 oocytes or embryos per reaction [34]. An appropriate volume of RT reaction containing 4 oocyte/embryo equivalents was used in PCR reactions conducted as described previously [34], but according to the following PCR program: 94°C for 1 min, followed by 29 cycles of a 2-step program of 94°C for 10 sec and 60°C for 15 sec. The last cycle was followed by a 6-min extension at 60°C. The PCR reactions were conducted in the presence of [{alpha}-32P]dCTP (3000 Ci/mmol [NEN Research Products, Boston, MA]). The 5' and 3' H19 gene-specific primers were 5'GCACTAAGTCGATTGCACTGG3' and 5'CTCGCCTAGTCTGGAAGCAG3', respectively; these primers generate a 195-bp product.

Isolation of RNA, RT-PCR, and Single-Stranded Conformation Polymorphism Gel Electrophoresis

When the parental origin of the transcript was to be determined, single-stranded conformation polymorphism (SSCP) gel electrophoresis was conducted. In these experiments, RNA was isolated and subjected to RT as described above except that ß-globin mRNA was not added. After RT, PCR was performed on 4 embryo equivalents of reverse-transcribed product in a 25-µl reaction mixture containing single-strength PCR buffer II (10 mM Tris-HCl, pH 8.3, 50 mM KCl [Perkin Elmer]), 1.5 mM MgCl2, 125 µM dNTP each, 0.3 µM primer each, 0.1 µl [{alpha}-32P]dCTP (3000 Ci/mmol [NEN Research Products]), 1 unit AmpliTaq DNA polymerase (Perkin Elmer).

The H19 primers were 5'GCACTAAGTCGATTGCACTGG3' (U19613; position 2658–2678) and 5'TGGGTACTGGGGCAGCATTG3' (U19613; position 2768–2749); these primers generate a 110-bp amplicon that contains polymorphisms at nucleotides 2701, 2736, and 2739 such that B6 possess thymine, thymine, and adenine, while CAST mice have guanine, cytosine, and guanine at these positions (unpublished results). The Snrpn primers were 5'CTCCACCAGGAATTAGAGGC3' (MMSMN; position 822–841) and 5'GCAGTAAGAGGGGTCAAAAGC3' (MMSMN; position 966–946); these primers generate a 145-bp amplicon that contains a polymorphism at nucleotide 915 such that B6 possess a cytosine while CAST have a thymine at this position [35].

PCR amplification for both H19 and Snrpn cDNAs consisted of 34 cycles, 94°C for 1 min, 55°C for 2 min, 72°C for 2 min with an elongation cycle 60°C for 7 min. For SSCP analysis, 1–5 µl of PCR reaction product was added to 10 µl loading dye (95% formamide, 0.0125% bromophenol blue, 0.0125% xylene cyanol, 0.75% Ficoll, 50 µM EDTA), and the sample was heated to 95°C for 10 min and immediately placed on ice. Samples were electrophoresed through an SSCP gel (0.5-strength MDE [J.T. Baker, Phillipsburg, NJ]) in 0.6-strength TBE at 500 V, 4°C. For H19 product analysis, the gels either contained no glycerol and were run for 5 h (see Fig. 3) or contained 5% glycerol and were run for 7 h (see Fig. 7). Snrpn PCR products were analyzed on 10% glycerol SSCP gels for 15 h. The relative band intensities were quantitated using ImageQuant (Molecular Dynamics, Sunnyvale, CA), allowing the parental allele-specific contributions to be assessed.



View larger version (49K):
[in this window]
[in a new window]
 
FIG. 3. Effect of culture on H19 expression. SSCP analysis of RT-PCR products derived from B6(CAST-H19) x B6 F1 hybrid embryos that harbor a maternal H19 CAST allele and paternal B6 allele. Embryos cultured in KSOM+AA (KSOM) primarily expressed the maternal H19 allele (lane 1), while embryos cultured in Whitten's medium (WM) expressed H19 biallelically (lane 2). Only the maternal H19 allele was expressed in embryos that developed in vivo (lane 3). Open arrows, H19 amplicon derived from the paternal B6 allele; closed arrows, H19 amplicon derived from the maternal CAST allele



View larger version (65K):
[in this window]
[in a new window]
 
FIG. 7. Effect of culture on Snrpn expression. SSCP analysis to distinguish the parental alleles of RT-PCR products derived from B6(CAST 727–71) x B6 F1 hybrid embryos. Lane 1, B6 parental allele; lane 2, 1:1 mix of B6 and CAST alleles; lane 3, CAST parental allele. (A) Strict monoallelic Snrpn expression of the paternal B6 allele was observed in embryos cultured in either KSOM+AA (KSOM; lane 4) or Whitten's medium (WM; lane 5); in contrast, (B) significant paternal H19 expression was observed after culture in Whitten's medium, and little if any paternal H19 expression was observed after culture in KSOM+AA. Open arrow, amplicon derived from the paternal B6 allele; closed arrow, amplicon derived from the maternal CAST allele. Note that in these experiments the gel conditions for H19 (plus 5% glycerol) resulted in a different electrophoretic mobility than those observed in Figure 3. Also note that the extent of paternal H19 expression after culture in Whitten's medium was less than that shown in Figure 3

PCR Methylation Analysis

The analysis of the methylation status of the HhaI site 5 was conducted essentially as previously described [19]. Briefly, after culture and isolation of DNA, samples were digested with PvuII alone (to reduce the size of the DNA) or PvuII plus the methylation-sensitive enzyme HhaI. The 5' and 3' primers surrounding the HhaI site 5 were 5'TATGCCTCAGTGGTCGATATG3' and 5'GGTTCAGTGTGTAAGGGAACC3', respectively, and PCR amplification was conducted as previously described [19]. The PCR products were separated by electrophoresis either under conditions that detect the amplified product or under SSCP conditions that resolve the parental allele-specific DNA strands.

Assay for DNA Methyltransferase Activity

The activity of endogenous DNA methyltransferase was assayed with minor modifications to the method of Monk et al. [36]. Briefly, oocytes/embryos recovered from either CF-1 females mated with B6D2/F1 males or B6(CAST-H19) females mated with B6 males (10 per group and 4 groups per assay) were transferred in 2–17 µl of assay buffer (50 mM Tris-HCl, pH 7.8, 1 mM EDTA, 1 mM dithiothreitol, 10% glycerol, 1% Tween 80, 100 µg/ml RNase A, and 130 µCi/ml [3H-methyl]S-adenosylmethionine [77 Ci/mmol; Amersham Pharmacia Biotech, Piscataway, NJ]). Oocytes/embryos were then lysed by 4 freeze/thaw cycles using dry ice in methanol. After the addition of water (1 µl) to one tube and 1 µl poly d(I-C) (500 µg/ml [Boehringer Mannheim, Indianapolis, IN]) to the remaining 3 tubes in each embryo group, the samples were incubated for 2 h at 37°C. The reaction was terminated by the addition of 2.5 µl 10% SDS and 3 µl proteinase K (10 mg/ml) and incubated for 30 min at 37°C. The poly d(I-C) substrate was recovered by adding 72 µl of resuspension solution (40 mM Tris-HCl, pH 7.5, 10 mM NaCl, 6 mM MgCl2) and then extracting the samples with 100 µl phenol:chloroform:isoamyl alcohol (25:24:1). After a brief centrifugation, the aqueous phase was removed and transferred to another tube containing 30 µl 1 M NaOH. The sample was incubated for 1 h at 37°C to degrade any RNA. After the incubation, the sample was acidified by addition of 50 µl 1 M HCl. BSA (10 µg) was added as carrier, and the poly d(I-C) was precipitated overnight at 4°C after addition of 200 µl 10% trichloroacetic acid. The precipitate was collected by centrifugation for 15 min at 10 000 x g and 4°C, and the resulting pellets were washed twice with 100 µl cold 10% trichloroacetic acid. After washing, the pellets were resuspended in 30 µl 1 N NaOH, then mildly acidified with 40 µl 1 N HCl. The samples were then subjected to liquid scintillation counting using a Beckman (Palo Alto, CA) LS 6500. Background values (no poly d[I-C]) were subtracted from corresponding experimental samples.

