HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Sachdeva, G. Articles by Puri, C. P. Search for Related Content PubMed PubMed Citation Articles by Sachdeva, G. Articles by Puri, C. P. Agricola Articles by Sachdeva, G. Articles by Puri, C. P.

Detection of Progesterone Receptor Transcript in Human Spermatozoa

^a Institute for Research in Reproduction, Indian Council of Medical Research, Parel, Mumbai 400 012, India

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The present study, to our knowledge, is the first to demonstrate presence of progesterone receptor (PR) transcript in human spermatozoa. The study shows the presence of low copy number PR mRNA in mature human spermatozoa. The PR transcript in spermatozoa was detected by reverse transcriptase-polymerase chain reaction using primers specific for the hormone binding domain and the DNA binding domain of the conventional uterine PR. Further, the cDNA sequence of the partial PR transcript from spermatozoa was found to be identical to the region spanning nucleotides 2694 to 3230 of the conventional PR full-length cDNA sequence. This study also indirectly suggests that the PR protein indeed is an intrinsic sperm protein and is not acquired through proteinaceous secretions of accessory reproductive organs.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Recently a number of reports have suggested the role of progesterone, a typical female hormone, in various sperm functions, i.e., capacitation, acrosome reaction, motility, egg penetration, and fertilization [1–5]. There have been attempts to characterize the molecule(s) that mediates the progesterone-induced effects. Some of the studies succeeded in identifying and further characterizing the sperm proteins that bind to progesterone, conveniently termed progesterone receptors (PRs) [6–10]. The majority of these studies used competitive receptor inhibition assays, Western blotting, and fluorescein-tagged ligand binding tests to characterize the progesterone binding sites on human spermatozoa. However, these studies do not rule out the possibility of PR protein acquired by sperm through secretions of accessory reproductive organs. Detection of PR mRNAs in spermatozoa, a more reliable assay to ascertain whether the PR protein is actually synthesized in spermatids or spermatozoa, has not been attempted so far.

Interestingly, unlike conventional PRs, which act as intranuclear transcription factors in ovary, uterus, and mammary gland, sperm PR is a surface protein [11]. Further, there is evidence to suggest that the molecular mechanism of action of progesterone with respect to human spermatozoa differs from that commonly operating in other target tissues. Progesterone generally exerts its effects on the target tissues through its entry into the cells and binding to nuclear genomic receptors, with the subsequent activation of DNA transcription and protein synthesis [12]. However, DNA transcription and protein synthesis in the human spermatozoa, if present, are limited to mitochondria [13, 14]. The rapid modifying effects of progesterone on sperm motility, acrosome reaction, and metabolism are hardly compatible with a genomic effect [15]. The progesterone-mediated effects, for example, Ca²⁺ influx into spermatozoa, are found to be too rapid to involve binding of the progesterone-PR complex to progesterone-responsive elements in DNA [16, 17].

Further, ligand specificity experiments conducted in our laboratory demonstrated differences between sperm PR and uterine PR in their binding affinities to different ligands. Unlike uterine PR, sperm PR does not bind to mifepristone and other progesterone antagonists [11].

Differences in the mode of action and the peculiar location of sperm PR as compared to the conventional PR prompted us to investigate 1) whether there exist any PR-like transcripts in mature human spermatozoa and 2) whether these resemble the conventional PR in terms of its genomic organization, i.e., the presence of an N-terminal domain, DNA binding domain, and hormone binding domain. In view of the emerging concept suggesting that the progesterone-PR complex in human spermatozoa apparently does not require interaction with DNA to induce biological effects, our study on the presence or absence of a DNA binding domain in PR transcripts in spermatozoa could be of great significance in understanding the nonclassical mode of action of steroids.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Subjects

Semen samples were collected from healthy male volunteers, and endometrial biopsies were obtained from females attending the infertility clinic at the Institute for Research in Reproduction, Mumbai, India. Informed consent was obtained from each subject before collection of the samples.