Immunocytochemical Localization of Dnmt1

The zona pellucida was removed from embryos at different stages of development by a brief treatment (15–20 sec) in acid Tyrode's (pH 2.5), followed by several washes in PBS containing 3 mg/ml BSA. The embryos were fixed in freshly prepared 3.7% paraformaldehyde for 1 h at 4°C. After fixation, embryos were washed twice in PBS containing 3 mg/ml PVP and then permeabilized in 20 µl 0.1% Triton X-100/PBS for 15 min at room temperature in a humidified container. All subsequent steps were performed at room temperature in a humidified container. The embryos were transferred through two 20-µl drops of PBS/PVP and then transferred into a 20-µl drop of blocking solution (BS: 0.1% BSA, 0.01% Tween 20 in PBS) for 15 min. The fixed and permeabilized embryos were incubated with 20 µl of the anti-DNA methyltransferase antibody (1:1000) for 1 h; the anti-DNA methyltransferase antibody was a generous gift of Dr. T. Bestor (Department of Genetics and Development, Columbia University, New York, NY). Embryos were washed in 20-µl drops BS (4 times, 15 min each) and incubated for 1 h with Texas Red-conjugated goat anti-rabbit IgG (1:500) (Jackson Immunoresearch Laboratories, West Grove, PA). Embryos were washed 3 times in BS (15 min per wash) and mounted on slides in VectaShield (Vector Laboratories, Burlingame, CA). Fluorescence was visualized with a Leica (Milton Keynes, Bucks, UK) TCS NT laser-scanning confocal microscope using an ArKr laser.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Temporal and Spatial Pattern of H19 Expression in Preimplantation Mouse Embryos

H19 is expressed from the maternal allele during all stages of embryonic development, including the blastocyst stage [19, 23]. Biallelic expression, however, has been reported in embryos [27] and embryonic stem cells experimentally manipulated by in vitro culture conditions, suggesting that the H19 imprint may be unstable during early stages of development. To determine the effect of in vitro culture on imprinting, H19 expression and methylation were assessed after culture of embryos to the blastocyst stage. Before initiating studies on the regulation of H19 expression in the preimplantation mouse embryo, however, it was first important to define the temporal and spatial pattern of H19 expression, since previous analyses have been ambiguous. Several studies employing RT-PCR methods failed to detect H19 expression in either fully grown germinal vesicle-intact oocytes or blastocysts [37, 38]. In contrast, others have detected H19 expression in the 4.5-day blastocyst by either in situ hybridization [39] or RT-PCR [19]. One possible explanation for these discordant results is that H19 is poorly expressed during preimplantation development. To resolve the ambiguity of these data and to determine the temporal and spatial pattern of H19 expression in the preimplantation embryo, we used an RT-PCR assay that permits quantification of the relative changes in transcript abundance [34]. Very little, if any, maternal H19 transcripts were contained in oocytes, ovulated eggs, or 1-cell embryos (Fig. 2A). Concomitant with the activation of the embryonic genome at the 2-cell stage [40], a small increase in H19 transcript abundance was observed. The major increase, however, occurred between the 8-cell and blastocyst stages.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 2. Temporal and spatial pattern of H19 expression during preimplantation development in vivo. A) H19 was expressed maximally at the blastocyst stage during preimplantation development. Data are expressed relative to the blastocyst stage (BL). Signals obtained for the oocyte, egg, and 1-cell (1-C) embryo were essentially at the limits of detection. B) H19 expression was trophoblast specific. ICM were obtained by immunosurgery of blastocysts that developed in vivo. RT-PCR analysis failed to detect expression of H19 in ICM in contrast to blastocysts (BL), where an amplification product was obtained. By deduction, H19 expression is restricted to the trophectoderm. 2-C, 2-Cell embryo; 8-C, 8-cell embryo. The oocytes, ovulated eggs, or embryos were collected directly from the female mice and immediately transferred to lysis buffer

To determine the spatial pattern of H19 expression at the blastocyst stage, an RT-PCR assay on immunodissected embryos was performed (Fig. 2B). Since essentially no signal was obtained with immunosurgically isolated ICM cells whereas a signal was detected from intact blastocysts, we deduced that H19 expression is likely limited to the trophectoderm of mid-blastocyst embryos (32–40 cells). The absence of a signal for H19 in the ICM could not be attributed to RT-PCR failure, since as part of the RT-PCR assay [34] exogenously added ß-globin mRNA was included and served as a control for the RT and PCR reaction efficiencies. In addition, cell numbers for ICM and intact blastocysts were equalized prior to RT as described in Brison and Schultz [41]. These results are in agreement with in situ hybridization studies showing that H19 is preferentially expressed in the trophectoderm of the blastocyst [39]. Moreover, the much higher degree of sensitivity of the RT-PCR method, when compared to in situ hybridization, indicates that H19 expression in the blastocyst is exclusively restricted to the trophectoderm. Thus, the temporal and spatial expression analyses indicate that H19 expression initiates by the mid-blastocyst stage and is trophectoderm specific.

Effect of Culture Conditions on H19 Expression

The experiments described above established the expression pattern of H19 in the in vivo preimplantation embryo. To determine the lability of the gametic imprint at this locus we employed a system that has been previously demonstrated to perturb gene expression in the preimplantation mouse embryo, namely in vitro culture conditions. For example, culture of embryos in commonly used media such as Whitten's medium results in developmental rates that are retarded when compared to those of embryos that develop in vivo. These embryos show reduced levels of expression of many genes that have been analyzed [32]. Simplex optimization has led to the development of the medium KSOM containing amino acids that supports preimplantation development in vitro at rates superior to those obtained with commonly used media such as Whitten's medium [42]. Moreover, for every gene analyzed to date, the levels of transcript abundance are not statistically different from those of embryos that develop in vivo [32]. The effect of culture conditions, however, on maintenance of imprinted gene expression has not been studied. Accordingly, we examined the expression of H19 in embryos cultured in either Whitten's medium or KSOM+AA.

In these experiments, 2-cell embryos derived from either a B6(CAST-H19) x B6 or a B6(CAST 727–71) x B6 cross were flushed from the oviducts and then cultured to the blastocyst stage in either Whitten's medium or KSOM+AA. In contrast to findings for in vivo-derived blastocysts, in which essentially no paternal H19 expression was detected, culture of embryos in Whitten's medium resulted in biallelic expression of H19 (Fig. 3). Quantification of results from a series of experiments indicated that paternal expression constituted 40% ± 6% (mean ± SEM, n = 7) of the total H19 expression after culture in Whitten's medium. In two of these experiments, paternal expression represented only about 20% of total H19 expression, while in the remaining five, the paternal allele contributed 48% ± 4% of total H19 expression. H19 expression was not detected in immunosurgically isolated ICM from blastocysts that had been cultured in Whitten's medium (data not shown), indicating that biallelic H19 expression was likely restricted to the trophectoderm.

In contrast, after culture in KSOM+AA, only 10% ± 3% (n = 3) of H19 expression was derived from the paternal allele. Thus, while culture in Whitten's medium resulted in biallelic expression, culture in KSOM+AA more closely approximated the in vivo situation, although a low level of paternal expression was detected.

Effect of Culture on Methylation of the H19 Gene

To ascertain whether the loss-of-imprinting that occurred after culture in Whitten's medium was correlated with loss of methylation within the region hypothesized to confer the imprinting mark [14], we assessed the methylation status of DNA at the HhaI site 5 (indicated by Hh5 of the top line in Fig. 1) that resides in this 2-kb domain. We previously demonstrated that this site is differentially methylated in blastocyst stage embryos [19, 23]. After culture from the 2-cell stage to the blastocyst stage in either Whitten's medium or KSOM+AA, blastocyst DNA was digested with PvuII (cuts outside the region of interest) and the methylation-sensitive restriction endonuclease HhaI. If the DNA is methylated, the methylation-sensitive enzyme is unable to digest the DNA, and PCR of this region with flanking primers yields a product. If the cytosine residue is unmethylated, however, the DNA is cleaved and subsequent PCR of this region does not yield an amplification product.

Results of these experiments indicated that little, if any, of the diagnostic PCR amplicon was detected when the embryos were cultured in Whitten's medium, whereas this amplicon was readily detected when the embryos were cultured in KSOM+AA (Fig. 4A). Thus, culture in Whitten's medium resulted in a significant loss of methylation at this site, presumably on the normally methylated paternal allele. To verify this conclusion, SSCP analysis of the DNA was conducted. As anticipated, after restriction with HhaI, the paternal allele was not detected for embryos cultured in Whitten's medium (Fig. 4B, lane 2) but was detected for embryos cultured in KSOM+AA (Fig. 4B, lane 4); little if any of the hypomethylated maternal allele was detected, as anticipated. Thus, culture of embryos in Whitten's medium resulted in both loss-of-imprinting and loss of DNA methylation in the putative imprinting control domain on the paternal allele. In contrast, both maternal (essentially) monoallelic H19 expression and retention of methylation on the paternal allele were observed after culture in KSOM+AA.