Reverse Transcription (RT)-Polymerase Chain Reaction (PCR)

Motile spermatozoa were collected by swim-up of pooled semen samples [18]. In brief, pooled spermatozoa were washed twice with Dulbecco's modified Eagle's medium (DMEM; Sigma, St. Louis, MO) at 800 rpm for 10 min. Sixty million spermatozoa were overlaid with 1 ml of DMEM and incubated at 37°C for 1 h. Supernatants were pelleted at 800 rpm to obtain motile spermatozoa. Samples were checked under x400 magnification using a brightfield light microscope (Zeiss Ultraphot; Carl Zeiss, Inc., Thornwood, NY) to rule out the possibility of any contamination with leukocytes or other debris. Total RNA was extracted from spermatozoa and endometrial aspirates using an RNeasy kit (Qiagen Inc., Santa Clarita, CA). Five micrograms of RNA was incubated with 5 units of ribonuclease-free deoxyribonuclease (DNase) I (Boehringer Mannheim, Mannheim, Germany) in single-strength reaction buffer at 37°C for 15 min. This was followed by heat inactivation of DNase I at 65°C for 10 min. DNase-treated RNA samples were subjected to RT-PCR. In brief, 0.4 µM anchored oligo(dT) primer (5' TTTTTTTTTTTC 3'), 200 µM dNTPs, 5 mM dithiothreitol (DTT), and 1 unit of an enzyme mix of avian myeloblastosis virus (AMV) reverse transcriptase and Pyrococcus woesei (Pwo) DNA polymerase (Boehringer Mannheim) were used to synthesize the first strand of cDNA from 5 µg sperm RNA at 50°C in a total volume of 25 µl. An aliquot of the cDNA mix was amplified using 0.4 µM primers specific to the conventional PR (PR1 [5' GATTCAGAAGCCAGCCAGAG 3'], spanning nucleotides 2694 to 2714, targeted towards the sequences coding for the DNA binding domain; and PR2 [5' AGTTGCCTCTCGCCTAGTTG 3'], complementary to nucleotides 3210 to 3230, targeted towards the sequences corresponding to the hormone-binding domain of human [h] PR [19]), 1 unit Taq DNA polymerase (Gibco BRL, Life Technologies, Grand Island, NY), 1.25 mM MgCl₂, and 200 µM dNTPs in a 25-µl reaction volume in a Perkin Elmer (Branchburg, NJ) thermocycler. Two hundred nanograms of endometrial RNA was also subjected to RT-PCR. However, no anchored oligo(dT) primer was used in the cDNA synthesis reaction for endometrial RNA. Only specific primers PR1 and PR2 were used in a single-step RT-PCR reaction to detect endometrial PR transcript (Titan One Tube RT-PCR System; Boehringer Mannheim). Primers for ß actin [19] were used in the same reaction to amplify actin as a positive control in the endometrial RNA sample. The program comprised 35 cycles of denaturation at 94°C for 30 sec, annealing at 52°C for 30 sec, and extension at 72°C for 2 min. The negative control did not include reverse transcriptase in the reaction mixture. The products were analyzed on a 1.2% agarose gel stained with ethidium bromide and visualized under UV transillumination. Reamplification of RT-PCR products of sperm PR was also carried out using PR1 and PR2 primers.

Sperm RNA was also subjected to RT-PCR using primers specific for leukocyte common antigen (CD45) [20]. RNA extracted from human leukocytes was also subjected to RT-PCR using PR-specific primers under conditions identical to those used for the detection of PR in human spermatozoa.

Southern Hybridization

The PR cDNA insert (hPR1/pSG5) of 3.8 kilobases (kb) was excised from the vector (3.9 kb) by EcoRI digestion. EcoRI-digested hPR1/pSG5 plasmid was run on a 5% polyacrylamide gel to elute the insert for PR [21]. The eluted fragment was labeled with nonradioactive digoxigenin-11-UTP (Boehringer Mannheim). In brief, 100 ng of the eluted fragment was labeled in a total volume of 20 µl containing 2 µl random hexamers, 2 µl labeling mix, and 1 µl of Klenow enzyme (digoxigenin DNA labeling kit; Boehringer Mannheim) at 37°C overnight. The labeled DNA was precipitated and washed with 70% ethanol. Concentration of the labeled DNA and the labeling efficiency was checked by comparing the intensities of colored precipitates formed by the prelabeled and labeled DNA samples in a colorimetric detection assay (Boehringer Mannheim) according to the manufacturer's instructions.

Sperm PR and endometrial PR RT-PCR products were transferred to nylon membranes [22]. Blots were prehybridized overnight at 40°C in 50% formamide, 6-strength SSC (single-strength SSC is 0.15 M sodium chloride, 0.015 M sodium citrate) pH 7.0, 5% blocking reagent, 0.1% N lauryl sarcosine, and 0.02% SDS and were hybridized for 20 h at 40°C with an optimized concentration (50 ng/ml) of digoxigenin-labeled probe [23]. The filter was washed in double-strength SSC, 0.1% SDS at room temperature three times for 30 min, and then in single-strength SSC, 0.1% SDS at 55°C, three times for 30 min. The hybridized molecules were detected using a nonradioactive chemiluminescent digoxigenin detection system (Boehringer Mannheim) according to the manufacturer's instructions.

Partial Cloning and Sequencing of Sperm PR

The RT-PCR product for sperm PR was eluted from a 1% agarose gel in 15% polyethylene glycol, precipitated, and washed with 70% ethanol. The eluted PCR fragment (60 ng) was ligated with 50 ng of pGEM-T vector in a 15-µl reaction volume containing single-strength rapid ligation buffer and 1 Weiss unit of T4 DNA ligase at 25°C for 1 h (Promega, Madison, WI). The ligation product was transformed into DH5 competent cells, and 100 µl of transformation mixture was plated on liquid broth medium/ampicillin (50 µg/ml) with 5-bromo-4-chloro-3-indolyl ß-D-galactopyranoside (X-Gal) and isopropyl-1-thio-ß-D-galactopyranoside (IPTG) to grow overnight. Ten colonies were selected for amplification in liquid broth medium/ampicillin. Plasmid DNAs were extracted from 1.5 ml of overnight-grown cultures by the alkaline lysis method [21]. Plasmid DNAs were subjected to PCR using primers PR1 and PR2. The positive clones were reamplified and sequenced using PR1 and PR2 primers (automated fluorescence-based DNA sequencing system).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
When primers corresponding to the DNA binding and hormone binding domains of the conventional PR were used in RT-PCR to detect the PR transcript in human spermatozoa, no product was visualized (Fig. 1, lane 3), whereas in endometrial RNA an intense band of expected size, i.e., 536 base pairs (bp) was seen (Fig. 1, lane 1). However, when the transcripts from spermatozoa were reverse-transcribed using anchored oligo(dT) primers and then amplified with both forward and reverse PR-specific primers, a 536-bp product was obtained (Fig. 1, lane 4). A few nonspecific signals were also observed that were due to the use of anchored oligo(dT) primers in the cDNA synthesis reaction. The intensity of these signals was less when the RT-PCR product of sperm PR was further amplified using only specific PR primers (Fig. 2, lane 1). Sperm RNA subjected to RT-PCR using CD45-specific primers did not show any product (data not shown).

View larger version (61K): [in this window] [in a new window]   FIG. 1. RT-PCR detection of PR transcripts. Endometrial RNA (lane 1) and spermatozoa RNA (lanes 2–4) were used as the templates for RT-PCR reactions. No reverse transcriptase was added in RT-PCR reactions for products loaded in lane 2. No anchored oligos were used in RT-PCR reactions for products loaded in lane 3. No PR RT-PCR products were detected in lanes 2 and 3. Products of PR (536 bp) and actin (284 bp) were detected in lane 1, and a product of PR (536 bp) in lane 4. Lane M contains HaeIII-digested X174 molecular size markers

View larger version (50K): [in this window] [in a new window]   FIG. 2. Reamplification of the PR RT-PCR product of spermatozoa using specific PR primers (lane 1). Lane 2, negative control (no template). Lane M, HaeIII-digested X174 molecular size markers

The identity of the PCR-amplified cDNA fragment of PR transcripts from human spermatozoa was verified using Southern hybridization with labeled full-length PR cDNA excised from hPR1/pSG5. Intense signals of 536 bp were observed for both sperm and endometrial PR (Fig. 3).

View larger version (40K): [in this window] [in a new window]   FIG. 3. Southern hybridization of PR RT-PCR products of human endometrium (lane 1) and spermatozoa (lane 2) with digoxigenin-labeled PR cDNA (cloned in pSG5)

The sperm PR PCR product was further cloned in pGEM-T vector. Recombinant clones were screened for the presence of an insert by PCR using specific primers PR1 and PR2 (Fig. 4). Positive clones were subjected to automated fluorescence-based DNA sequencing using PR1 and PR2 as sequencing primers. The sperm PR-PCR product was identical in its sequence to the uterine PR cDNA from nucleotide 2694 to nucleotide 3230 [19], thereby suggesting its similarity with uterine PR (Fig. 5).