View larger version (73K):
[in this window]
[in a new window]
 
FIG. 4. Effect of culture on methylation of the Hh5 site located in the upstream region of the H19 gene. A) DNA from B6(CAST-H19) x B6 F1 hybrid embryos was digested with PvuII (Pvu) that cuts outside of the region of interest, or with PvuII and HhaI (Hha), a methylation-sensitive restriction enzyme. PCR amplification was then performed with primers that flank the Hh5 site (see Fig. 1). Embryos cultured in Whitten's medium (WM) produced very little amplification product after restriction with HhaI (lane 2), indicating that DNA from these embryos was unmethylated. The presence of a PCR product in lane 4 indicates that DNA from KSOM+AA cultured embryos (KSOM) was methylated. B) SSCP analysis to determine the parental origin of methylation of samples shown in A. After restriction with HhaI, the paternal allele was not detected for embryos cultured in Whitten's medium (lane 2). For embryos cultured in KSOM+AA, the vast majority of methylation occurred on the paternal allele, while the maternal allele was relatively hypomethylated (lane 4). Open arrow, H19 amplicon derived from the paternal B6 allele; closed arrow, H19 amplicon derived from the maternal CAST allele

Effect of Culture Conditions on Dnmt1 Activity and Localization

To determine whether loss-of-imprinting and changes in methylation resulted from a general effect of culture conditions on DNA methyltransferase, we assayed DNA methyltransferase activity in in vitro-cultured embryos. In vivo, the amount of DNA methyltransferase activity decreases throughout preimplantation development when expressed as the amount of activity per cell [36]; the total amount of DNA methyltransferase activity remains constant until the 8-cell stage, after which it decreases. Since gene expression can be perturbed in in vitro-cultured embryos, a disproportionate decrease in DNA methyltransferase activity in embryos cultured in Whitten's medium when compared to embryos cultured in KSOM+AA could result in the inability of Whitten's-cultured embryos to maintain levels of DNA methylation sufficient to support monoallelic H19 expression.

In vivo- and in vitro-derived embryos were isolated and assayed for DNA methyltransferase activity using [3H-methyl]S-adenosylmethionine as the methyl donor. When compared to embryos that develop in vivo, embryos cultured in either KSOM+AA or Whitten's medium displayed similar decreases in DNA methyltransferase activity (Fig. 5). While the difference in activity between embryos cultured in Whitten's medium and KSOM+AA was significant (P < 0.01, ANOVA), the magnitude of the decrease was very similar. Moreover, when the data were expressed on a per cell basis, the activity per cell was virtually identical.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 5. Developmental changes in DNA methyltransferase activity during preimplantation development. Two-cell to blastocyst stage embryos were collected after development in vivo or in either KSOM+AA (KSOM) or Whitten's medium (WM). Cultured embryos displayed the same developmental pattern of DNA methyltransferase activity as in vivo-derived embryos. Data are expressed as either cpm per embryo (A) or cpm per cell (B). Morulae possessed 24 cells while blastocysts contained 64.5 cells. Two to three groups of 5 embryos each were assayed per experiment, three times. Data are expressed as the mean ± SEM. In several instances the error bars are too small to be observed. 2-C, 2-Cell embryo; M, morula; BL, blastocyst. Cell number was determined by DAPI staining as previously described [62]

The DNA methyltransferase, Dnmt1, that is responsible for the bulk of DNA methylation displays a remarkable stage-specific change in intracellular distribution during preimplantation development [43]. Between the 1-cell and 8-cell stages, the enzyme is predominantly located in the cytoplasm. During the 8-cell stage, the enzyme is preferentially located in the nucleus; but by the morula stage, the enzyme is again located predominantly in the cytoplasm. Although the molecular basis for these changes and the biological sequelae are not known, we found similar temporal and spatial changes in Dnmt1 localization in embryos cultured in KSOM+AA or Whitten's medium (Fig. 6). In conclusion, results of these DNA methyltransferase experiments suggest that the loss of H19 imprinting that occurs following culture in Whitten's medium is unlikely a simple consequence of insufficient levels of DNA methyltransferase activity or inappropriate changes in the spatial localization of Dnmt1 in these cultured embryos.



View larger version (62K):
[in this window]
[in a new window]
 
FIG. 6. Stage-specific changes in the intracellular localization of Dnmt1 protein during preimplantation development. After culture, embryos were subjected to immunocytochemistry with antibodies highly specific to the Dnmt1 protein; e.g., omission of the primary antibody results in little staining above background [43]. Whether cultured in Whitten's medium or KSOM+AA, embryos displayed the same transient nuclear localization of Dnmt1 protein during the 8-cell (8C) stage, which was similar to the pattern described for in vivo-derived embryos. Shown are a series of representative laser-scanning confocal images

Effect of Culture Conditions on Snrpn Expression

It was also possible that the suboptimal culture conditions confronted by embryos in Whitten's medium could, in principle, result from a global loss-of-imprinting. Accordingly, we examined whether loss-of-imprinting of another imprinted gene, Snrpn, occurred after culture in Whitten's medium. The Snrpn gene is expressed from the paternal genome starting at the 4-cell stage [35]. Using the same conditions we had previously employed to study in vitro culture effects on H19 imprinting, we determined that after culture from the 2-cell stage to the blastocyst, Snrpn was expressed exclusively from the paternal allele when the embryos were cultured in either Whitten's medium or KSOM+AA (Fig. 7). As anticipated, loss-of-imprinting of H19 was observed in the embryos cultured in Whitten's medium, but not when they were cultured in KSOM+AA. Thus, the genomic imprint governing the expression of the Snrpn gene does not appear to show the same lability as that controlling the expression of the H19 gene.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The results described here support previous experiments suggesting that methylation of the H19 gene is crucial for imprinted expression [14, 19, 26]. Embryos cultured in Whitten's medium experience both a loss-of-imprinting and a reduction in the methylation of a CpG dinucleotide in the hypothesized imprinting control domain located upstream from the start of H19 transcription. In contrast, embryos cultured in KSOM+AA express H19 predominantly from the maternal allele and are methylated on the paternal allele, thereby approximating in vivo conditions. It is possible, however, that biallelic expression of H19 after culture in Whitten's medium is a consequence of a reduction in the molecules that recognize the H19 imprint mark. The loss-of-imprinting observed in Whitten's medium is unlikely attributable to a global decrease in DNA methylation, since DNA methyltransferase activity levels are similar in in vivo-derived embryos and embryos cultured in KSOM+AA or Whitten's medium. Furthermore, the analysis of another imprinted gene, Snrpn, shows that imprinting is maintained at this locus during culture in Whitten's medium. We therefore propose that the imprinting of the H19 gene is hypersensitive to environmental conditions.

The lability of the H19 imprint is not surprising given the results of previous experiments demonstrating that its imprint is more sensitive to changes in DNA methylation levels than other imprinted genes. Mice harboring mutations at the endogenous Dnmt1 locus have been used to assess the importance of methylation in embryonic growth as well as genomic imprinting [26, 44]. Mice with the less severe Dnmt1n/n mutation have approximately 30% of the wild-type levels of genomic DNA methylation and die later than mice with the more severe Dnmt1s/s mutation. Mice homozygous for the less severe mutation show a loss-of-imprinting for the H19 gene but maintain appropriate imprinting of the Igf2r and p57Kip2 genes [26, 45]. In contrast, all three genes are affected in the more severe Dnmt1s/s background [10, 26]. Like H19, the Kvlqt1 gene is affected in both strains, but a more dramatic change in expression is observed in Dnmt1s/s mice [10, 45].

H19 imprinting also appears more sensitive to in vitro manipulations than other imprinted genes. The best example of this is seen in the work of Sasaki and colleagues, who were the first to show that in vitro-fertilized and cultured mouse embryos experience a loss in H19 imprinting when compared to in vivo-derived embryos [27]. In a recent study on the ability of mouse spermatid nuclei to initiate a normal developmental program when injected into mouse oocytes, Shamanski and colleagues [46] determined that five imprinted genes, including Snrpn and Igf2, are appropriately imprinted in midgestation embryonic and extraembryonic tissues. In contrast, the normally repressed paternal H19 allele is expressed in extraembryonic but not embryonic tissues. Unfortunately, this study did not examine the allelic methylation patterns of H19. It is unlikely, however, that the derepression of the paternal H19 allele results from incomplete methylation of round spermatid DNA, since we have determined the H19 methylation patterns of round spermatid DNA to be identical to that of mature spermatozoa [47]. Rather, these results are consistent with a greater sensitivity of H19 to in vitro manipulation. Interestingly, in this case, the extraembryonic tissues appear more sensitive to perturbations than embryonic tissues. For blastocysts that develop in Whitten's medium, the aberrant paternal H19 expression appears restricted to the trophectoderm cells where H19 is normally expressed, since no H19 expression is detected in the inner mass cells.

Importantly, previous studies in mice have suggested that in vitro culture and manipulation of eggs and preimplantation embryos can lead to reduced viability and growth, as well as developmental abnormalities [4850]. Where analyzed, these defects are linked to epigenetic changes in the embryo [49, 50]. For example, Dean and colleagues [49] found that developmentally compromised fetuses derived exclusively from the culture of embryonic stem cells exhibited perturbations in the expression and methylation patterns of four imprinted genes, including H19. Furthermore, in one case, the phenotypic abnormalities were transmitted to the progeny of the manipulated parental mice, suggesting that some epigenetic changes could be stably propagated through the germline [51].