View larger version (38K): [in this window] [in a new window]   FIG. 4. PCR screening of recombinant pGEM-T colonies for the presence of the sperm PR clone. Lane M, HaeIII-digested X174 molecular size markers. Lanes 1–10 were loaded with products of PCRs using plasmid DNAs isolated from transformed colonies as templates and PR1 and PR2 as primers. Lane 11 contains the product of PCR using plasmid DNA isolated from full-length uterine PR cDNA clone as a template and PR1 and PR2 as primers

View larger version (42K): [in this window] [in a new window]   FIG. 5. Sequence of the sperm PR clone (from nucleotides 1–536) in pGEM-T vector as determined by an automated DNA sequencing system using PR1 and PR2 as sequencing primers. Sequences complementary to PR1 and PR2 primers are indicated in bold. Vector sequences are underlined

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The present study demonstrates the presence of PR transcript in human spermatozoa. However, unlike uterine PR, the transcript seems to be present in low abundance, as indicated by our repeated inability to detect it by RT-PCR with specific PR primers, even with a high amount of initial template. However, when transcripts in spermatozoa were selectively transcribed using an anchored oligo(dT) primer, followed by amplification with primers spanning the DNA binding domain (as forward primer) and the hormone binding domain (as reverse primer) of the conventional PR, a PCR product of similar size (i.e., 536 bp) was obtained as expected for the endometrial PR. The product was not a result of any contamination in semen samples as the RNA was extracted from a motile sperm population collected by a swim-up procedure. The post-swim-up sperm sample was checked under x400 magnification under a brightfield light microscope (Zeiss Ultraphot) to rule out the possibility of any contamination with other cells before the RNA was extracted. Although the sperm RNA preparation used in this study was obtained from a highly motile sperm population collected after a swim-up procedure, the sample was also subjected to RT-PCR using primers specific for CD45 to rule out the possibility of any cellular contamination. No product was detected for CD45 in sperm RNA. Further RNA samples extracted from human leukocytes when subjected to RT-PCR using PR primers did not demonstrate any PR product. The RT-PCR product for PR in sperm was also not a result of any DNA contamination as the RNA samples were subjected to DNase treatment before RT-PCR. Moreover, sequences of both primers were deduced from the cDNA sequence of the conventional PR, to avoid the amplification of intronic sequences. Further, we did not obtain any product when the reverse transcriptase was omitted from the amplification reaction carried out in presence of Taq polymerase alone.

The identity of the product was validated by Southern hybridization with a full-length cDNA probe for full-length uterine PR. This was further confirmed by sequencing of the sperm PR PCR product cloned in a T vector.

Our previous observations have shown that, unlike conventional PR, sperm PR is membrane protein and does not bind to mifepristone and other antiprogestins [11]. These observations were consistent with earlier reports demonstrating the inability of mifepristone and ZK 98.299 to block the progesterone-mediated increase in calcium influx in spermatozoa [3, 16]. They suggested the possibility that the sperm PR is distinct from the conventional PR. However, the present study demonstrates that the sequence of PR transcript from human spermatozoa is similar to that of PR transcript from human endometrium, at least in the region from nucleotide 2694 to nucleotide 3230 of the conventional PR cDNA. Although this study does not demonstrate detection of the full-length PR transcript in human spermatozoa, it clearly indicates that the sperm PR transcript has regions corresponding to both the domains—the DNA binding domain as well as hormone binding domain. However, this does not exclude the possibility that the PR transcript in spermatozoa is different from the conventional PR transcript in regions spanning nucleotides 1 to 2694 or 3231 to 3852, which may explain the differences in the binding characteristics of sperm PR with respect to ligand affinities, kinetics, and steroid specificities as compared to the conventional PR [7].

Considering the fact that mature human spermatozoa have low biosynthetic activity, it seems likely that PR mRNA is synthesized in spermatid or other germ cells. However, to establish exactly the origin of PR synthesis in the process of maturation of spermatozoa in human, development of specific tools (antibodies/nucleic acids) to screen organ or tissue specific cDNA libraries is needed. The present study provides a sperm PR clone as a molecular tool for screening these libraries.

In conclusion, this study demonstrating the presence of PR transcript in mature human spermatozoa suggests a definite role for progesterone in sperm functions. It would be of interest to explore the presence of elements corresponding to the DNA binding domain of conventional PR and their function in sperm PR, which is a membrane protein and apparently does not require direct interaction with DNA to induce biological responses. These studies might throw some light on the possible existence of two alternate modes of action, i.e., genomic and nongenomic, of the progesterone-PR complex in spermatozoa.