Epigenetic changes can also occur as a result of genotypic background and can affect such processes as gene expression, methylation, and development. For example, Latham and Solter [52] determined that androgenones produced with fertilized C57BL/6 eggs formed blastocysts much more efficiently than those produced with DBA/2 eggs. Poor development in the latter has been linked to two independently segregating DBA/2 loci [53]. Genotype has also been shown to affect the imprinting and methylation of exogenous DNA in transgenic mice [5456]. In one study, DBA/2 and 129 genetic backgrounds enhanced expression of a lacZ transgene while expression of this same transgene was suppressed and its DNA hypermethylated following the maternal inheritance of a BALB/c strain-specific modifier [54]. We too have noted an effect of genotype on H19 imprinting in Whitten's in vitro-cultured embryos. While we have observed that embryos derived from a CAST female and B6 male displayed a loss of H19 imprinting when cultured in Whitten's medium, embryos produced by the reciprocal mating appropriately imprinted H19 under identical conditions (data not shown). Since the CAST strains that we used in this study have portions of a M. musculus castaneus chromosome 7 on a mixed C57BL/6J and M. musculus castaneus background, it is possible that strain-specific modifiers are affecting the maintenance of the H19 imprint.

The results presented here may also have bearing on the strange phenomenon known as large calf syndrome, as well as on the clinical practice of assisted reproduction. Culture of bovine and ovine embryos to the blastocyst stage prior to embryo transfer results in a greater fraction of offspring with a significant increase in birth weight, as well as in higher incidences of fetal and perinatal loss ([57] and references therein). In cattle, these abnormalities are not observed if the embryos are first transferred to the oviducts of sheep and then transferred at the blastocyst stage to the reproductive tracts of recipient heifers [58]. Thus, these abnormalities are likely attributable to embryo culture. Since the culture conditions are most likely suboptimal for these species, loss-of-imprinting of specific genes may occur during the culture period and could, in principle, contribute to the observed differences in birth weight, as well as fetal and postnatal loss. Of note is that certain human syndromes suffering a loss-of-imprinting, such as Beckwith-Wiedemann syndrome, are characterized by pre- and postnatal organ overgrowth [59].

Currently, human embryos are usually cultured for short periods prior to transfer to the mother. It is most likely, however, that with advances in assisted reproductive technologies (ART) (e.g., preimplantation genetic diagnosis), embryos will be cultured for much longer periods prior to transfer to the mother. For example, the incidence of aneuploidy markedly increases in women 40+ yr of age [60]. Thus, embryos derived from women in this age group will likely be scrutinized routinely for aneuploidy to ensure that only embryos containing a normal chromosome complement are returned to the mother. Such genetic diagnosis will entail much longer periods of embryo culture prior to transfer to the mother than are currently employed. Moreover, there is an increasing trend in ART practices to culture embryos for longer periods for later-stage embryo transfer, with the assumption that embryos that have developed further are of "higher quality" [61]. Although it is not known whether loss-of-imprinting occurs during culture of human preimplantation embryos or whether such a loss-of-imprinting results in embryos that are developmentally compromised, our results do provide a strong cautionary note for such a practice.

In summary, our finding that culture conditions can dramatically, but selectively, affect the expression of imprinted genes provides a model system to study further the regulation of imprinted expression of H19. For example, this system is currently being exploited to assess the linkage between the extent of DNA hypomethylation of the differentially methylated domain and expression of the appropriate H19 allele. In addition, the results of these experiments raise several obvious questions: is the appropriate monoallelic maternal expression of H19 reestablished after implantation, and if so, what is the methylation status of the differentially methylated domain? Are blastocysts that display loss-of-imprinting compromised with respect to their ability to implant and develop to term? Questions such as these are also under current investigation.


    FOOTNOTES
 
First decision: 7 January 2000.

1 This research was supported by grants from the NIH (HD 22681 to R.M.S. and GM 51279 to M.S.B.). K.D.T. was supported by U.S. Public Service training grant GM07229. M.R.W.M. was supported by a grant from the Lalor Foundation. M.S.B. is an assistant investigator of the Howard Hughes Medical Institute. Back

2 Correspondence: Richard Schultz, Department of Biology, University of Pennsylvania, 415 South University Avenue, Philadelphia, PA 19104-6018. FAX: 215 898 8780; rschultz{at}sas.upenn.edu Back

3 Current address: Department of Molecular and Cellular Biology, Harvard University, The Biological Laboratories, Cambridge, MA 02138. Back

Accepted: January 10, 2000.

Received: November 22, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bartolomei MS, Tilghman SM. Genomic imprinting in mammals. Annu Rev Genet 1997; 31:493–525.[CrossRef][Medline]
  2. Constância M, Pickard B, Kelsey G, Reik W. Imprinting mechanisms. Genome Res 1998; 8:881–900.[Abstract/Free Full Text]
  3. Moulton T, Crenshaw T, Hao Y, Moosikasuwan J, Lin N, Dembitzer F, Hensle T, Weiss L, McMorrow L, Loew T, Kraus W, Gerald W, Tycko B. Epigenetic lesions at the H19 locus in Wilms' tumour patients. Nat Genet 1994; 7:440–447.[CrossRef][Medline]
  4. Ogawa O, Eccles MR, Szeto J, McNoe LA, Yun K, Maw MA, Smith PJ, Reeve AE. Relaxation of insulin-like growth factor II gene imprinting implicated in Wilms' tumour. Nature 1993; 362:749–751.[CrossRef][Medline]
  5. Rainier S, Johnson LA, Dobry CJ, Ping AJ, Grundy PE, Feinberg AP. Relaxation of imprinted genes in human cancer. Nature 1993; 362:747–749.[CrossRef][Medline]
  6. Reis A, Dittrich B, Greger V, Buiting K, Lalande M, Gillessen-Kaesbach G, Anvret M, Horsthemke B. Imprinting mutations suggested by abnormal DNA methylation patterns in familial Angelman and Prader-Willi syndromes. Am J Hum Genet 1994; 54:741–747.[Medline]
  7. Sutcliffe JS, Nakao M, Christian S, Orstavik KH, Tommerup N, Ledbetter DH, Beaudet AL. Deletions of a differentially methylated CpG island at the SNRPN gene define a putative imprinting control region. Nat Genet 1994; 8:52–58.[CrossRef][Medline]
  8. Bartolomei MS, Zemel S, Tilghman SM. Parental imprinting of the mouse H19 gene. Nature 1991; 351:153–155.[CrossRef][Medline]
  9. Brannan CI, Dees EC, Ingram RS, Tilghman SM. The product of the H19 gene may function as an RNA. Mol Cell Biol 1990; 10:28–36.[Abstract/Free Full Text]
  10. Caspary T, Cleary MA, Baker CC, Guan X-J, Tilghman SM. Multiple mechanisms regulate imprinting of the mouse distal chromosome 7 gene cluster. Mol Cell Biol 1998; 18:3466–3474.[Abstract/Free Full Text]
  11. Paulsen M, Davies KR, Bowden LM, Villar AJ, Franck O, Dean WL, Moore TF, Rodrigues N, Davies KE, Hu R-J, Feinberg AP, Maher ER, Reik W, Walter J. Syntenic organization of the mouse distal chromosome 7 imprinting cluster and the Beckwith-Wiedemann syndrome region in chromosome 11p15.5. Hum Mol Genet 1998; 7:1149–1159.[Abstract/Free Full Text]
  12. Leighton PA, Ingram RS, Eggenschwiler J, Efstratiadis A, Tilghman SM. Disruption of imprinting caused by deletion of the H19 gene region in mice. Nature 1995; 375:34–39.[CrossRef][Medline]
  13. Leighton PA, Saam JR, Ingram RS, Stewart CL, Tilghman SM. An enhancer deletion affects both H19 and Igf2 expression. Genes Dev 1995; 9:2079–2089.[Abstract/Free Full Text]
  14. Thorvaldsen JL, Duran KL, Bartolomei MS. Deletion of the H19 differentially methylated domain results in loss of imprinted expression of H19 and Igf2. Genes Dev 1998; 12:3693–3702.[Abstract/Free Full Text]
  15. Hark AT, Tilghman SM. Chromatin conformation of the H19 epigenetic mark. Hum Mol Genet 1998; 7:1979–1985.[Abstract/Free Full Text]
  16. Khosla S, Aitchison A, Gregory R, Allen ND, Feil R. Parental allele-specific chromatin configuration in a boundary/imprinting-control element upstream of the mouse H19 gene. Mol Cell Biol 1999; 19:2556–2566.[Abstract/Free Full Text]
  17. Kitsberg D, Selig S, Brandeis M, Simon I, Keshet I, Driscoll DJ, Nicholls RD, Cedar H. Allele-specific replication timing of imprinted gene regions. Nature 1993; 364:459–463.[CrossRef][Medline]
  18. Szabó PE, Pfeifer GP, Mann JR. Characterization of novel parent-specific epigenetic modifications upstream of the imprinted mouse H19 gene. Mol Cell Biol 1998; 18:6767–6776.[Abstract/Free Full Text]
  19. Tremblay KD, Saam JR, Ingram RS, Tilghman SM, Bartolomei MS. A paternal-specific methylation imprint marks the alleles of the mouse H19 gene. Nat Genet 1995; 9:407–413.[CrossRef][Medline]
  20. Bartolomei MS, Webber AL, Brunkow ME, Tilghman SM. Epigenetic mechanisms underlying the imprinting of the mouse H19 gene. Genes Dev 1993; 7:1663–1673.[Abstract/Free Full Text]
  21. Brandeis M, Kafri T, Ariel M, Chaillet JR, McCarrey J, Razin A, Cedar H. The ontogeny of allele-specific methylation associated with imprinted genes in the mouse. EMBO J 1993; 12:3669–3677.[Medline]
  22. Ferguson-Smith AS, Sasaki H, Cattanach BM, Surani MA. Parental-origin-specific epigenetic modification of the mouse H19 gene. Nature 1993; 362:751–754.[CrossRef][Medline]
  23. Tremblay KD, Duran KL, Bartolomei MS. A 5' 2-kilobase-pair region of the imprinted mouse H19 gene exhibits exclusive paternal methylation throughout development. Mol Cell Biol 1997; 17:4322–4329.[Abstract]
  24. Jones PL, Veenstra GJC, Wade PA, Vermaak D, Kass SU, Landsberger N, Strouboulis J, Wolffe AP. Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription. Nature Genet 1998; 19:187–191.[CrossRef][Medline]
  25. Nan X, Ng H-H, Johnson CA, Laherty CD, Turner BM, Eisenman RN, Bird A. Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature 1998; 393:386–389.[CrossRef][Medline]
  26. Li E, Beard C, Jaenisch R. Role for DNA methylation in genomic imprinting. Nature 1993; 366:362–365.[CrossRef][Medline]
  27. Sasaki H, Ferguson-Smith AC, Shum ASW, Barton SC, Surani MA. Temporal and spatial regulation of H19 imprinting in normal and uniparental mouse embryos. Development 1995; 121:4195–4202.[Abstract]
  28. Schultz RM, Montgomery RR, Belanoff JR. Regulation of mouse oocyte maturation: Implication of a decrease in oocyte cAMP and protein dephosphorylation in commitment to resume meiosis. Dev Biol 1983; 97:264–273.[CrossRef][Medline]
  29. Evans JP, Schultz RM, Kopf GS. Fertilization of mouse eggs: Implication of egg integrins and the mouse sperm homologue of PH-30 (fertilin) ß sperm-egg plasma membrane interactions. J Cell Sci 1995; 108:3267–3278.[Abstract]
  30. Manejwala F, Kaji E, Schultz RM. Development of activatable adenylate cyclase in the preimplantation mouse embryo and a role for cyclic AMP in blastocoel formation. Cell 1986; 46:95–103.[CrossRef][Medline]
  31. Whitten WK. Nutrient requirements for the culture of preimplantation mouse embryo in vitro. Adv Biosci 1971; 6:129–139.
  32. Ho Y, Wigglesworth K, Eppig JE, Schultz RM. Preimplantation development of mouse embryos in KSOM: augmentation by amino acids and analysis of gene expression. Mol Reprod Dev 1995; 41:232–238.[CrossRef][Medline]
  33. Solter D, Knowles BB. Immunosurgery of mouse blastocyst. Proc Natl Acad Sci USA 1975; 72:5099–5102.[Abstract/Free Full Text]
  34. Temeles GL, Ram PT, Rothstein JL, Schultz RM. Expression patterns of novel genes during mouse preimplantation embryogenesis. Mol Reprod Dev 1994; 37:121–129.[CrossRef][Medline]
  35. Szabó PE, Mann JR. Allele-specific expression and total expression levels of imprinted genes during early mouse development: implications for imprinting mechanisms. Genes Dev 1995; 9:3097–3108.[Abstract/Free Full Text]
  36. Monk M, Adams RLP, Rinaldi A. Decrease in DNA methylase activity during preimplantation development in the mouse. Development 1991; 112:189–192.[Abstract]
  37. Villar AJ, Eddy EM, Pedersen RA. Developmental regulation of genomic imprinting during gametogenesis. Dev Biol 1995; 172:264–271.[CrossRef][Medline]
  38. Szabó P, Mann JR. Expression and methylation of imprinted genes during in vitro differentiation of mouse parthenogenetic and androgenetic embryonic stem cell lines. Development 1994; 120:1651–1660.[Abstract]
  39. Poirier F, Chan CTJ, Timmons PM, Robertson EJ, Evans MJ, Rigby PW. The murine H19 gene is activated during embryonic stem cell differentiation in vitro and at the time of implantation in the developing embryo. Development 1991; 113:1105–1114.[Abstract]
  40. Schultz RM. Regulation of zygotic gene activation in the mouse. Bioessays 1993; 15:531–538.[CrossRef][Medline]
  41. Brison DR, Schultz RM. RT-PCR-based method to localize the spatial expression of genes in the mouse blastocyst. Mol Reprod Dev 1996; 44:171–178.[CrossRef][Medline]
  42. Erbach GT, Lawitts JA, Papaioannou VE, Biggers JD. Differential growth of the mouse preimplantation embryo in chemically defined media. Biol Reprod 1994; 50:1027–1033.[Abstract]
  43. Carlson LL, Page AW, Bestor TH. Properties and localization of DNA methyltransferase in preimplantation mouse embryos: implications for genomic imprinting. Genes Dev 1992; 6:2536–2541.[Abstract/Free Full Text]
  44. Li E, Bestor TH, Jaenisch R. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 1992; 69:915–926.[CrossRef][Medline]
  45. Dao D, Walsh CP, Yuan L, Gorelov D, Feng L, Hensle T, Nisen P, Yamashiro DJ, Bestor TH, Tycko B. Multipoint analysis of human chromosome 11p15/mouse distal chromosome 7: inclusion of H19/IGF2 in the minimal WT2 region, gene specificity of H19 silencing in Wilms' tumorigenesis and methylation hyper-dependence of H19 imprinting. Hum Mol Genet 1999; 8:1337–1352.[Abstract/Free Full Text]
  46. Shamanski FL, Kimura Y, Lavoir M-C, Pedersen RA, Yanagimachi R. Status of genomic imprinting in mouse spermatids. Hum Reprod 1999; 14:1050–1056.[Abstract/Free Full Text]
  47. Davis TL, Trasler JM, Moss SB, Yang GJ, Bartolomei MS. Acquisition of the H19 methylation imprint occurs differentially on the parental alleles during spermatogenesis. Genomics 1999; 58:18–28.[CrossRef][Medline]
  48. Bowman P, McLaren A. Viability and growth of mouse embryos after in vitro culture and fusion. J Embryol Exp Morphol 1970; 23:693–704.[Medline]
  49. Dean W, Bowden L, Aitchison A, Klose J, Moore T, Meneses JJ, Reik W, Feil R. Altered imprinted gene methylation and expression in completely ES cell-derived mouse fetuses: association with aberrant phenotypes. Development 1998; 125:2273–2282.[Abstract]
  50. Reik W, Romer I, Barton SC, Surani MA, Howlett SK, Klose J. Adult phenotype in the mouse can be affected by epigenetic events in the early embryo. Development 1993; 119:933–942.[Abstract]
  51. Roemer I, Reik W, Dean W, Klose J. Epigenetic inheritance in the mouse. Curr Biol 1997; 7:277–280.[CrossRef][Medline]
  52. Latham KE, Solter D. Effect of egg composition on the developmental capacity of androgenetic mouse embryos. Development 1991; 113:561–568.[Abstract]
  53. Latham KE. Strain-specific differences in mouse oocytes and their contributions to epigenetic inheritance. Development 1994; 120:3419–3426.[Abstract]
  54. Allen ND, Norris ML, Surani MA. Epigenetic control of transgene expression and imprinting by genotype-specific modifiers. Cell 1990; 61:853–861.[CrossRef][Medline]
  55. Sapienza C, Paquette J, Tran TH, Peterson A. Epigenetic and genetic factors affect transgene methylation imprinting. Development 1989; 107:165–168.[Abstract]
  56. Sasaki H, Hamada T, Ueda T, Seki R, Higashinakagawa T, Sakaki Y. Inherited type of allelic methylation variations in a mouse chromosome region where an integrated transgene shows methylation imprinting. Development 1991; 111:573–581.[Abstract]
  57. Walker SK, Hartwich KM, Seamark RF. The production of unusually large offspring following embryo manipulation: concepts and challenges. Theriogenology 1996; 45:110–120.
  58. Behboodi E, Anderson GB, BonDurant RH, Cargill SL, Kreuscher BR, Medrano JF, Murray JD. Birth of large calves that developed from in vitro-derived bovine embryos. Theriogenology 1995; 44:227–232.
  59. Junien C. Beckwith-Wiedemann syndrome, tumourigenesis and imprinting. Curr Opin Genet Dev 1992; 2:431–438.[CrossRef][Medline]
  60. Hassold T, Hunt PA, Sherman S. Trisomy in humans: incidence, origin, and etiology. Curr Opin Genet Dev 1993; 3:398–403.[CrossRef][Medline]
  61. Gardner D, Schoolcraft WB. Culture and transfer of human blastocysts. Curr Opin Ob Gyn 1999; 11:307–311.
  62. Connors SA, Kanatsu-Shinohara M, Schultz RM, Kopf GS. Involvement of the cytoskeleton in the movement of cortical granules during oocyte maturation, and cortical granule anchoring in mouse eggs. Dev Biol 1998; 200:103–115.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Hum Mol GenetHome page
C. Li, Z. Chen, Z. Liu, J. Huang, W. Zhang, L. Zhou, D. L. Keefe, and L. Liu
Correlation of expression and methylation of imprinted genes with pluripotency of parthenogenetic embryonic stem cells
Hum. Mol. Genet., June 15, 2009; 18(12): 2177 - 2187.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
E. Goossens, M. De Rycke, P. Haentjens, and H. Tournaye
DNA methylation patterns of spermatozoa and two generations of offspring obtained after murine spermatogonial stem cell transplantation
Hum. Reprod., June 12, 2009; (2009) dep213v1.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
G. Mitsiakos, E. Giougi, C. Tsakalidis, M. Kourti, H. Chatziionnidis, P. Karagianni, E. M. Kolibianakis, and N. Nikolaidis
A case of Adams-Oliver syndrome following in vitro fertilization
Hum. Reprod., June 1, 2009; 24(6): 1529 - 1530.
[Full Text] [PDF]