	ACKNOWLEDGMENTS

 
The authors wish to thank Professor P. Chambon, INSERM, for providing the cDNA clone (hPR1/pSG5) for the human PR. We also thank Dr. Vandana Valvekar, Dean, Jerbai Wadia Maternity Hospital, for providing semen samples from healthy volunteers. We are grateful to Dr. Vijaya Raghavan, Deputy Director, IRR, for providing prostatic RNA.

	FOOTNOTES

 
First decision: 21 July 1999.

¹ Correspondence: Chander P. Puri, Institute for Research in Reproduction, Indian Council of Medical Research, Jehangir Merwanji Street, Parel, Mumbai 400 012, India. FAX: 91 22 4964853, 4139412; vichin{at}bom4.vsnl.net.in

Accepted: January 6, 2000.

Received: June 1, 1999.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Osman RA, Andria ML, Jones AD, Meizel S. Steroid induced exocytosis: the human sperm acrosome reaction. Biochem Biophys Res Commun 1989; 160:828–833.[CrossRef][Medline]
2. Blackmore PF, Beebe SJ, Danforth DR, Alexander NJ. Progesterone and 17-hydroxyprogesterone: novel stimulators of calcium influx in human sperm. J Biol Chem 1990; 265:1376–1380.[Abstract/Free Full Text]
3. Uhler ML, Leung A, Chan SY, Wang C. Direct effects of progesterone and antiprogesterone on human sperm hyperactive motility and acrosome reaction. Fertil Steril 1992; 58:1191–1198.[Medline]
4. Libersky EA, Boatman DE. Effects of progesterone on in vitro sperm capacitation and egg penetration in the golden hamster. Biol Reprod 1995; 53:483–487.[Abstract]
5. Kholkute SD, Rodriguez J, Dukelow WR. In vitro fertilization and acrosome reaction of the mouse epididymal sperm following exposure to progesterone and 17-hydroxyprogesterone. Int J Androl 1996; 18:146–150.
6. Tesarik J, Mendoza C. Insights into the sperm surface progesterone receptor: evidence of ligand-induced receptor aggregation and the implication of proteolysis. Exp Cell Res 1993; 205:111–117.[CrossRef][Medline]
7. Ambhaikar MB, Puri CP. Role of progesterone in sperm function. In: Puri CP, Van Look PFA (eds.), Current Concepts in Fertility Regulation. New Delhi, India: Wiley-Eastern Ltd.; 1994: 165–176.
8. Brucker C, Kassner G, Loser G, Hinrichsen M, Lipford GB. Progesterone-induced acrosome reaction: potential role for sperm acrosome antigen-1 in fertilization. Hum Reprod 1994; 9:1897–1902.[Abstract/Free Full Text]
9. Sabeur K, Edwards DP, Meizel S. Human sperm plasma membrane progesterone receptor(s) and the acrosome reaction. Biol Reprod 1996; 54:993–1001.[Abstract]
10. Luconi M, Bonnaccorsi L, Maggi M, Pecchioli P, Krausz C, Forti G, Baldi E. Identification and characterization of functional nongenomic progesterone receptors on human sperm membrane. J Clin Endocrinol Metab 1998; 83:877–885.[Abstract/Free Full Text]
11. Ambhaikar MB, Puri CP. Cell surface binding sites for progesterone on human spermatozoa. Mol Hum Reprod 1998; 4:413–421.[Abstract/Free Full Text]
12. Yamamoto KR. Steroid receptor regulated transcription of specific genes and gene networks. Annu Rev Genet 1985; 19:209–213.[CrossRef][Medline]
13. Premkumar E, Bhargava PM. Transcription and translation in bovine spermatozoa. Nature 1972; 240:139–143.
14. McLaughlin J, Terner C. Ribonucleic acid synthesis by spermatozoa from the rat and hamster. Biochem J 1973; 133:635–639.[Medline]
15. Revelli A, Modotti M, Piffaretti-Yanez A, Massobrio M, Balerna M. Steroid receptors in human spermatozoa. Hum Reprod 1994; 9:760–766.[Abstract/Free Full Text]
16. Blackmore PF, Neulen J, Lattanzio F, Beebe SJ. Cell surface binding sites for progesterone mediated calcium uptake in human sperm. J Biol Chem 1991; 266:18655–18659.[Abstract/Free Full Text]
17. Meizel S. Amino acid neurotransmitter receptor/chloride channels of mammalian sperm and the acrosome reaction. Biol Reprod 1997; 56:569–574.[Abstract]
18. Overstreet JW, Gould JE, Katz DF, Hanson FW. In vitro capacitation of human spermatozoa after passage through a column of cervical mucus. Fertil Steril 1980; 34:604–606.[Medline]
19. Misrahi M, Atger M, D'Auriol L, Loosfelt H, Menet C, Fridlansky F, Guiochon-Mantel A, Galibert F, Milgrom B. Complete amino acid sequence of the human progesterone receptor deduced from cloned cDNA. Biochem Biophys Res Commun 1987; 143:740–748.[CrossRef][Medline]
20. Santos LDJ M, Anderson DJ, Racowsky C, Simon C, Hill JA. Expression of interleukin-1 system genes in human gametes. Biol Reprod 1998; 59:1419–1424.[Abstract/Free Full Text]
21. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.
22. Southern EM. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 1975; 98:503–517.[CrossRef][Medline]
23. Sachdeva G, Kaur G, Bamezai R. Noise free chemiluminescent detection of human T cell receptor and interleukin 2 receptor genes after optimization of digoxigenin labelled probe concentration. Ind J Exp Biol 1995; 33:173–183.[Medline]