Home page
Hum ReprodHome page
J.J. Eppig, M.J. O'Brien, K. Wigglesworth, A. Nicholson, W. Zhang, and B.A. King
Effect of in vitro maturation of mouse oocytes on the health and lifespan of adult offspring
Hum. Reprod., April 1, 2009; 24(4): 922 - 928.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Y. Cheng, K. Wang, L. D. Kellam, Y. S. Lee, C.-G. Liang, Z. Han, N. R. Mtango, and K. E. Latham
Effects of Ooplasm Manipulation on DNA Methylation and Growth of Progeny in Mice
Biol Reprod, March 1, 2009; 80(3): 464 - 472.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
R. Fernandez-Gonzalez, J. de Dios Hourcade, I. Lopez-Vidriero, A. Benguria, F. R. De Fonseca, and A. Gutierrez-Adan
Analysis of gene transcription alterations at the blastocyst stage related to the long-term consequences of in vitro culture in mice
Reproduction, February 1, 2009; 137(2): 271 - 283.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
D. J. Amor and J. Halliday
A review of known imprinting syndromes and their association with assisted reproduction technologies
Hum. Reprod., December 1, 2008; 23(12): 2826 - 2834.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. T. Heijmans, E. W. Tobi, A. D. Stein, H. Putter, G. J. Blauw, E. S. Susser, P. E. Slagboom, and L. H. Lumey
Persistent epigenetic differences associated with prenatal exposure to famine in humans
PNAS, November 4, 2008; 105(44): 17046 - 17049.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
R. E. Everts, P. Chavatte-Palmer, A. Razzak, I. Hue, C. A. Green, R. Oliveira, X. Vignon, S. L. Rodriguez-Zas, X. C. Tian, X. Yang, et al.
Aberrant gene expression patterns in placentomes are associated with phenotypically normal and abnormal cattle cloned by somatic cell nuclear transfer
Physiol Genomics, October 8, 2008; 33(1): 65 - 77.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
Y. S. Lee, K. E. Latham, and C. A. VandeVoort
Effects of in vitro maturation on gene expression in rhesus monkey oocytes
Physiol Genomics, October 8, 2008; 35(2): 145 - 158.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
H. D. Morgan, X. L. Jin, A. Li, E. Whitelaw, and C. O'Neill
The Culture of Zygotes to the Blastocyst Stage Changes the Postnatal Expression of an Epigentically Labile Allele, Agouti Viable Yellow, in Mice
Biol Reprod, October 1, 2008; 79(4): 618 - 623.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
R Khoureiry, S Ibala-Rhomdane, L Mery, T Blachere, J-F Guerin, J Lornage, and A Lefevre
Dynamic CpG methylation of the KCNQ1OT1 gene during maturation of human oocytes
J. Med. Genet., September 1, 2008; 45(9): 583 - 588.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
P. D. Gluckman, M. A. Hanson, C. Cooper, and K. L. Thornburg
Effect of In Utero and Early-Life Conditions on Adult Health and Disease
N. Engl. J. Med., July 3, 2008; 359(1): 61 - 73.
[Full Text] [PDF]


Home page
Genes Dev.Home page
R. Hirasawa, H. Chiba, M. Kaneda, S. Tajima, E. Li, R. Jaenisch, and H. Sasaki
Maternal and zygotic Dnmt1 are necessary and sufficient for the maintenance of DNA methylation imprints during preimplantation development
Genes & Dev., June 15, 2008; 22(12): 1607 - 1616.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. L. Fortier, F. L. Lopes, N. Darricarrere, J. Martel, and J. M. Trasler
Superovulation alters the expression of imprinted genes in the midgestation mouse placenta
Hum. Mol. Genet., June 1, 2008; 17(11): 1653 - 1665.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
A. J. Watkins, A. Wilkins, C. Cunningham, V. H. Perry, M. J. Seet, C. Osmond, J. J. Eckert, C. Torrens, F. R. A. Cagampang, J. Cleal, et al.
Low protein diet fed exclusively during mouse oocyte maturation leads to behavioural and cardiovascular abnormalities in offspring
J. Physiol., April 15, 2008; 586(8): 2231 - 2244.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
M. Toppings, C. Castro, P. H. Mills, B. Reinhart, G. Schatten, E. T. Ahrens, J. R. Chaillet, and J. M. Trasler
Profound phenotypic variation among mice deficient in the maintenance of genomic imprints
Hum. Reprod., April 1, 2008; 23(4): 807 - 818.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R. Fernandez-Gonzalez, P. N. Moreira, M. Perez-Crespo, M. Sanchez-Martin, M. A. Ramirez, E. Pericuesta, A. Bilbao, P. Bermejo-Alvarez, J. d. D. Hourcade, F. R. d. Fonseca, et al.
Long-Term Effects of Mouse Intracytoplasmic Sperm Injection with DNA-Fragmented Sperm on Health and Behavior of Adult Offspring
Biol Reprod, April 1, 2008; 78(4): 761 - 772.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Wyman, A. B. Pinto, R. Sheridan, and K. H. Moley
One-Cell Zygote Transfer from Diabetic to Nondiabetic Mouse Results in Congenital Malformations and Growth Retardation in Offspring
Endocrinology, February 1, 2008; 149(2): 466 - 469.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
R. M. Rivera, P. Stein, J. R. Weaver, J. Mager, R. M. Schultz, and M. S. Bartolomei
Manipulations of mouse embryos prior to implantation result in aberrant expression of imprinted genes on day 9.5 of development
Hum. Mol. Genet., January 1, 2008; 17(1): 1 - 14.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
A. Thurston, J. Taylor, J. Gardner, K. D Sinclair, and L. E Young
Monoallelic expression of nine imprinted genes in the sheep embryo occurs after the blastocyst stage
Reproduction, January 1, 2008; 135(1): 29 - 40.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
B Mahsoudi, A Li, and C O'Neill
Assessment of the Long-Term and Transgenerational Consequences of Perturbing Preimplantation Embryo Development in Mice
Biol Reprod, November 1, 2007; 77(5): 889 - 896.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
P. J. Rugg-Gunn, A. C. Ferguson-Smith, and R. A. Pedersen
Status of genomic imprinting in human embryonic stem cells as revealed by a large cohort of independently derived and maintained lines
Hum. Mol. Genet., October 15, 2007; 16(R2): R243 - R251.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. M. Schultz
Of light and mouse embryos: Less is more
PNAS, September 11, 2007; 104(37): 14547 - 14548.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. L. Miles, P. L. Hofman, J. Peek, M. Harris, D. Wilson, E. M. Robinson, P. D. Gluckman, and W. S. Cutfield
In Vitro Fertilization Improves Childhood Growth and Metabolism
J. Clin. Endocrinol. Metab., September 1, 2007; 92(9): 3441 - 3445.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
M. G. Hansson, G. Helgesson, R. Wessman, and R. Jaenisch
Commentary: Isolated Stem Cells--Patentable as Cultural Artifacts?
Stem Cells, June 1, 2007; 25(6): 1507 - 1510.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
A.T. Dobson, R.M. Davis, M.P. Rosen, S. Shen, P.F. Rinaudo, J. Chan, and M.I. Cedars
Methylenetetrahydrofolate reductase C677T and A1298C variants do not affect ongoing pregnancy rates following IVF
Hum. Reprod., February 1, 2007; 22(2): 450 - 456.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
E. Geuns, P. Hilven, A. Van Steirteghem, I. Liebaers, and M. De Rycke
Methylation analysis of KvDMR1 in human oocytes
J. Med. Genet., February 1, 2007; 44(2): 144 - 147.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
A. Pesty, F. Miyara, P. Debey, B. Lefevre, and C. Poirot
Multiparameter assessment of mouse oogenesis during follicular growth in vitro
Mol. Hum. Reprod., January 1, 2007; 13(1): 3 - 9.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
A. Sato, E. Otsu, H. Negishi, T. Utsunomiya, and T. Arima
Aberrant DNA methylation of imprinted loci in superovulated oocytes
Hum. Reprod., January 1, 2007; 22(1): 26 - 35.
[Abstract] [Full Text] [PDF]