This article has been cited by other articles:

				R. K. Naz and R. Sellamuthu Receptors in Spermatozoa: Are They Real? J Androl, September 1, 2006; 27(5): 627 - 636. [Full Text] [PDF]

				D Modi, C Shah, G Sachdeva, S Gadkar, D Bhartiya, and C Puri Ontogeny and cellular localization of SRY transcripts in the human testes and its detection in spermatozoa Reproduction, November 1, 2005; 130(5): 603 - 613. [Abstract] [Full Text] [PDF]

				V S Patil, G Sachdeva, D N Modi, R R Katkam, D D Manjramkar, I Hinduja, and C P Puri Rab coupling protein (RCP): a novel target of progesterone action in primate endometrium J. Mol. Endocrinol., October 1, 2005; 35(2): 357 - 372. [Abstract] [Full Text] [PDF]

				J.P. Dadoune, A. Pawlak, M.F. Alfonsi, and J.P. Siffroi Identification of transcripts by macroarrays, RT-PCR and in situ hybridization in human ejaculate spermatozoa Mol. Hum. Reprod., February 1, 2005; 11(2): 133 - 140. [Abstract] [Full Text] [PDF]

				C. Shah, D. Modi, G. Sachdeva, S. Gadkar, and C. Puri Coexistence of Intracellular and Membrane-Bound Progesterone Receptors in Human Testis J. Clin. Endocrinol. Metab., January 1, 2005; 90(1): 474 - 483. [Abstract] [Full Text] [PDF]

				R. M. LOSEL, E. FALKENSTEIN, M. FEURING, A. SCHULTZ, H.-C. TILLMANN, K. ROSSOL-HASEROTH, and M. WEHLING Nongenomic Steroid Action: Controversies, Questions, and Answers Physiol Rev, July 1, 2003; 83(3): 965 - 1016. [Abstract] [Full Text] [PDF]

				S. Lambard, I. Galeraud-Denis, H. Bouraima, S. Bourguiba, A. Chocat, and S. Carreau Expression of aromatase in human ejaculated spermatozoa: a putative marker of motility Mol. Hum. Reprod., March 1, 2003; 9(3): 117 - 124. [Abstract] [Full Text] [PDF]

				H. Schwarzenbach, P. R. Manna, D. M. Stocco, G. Chakrabarti, and A. K. Mukhopadhyay Stimulatory Effect of Progesterone on the Expression of Steroidogenic Acute Regulatory Protein in MA-10 Leydig Cells Biol Reprod, March 1, 2003; 68(3): 1054 - 1063. [Abstract] [Full Text] [PDF]

				S. Gadkar, C.A. Shah, G. Sachdeva, U. Samant, and C.P. Puri Progesterone Receptor as an Indicator of Sperm Function Biol Reprod, October 1, 2002; 67(4): 1327 - 1336. [Abstract] [Full Text] [PDF]

				J.J. Peluso, G. Fernandez, A. Pappalardo, and B.A. White Membrane-Initiated Events Account for Progesterone's Ability to Regulate Intracellular Free Calcium Levels and Inhibit Rat Granulosa Cell Mitosis Biol Reprod, August 1, 2002; 67(2): 379 - 385. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Sachdeva, G. Articles by Puri, C. P. Search for Related Content PubMed PubMed Citation Articles by Sachdeva, G. Articles by Puri, C. P. Agricola Articles by Sachdeva, G. Articles by Puri, C. P.