Home page
NeoReviewsHome page
J. Johnson, T. Hartman, and C. E. Colby
Developmental and Genetic Outcomes in Children Conceived Through Assisted Reproductive Technologies
NeoReviews, December 1, 2006; 7(12): e615 - e626.
[Full Text] [PDF]


Home page
Biol. Reprod.Home page
D. Lucifero, J. Suzuki, V. Bordignon, J. Martel, C. Vigneault, J. Therrien, F. Filion, L. C. Smith, and J. M. Trasler
Bovine SNRPN Methylation Imprint in Oocytes and Day 17 In Vitro-Produced and Somatic Cell Nuclear Transfer Embryos
Biol Reprod, October 1, 2006; 75(4): 531 - 538.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
G. Wu, F. W. Bazer, J. M. Wallace, and T. E. Spencer
BOARD-INVITED REVIEW: Intrauterine growth retardation: Implications for the animal sciences
J Anim Sci, September 1, 2006; 84(9): 2316 - 2337.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
W. Y. Kwong, D. J Miller, E. Ursell, A. E Wild, A. P Wilkins, C. Osmond, F. W Anthony, and T. P Fleming
Imprinted gene expression in the rat embryo-fetal axis is altered in response to periconceptional maternal low protein diet.
Reproduction, August 1, 2006; 132(2): 265 - 277.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
N. Nikolettos, B. Asimakopoulos, and I. S. Papastefanou
Intracytoplasmic Sperm Injection-An Assisted Reproduction Technique That Should Make Us Cautious About Imprinting Deregulation
Reproductive Sciences, July 1, 2006; 13(5): 317 - 328.
[Abstract] [PDF]


Home page
J. Physiol.Home page
D. Feil, M. Lane, C. T. Roberts, R. L. Kelley, L. J. Edwards, J. G. Thompson, and K. L. Kind
Effect of culturing mouse embryos under different oxygen concentrations on subsequent fetal and placental development
J. Physiol., April 1, 2006; 572(1): 87 - 96.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
L. Armstrong, M. Lako, W. Dean, and M. Stojkovic
Epigenetic Modification Is Central to Genome Reprogramming in Somatic Cell Nuclear Transfer
Stem Cells, April 1, 2006; 24(4): 805 - 814.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
A. Fujimoto, S. M. Mitalipov, H.-C. Kuo, and D. P. Wolf
Aberrant Genomic Imprinting in Rhesus Monkey Embryonic Stem Cells
Stem Cells, March 1, 2006; 24(3): 595 - 603.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. L. Thorvaldsen, A. M. Fedoriw, S. Nguyen, and M. S. Bartolomei
Developmental Profile of H19 Differentially Methylated Domain (DMD) Deletion Alleles Reveals Multiple Roles of the DMD in Regulating Allelic Expression and DNA Methylation at the Imprinted H19/Igf2 Locus
Mol. Cell. Biol., February 15, 2006; 26(4): 1245 - 1258.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
D. L. Zander, J. G. Thompson, and M. Lane
Perturbations in Mouse Embryo Development and Viability Caused by Ammonium Are More Severe after Exposure at the Cleavage Stages
Biol Reprod, February 1, 2006; 74(2): 288 - 294.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
B. W. Sun, A. C. Yang, Y. Feng, Y. J. Sun, Y. f. Zhu, Y. Zhang, H. Jiang, C. L. Li, F. R. Gao, Z. H. Zhang, et al.
Temporal and parental-specific expression of imprinted genes in a newly derived Chinese human embryonic stem cell line and embryoid bodies
Hum. Mol. Genet., January 1, 2006; 15(1): 65 - 75.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K.-F. Lee, J.-S. Xu, Y.-L. Lee, and W. S. B. Yeung
Demilune Cell and Parotid Protein from Murine Oviductal Epithelium Stimulates Preimplantation Embryo Development
Endocrinology, January 1, 2006; 147(1): 79 - 87.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
R. M Schultz
From egg to embryo: a peripatetic journey
Reproduction, December 1, 2005; 130(6): 825 - 828.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
J. Sommovilla, W. B Bilker, T. Abel, and R. M Schultz
Embryo culture does not affect the longevity of offspring in mice
Reproduction, November 1, 2005; 130(5): 599 - 601.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
A K E Swales and N Spears
Genomic imprinting and reproduction
Reproduction, October 1, 2005; 130(4): 389 - 399.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. R. Miles, C. E. Farin, K. F. Rodriguez, J. E. Alexander, and P. W. Farin
Effects of Embryo Culture on Angiogenesis and Morphometry of Bovine Placentas During Early Gestation
Biol Reprod, October 1, 2005; 73(4): 663 - 671.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. Kanatsu-Shinohara, N. Ogonuki, T. Iwano, J. Lee, Y. Kazuki, K. Inoue, H. Miki, M. Takehashi, S. Toyokuni, Y. Shinkai, et al.
Genetic and epigenetic properties of mouse male germline stem cells during long-term culture
Development, September 15, 2005; 132(18): 4155 - 4163.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
T. Li, T. H. Vu, G. A. Ulaner, E. Littman, J.-Q. Ling, H.-L. Chen, J.-F. Hu, B. Behr, L. Giudice, and A. R. Hoffman
IVF results in de novo DNA methylation and histone methylation at an Igf2-H19 imprinting epigenetic switch
Mol. Hum. Reprod., September 1, 2005; 11(9): 631 - 640.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
M. Boiani, L. Gentile, V. V. Gambles, F. Cavaleri, C. A. Redi, and H. R. Scholer
Variable Reprogramming of the Pluripotent Stem Cell Marker Oct4 in Mouse Clones: Distinct Developmental Potentials in Different Culture Environments
Stem Cells, September 1, 2005; 23(8): 1089 - 1104.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
E. Seli and D. Sakkas
Spermatozoal nuclear determinants of reproductive outcome: implications for ART
Hum. Reprod. Update, July 1, 2005; 11(4): 337 - 349.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
A. Fujimoto, S.M. Mitalipov, L.L. Clepper, and D.P. Wolf
Development of a monkey model for the study of primate genomic imprinting
Mol. Hum. Reprod., June 1, 2005; 11(6): 413 - 422.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Imamura, A. Kerjean, T. Heams, J.-J. Kupiec, C. Thenevin, and A. Paldi
Dynamic CpG and Non-CpG Methylation of the Peg1/Mest Gene in the Mouse Oocyte and Preimplantation Embryo
J. Biol. Chem., May 20, 2005; 280(20): 20171 - 20175.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Sjoblom, C. T. Roberts, M. Wikland, and S. A. Robertson
Granulocyte-Macrophage Colony-Stimulating Factor Alleviates Adverse Consequences of Embryo Culture on Fetal Growth Trajectory and Placental Morphogenesis
Endocrinology, May 1, 2005; 146(5): 2142 - 2153.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
T. Takeuchi, Q. V. Neri, Y. Katagiri, Z. Rosenwaks, and G. D. Palermo
Effect of Treating Induced Mitochondrial Damage on Embryonic Development and Epigenesis
Biol Reprod, March 1, 2005; 72(3): 584 - 592.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
T. P. Fleming, W. Y. Kwong, R. Porter, E. Ursell, I. Fesenko, A. Wilkins, D. J. Miller, A. J. Watkins, and J. J. Eckert
The Embryo and Its Future
Biol Reprod, October 1, 2004; 71(4): 1046 - 1054.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
P. Rinaudo and R. M Schultz
Effects of embryo culture on global pattern of gene expression in preimplantation mouse embryos
Reproduction, September 1, 2004; 128(3): 301 - 311.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
G. Wu, F. W. Bazer, T. A. Cudd, C. J. Meininger, and T. E. Spencer
Maternal Nutrition and Fetal Development
J. Nutr., September 1, 2004; 134(9): 2169 - 2172.
[Abstract] [Full Text] [PDF]


Home page
Br. J. Ophthalmol.Home page
I Lee, P T Finger, J A Grifo, A R Rausen, A Rebarber, and D H Barad
Retinoblastoma in a child conceived by in vitro fertilisation
Br. J. Ophthalmol., August 1, 2004; 88(8): 1098 - 1099.
[Full Text] [PDF]


Home page
DevelopmentHome page
M. R. W. Mann, S. S. Lee, A. S. Doherty, R. I. Verona, L. D. Nolen, R. M. Schultz, and M. S. Bartolomei
Selective loss of imprinting in the placenta following preimplantation development in culture
Development, August 1, 2004; 131(15): 3727 - 3735.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Q. Wu, S. Ohsako, R. Ishimura, J. S. Suzuki, and C. Tohyama
Exposure of Mouse Preimplantation Embryos to 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) Alters the Methylation Status of Imprinted Genes H19 and Igf2
Biol Reprod, June 1, 2004; 70(6): 1790 - 1797.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
P. Zheng, B. Patel, M. McMenamin, S. E. Reddy, A. M. Paprocki, R. D. Schramm, and K. E. Latham
The Primate Embryo Gene Expression Resource: A Novel Resource to Facilitate Rapid Analysis of Gene Expression Patterns in Non-Human Primate Oocytes and Preimplantation Stage Embryos
Biol Reprod, May 1, 2004; 70(5): 1411 - 1418.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Fernandez-Gonzalez, P. Moreira, A. Bilbao, A. Jimenez, M. Perez-Crespo, M. A. Ramirez, F. R. De Fonseca, B. Pintado, and A. Gutierrez-Adan
Long-term effect of in vitro culture of mouse embryos with serum on mRNA expression of imprinting genes, development, and behavior
PNAS, April 20, 2004; 101(16): 5880 - 5885.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. Gao, E. Czirr, Y. G. Chung, Z. Han, and K. E. Latham
Genetic Variation in Oocyte Phenotype Revealed Through Parthenogenesis and Cloning: Correlation with Differences in Pronuclear Epigenetic Modification
Biol Reprod, April 1, 2004; 70(4): 1162 - 1170.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Schumacher and W. Doerfler
Influence of in vitro manipulation on the stability of methylation patterns in the Snurf/Snrpn-imprinting region in mouse embryonic stem cells
Nucleic Acids Res., March 5, 2004; 32(4): 1566 - 1576.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
J. Ohgane, T. Wakayama, S. Senda, Y. Yamazaki, K. Inoue, A. Ogura, J. Marh, S. Tanaka, R. Yanagimachi, and K. Shiota
The Sall3 locus is an epigenetic hotspot of aberrant DNA methylation associated with placentomegaly of cloned mice
Genes Cells, March 1, 2004; 9(3): 253 - 260.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. J. Ecker, P. Stein, Z. Xu, C. J. Williams, G. S. Kopf, W. B. Bilker, T. Abel, and R. M. Schultz
Long-term effects of culture of preimplantation mouse embryos on behavior
PNAS, February 10, 2004; 101(6): 1595 - 1600.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
D. Lucifero, J.R. Chaillet, and J. M. Trasler
Potential significance of genomic imprinting defects for reproduction and assisted reproductive technology
Hum. Reprod. Update, January 1, 2004; 10(1): 3 - 18.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
C. E. Farin, P. W. Farin, and J. A. Piedrahita
Development of fetuses from in vitro-produced and cloned bovine embryos
J Anim Sci, January 1, 2004; 82(13_suppl): E53 - 62.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
S. Sinawat, W.-C. Hsaio, J. H. Flockhart, M. H. Kaufman, J. Keith, and J. D. West
Fetal abnormalities produced after preimplantation exposure of mouse embryos to ammonium chloride
Hum. Reprod., October 1, 2003; 18(10): 2157 - 2165.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Lane and D. K. Gardner
Ammonium Induces Aberrant Blastocyst Differentiation, Metabolism, pH Regulation, Gene Expression and Subsequently Alters Fetal Development in the Mouse
Biol Reprod, October 1, 2003; 69(4): 1109 - 1117.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
P. Lonergan, D. Rizos, A. Gutierrez-Adan, P.M. Moreira, B. Pintado, J. de la Fuente, and M.P. Boland
Temporal Divergence in the Pattern of Messenger RNA Expression in Bovine Embryos Cultured from the Zygote to Blastocyst Stage In Vitro or In Vivo
Biol Reprod, October 1, 2003; 69(4): 1424 - 1431.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. R.W. Mann, Y. G. Chung, L. D. Nolen, R. I. Verona, K. E. Latham, and M. S. Bartolomei
Disruption of Imprinted Gene Methylation and Expression in Cloned Preimplantation Stage Mouse Embryos
Biol Reprod, September 1, 2003; 69(3): 902 - 914.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
R.D. Schramm, A. M. Paprocki, and C. A. VandeVoort
Causes of developmental failure of in-vitro matured rhesus monkey oocytes: impairments in embryonic genome activation
Hum. Reprod., April 1, 2003; 18(4): 826 - 833.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
T. T. Y. Chiu, M. S. Rogers, C. Briton-Jones, and C. Haines
Effects of myo-inositol on the in-vitro maturation and subsequent development of mouse oocytes
Hum. Reprod., February 1, 2003; 18(2): 408 - 416.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. Liu, J. Van der Elst, and M. Dhont
In Vitro Parthenogenetic Development of Mouse Oocytes Following Reciprocal Transfer of the Chromosome Spindle Between In Vivo-Matured Oocytes and In Vitro-Matured Oocytes
Biol Reprod, January 1, 2003; 68(1): 186 - 189.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
D. Rizos, A. Gutierrez-Adan, S. Perez-Garnelo, J. de la Fuente, M.P. Boland, and P. Lonergan
Bovine Embryo Culture in the Presence or Absence of Serum: Implications for Blastocyst Development, Cryotolerance, and Messenger RNA Expression
Biol Reprod, January 1, 2003; 68(1): 236 - 243.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
R. Roberts, S. Franks, and K. Hardy
Culture environment modulates maturation and metabolism of human oocytes
Hum. Reprod., November 1, 2002; 17(11): 2950 - 2956.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
E.A. Harding, C.A. Gibb, M.H. Johnson, D.I. Cook, and M.L. Day
Developmental Changes in the Management of Acid Loads During Preimplantation Mouse Development
Biol Reprod, November 1, 2002; 67(5): 1419 - 1429.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
M. De Rycke, I. Liebaers, and A. Van Steirteghem
Epigenetic risks related to assisted reproductive technologies: Risk analysis and epigenetic inheritance
Hum. Reprod., October 1, 2002; 17(10): 2487 - 2494.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Humpherys, K. Eggan, H. Akutsu, A. Friedman, K. Hochedlinger, R. Yanagimachi, E. S. Lander, T. R. Golub, and R. Jaenisch
Abnormal gene expression in cloned mice derived from embryonic stem cell and cumulus cell nuclei
PNAS, October 1, 2002; 99(20): 12889 - 12894.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
C. J. Bean, T. J. Hassold, L. Judis, and P. A. Hunt
Fertilization in vitro increases non-disjunction during early cleavage divisions in a mouse model system
Hum. Reprod., September 1, 2002; 17(9): 2362 - 2367.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
R. M. Schultz and C. J. Williams
The Science of ART
Science, June 21, 2002; 296(5576): 2188 - 2190.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Y. G. Chung, M. R.W. Mann, M. S. Bartolomei, and K. E. Latham
Nuclear-Cytoplasmic "Tug of War" During Cloning: Effects of Somatic Cell Nuclei on Culture Medium Preferences of Preimplantation Cloned Mouse Embryos
Biol Reprod, April 1, 2002; 66(4): 1178 - 1184.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
D. Rizos, P. Lonergan, M.P. Boland, R. Arroyo-Garcia, B. Pintado, J. d. l. Fuente, and A. Gutierrez-Adan
Analysis of Differential Messenger RNA Expression Between Bovine Blastocysts Produced in Different Culture Systems: Implications for Blastocyst Quality
Biol Reprod, March 1, 2002; 66(3): 589 - 595.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
Y. J.R. Menezo and D. Sakkas
Monozygotic twinning: is it related to apoptosis in the embryo?
Hum. Reprod., January 1, 2002; 17(1): 247 - 248.
[Full Text] [PDF]


Home page
Cancer Res.Home page
D. T. Schneider, A. E. Schuster, M. K. Fritsch, J. Hu, T. Olson, S. Lauer, U. Gobel, and E. J. Perlman
Multipoint Imprinting Analysis Indicates a Common Precursor Cell for Gonadal and Nongonadal Pediatric Germ Cell Tumors
Cancer Res., October 1, 2001; 61(19): 7268 - 7276.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
W. M. Rideout III, K. Eggan, and R. Jaenisch
Nuclear Cloning and Epigenetic Reprogramming of the Genome
Science, August 10, 2001; 293(5532): 1093 - 1098.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Q. Zhou, A. Jouneau, V. Brochard, P. Adenot, and J.P. Renard
Developmental Potential of Mouse Embryos Reconstructed from Metaphase Embryonic Stem Cell Nuclei
Biol Reprod, August 1, 2001; 65(2): 412 - 419.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
C. Wrenzycki, D. Herrmann, L. Keskintepe, A. Martins Jr, S. Sirisathien, B. Brackett, and H. Niemann
Effects of culture system and protein supplementation on mRNA expression in pre-implantation bovine embryos
Hum. Reprod., May 1, 2001; 16(5): 893 - 901.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. Khosla, W. Dean, D. Brown, W. Reik, and R. Feil
Culture of Preimplantation Mouse Embryos Affects Fetal Development and the Expression of Imprinted Genes
Biol Reprod, March 1, 2001; 64(3): 918 - 926.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Doherty, A. S.
Right arrow Articles by Schultz, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doherty, A. S.
Right arrow Articles by Schultz, R. M.
Agricola
Right arrow Articles by Doherty, A. S.
Right arrow Articles by Schultz, R. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS