| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Regular Article |
a Departments of Animal Sciences,
b Biochemistry, and
c Veterinary Pathobiology, University of Missouri-Columbia, Columbia, Missouri 65211
d Agricultural Sector, Dairy Business, Monsanto Co., St. Louis, Missouri 63198
e Department of Animal Endocrinology and Reproduction, University of Liège, Liège, Belgium
ABSTRACT
The pregnancy-associated glycoproteins (PAG) constitute a large family of recently duplicated genes. They show structural resemblance to pepsin and related aspartic proteinases. A total of 21 bovine (bo) PAG and 9 ovine (ov) PAG cDNA have been identified. Phylogenetic analysis indicated that the PAG are divided into two main groupings that accurately reflect their tissue expression, as determined by in situ hybridization. In the first pattern, represented by ovPAG-2 and boPAG-2, -8, -10, and -11 (where the numbering is arbitrary and reflects order of discovery within species), expression occurred throughout the outer epithelial layer of the placenta (trophectoderm). The second pattern was predominant localization to binucleate cells. Ribonuclease protection assays, which allow discrimination between closely related transcripts, have shown that the expression of PAG varies in a temporal manner over pregnancy. Of those bovine PAG expressed predominantly in binucleate cells, boPAG-1, -6, and -7 are expressed weakly, if at all, by Day 25 placenta, but are present at the middle and end of pregnancy. Others, such as boPAG-4, -5, and -9, are expressed at Day 25 and at earlier stages. Although not among the earliest PAG produced by the trophoblast, boPAG-1 has been used for pregnancy diagnosis, particularly in dairy cows, where there is a major need for a sensitive method capable of detecting pregnancy within 1 mo of conception. It seems likely that some of the newly discovered PAG will be better candidates than PAG-1 for pregnancy diagnosis.
Formation of the blastocyst allocates cells of the morula either to the trophoblast lineage or to an embryonic fate. Associated with this developmental transition are dramatic changes in gene expression. Certain genes transcribed only in trophectoderm become activated for the first time. For example, the chorionic gonadotropin of higher primates and interferon-
in cattle are expressed and play essential roles, albeit different ones, in maintaining the corpus luteum in a functional state [1].
The trophectoderm lineage, established at blastulation, continues to undergo differentiation as gestation proceeds [2]. In ruminant ungulates, a morphologically distinct cell type can first be noted at about the time of definitive cell-to-cell attachment of the trophoblast to the uterine wall; these are binucleate cells [3]. Whether this nuclear duplication is the result of endomitosis or mononuclear cell fusion remains unclear, but the result of the process is a population of larger granulated cells that can migrate from the trophectoderm to fuse with maternal uterine epithelial cells [4]. In sheep, the fusion of binucleate cells with uterine epithelial cells causes an extensive syncytium to form. This syncytium persists throughout pregnancy. In cattle, the extent of syncytium formation is much less and, in later pregnancy, is largely limited to the formation of short-lived trinucleate cells. Exocytosis of granules occurs from these fused cells toward the underlying maternal capillary beds, allowing trophoblast cell products to reach the maternal blood supply [4]. From the time that this limited form of implantation begins, binucleate cells comprise about 20% of the trophectoderm layer and are constantly being replaced as migration to the uterine epithelium proceeds [4].
As might be expected, major changes in gene expression are also associated with the formation of granulated binucleate cells. Interferon- genes, for example, are not transcribed in these cells [5]; their expression, which is limited to just a few days preceding trophoblast attachment, is confined to the mononucleate cell population. By contrast, placental lactogen is synthesized exclusively by binucleate cells [6], as is another protein, pregnancy-associated glycoprotein-1 (PAG-1) [7, 8], known also as pregnancy-specific protein B (PSPB) [9] and pregnancy serum protein of Mr 60 kDa (PSP60) [10]. Because of its expression by binucleate cells, the detection of PAG-1 has been used as the basis of a pregnancy test in ruminant ungulate species [10–12]. However, the effectiveness of the test is compromised by two disadvantages. First, positive pregnancy diagnosis in the first month after service is somewhat uncertain because antigen concentrations in the maternal blood are low and somewhat variable [10, 12, 13]. Second, PAG-1 concentrations rise markedly close to term [10, 12, 13]. Due to the long circulating half-life of the molecule, the antigen can still be detected 80–100 days postpartum, thus compromising pregnancy diagnosis in cows bred within this early postpartum period [9, 10, 13, 14].
Pregnancy-associated glycoprotein-1 is a member of the aspartic proteinase family, a structurally conserved grouping that includes pepsin, renin, and many other animal, plant, fungal, and retroviral proteinases [15]. Aspartic proteinases are bilobed molecules. One of the hallmarks of aspartic proteinases is the presence of a highly conserved sequence (hydrophobic-hydrophobic-Asp-Thr-Gly-Ser/Thr-Ser/Thr) flanking the catalytically essential aspartic acid within each lobe of the molecule [15]. Interestingly, boPAG-1 and the antigenically cross-reacting ovPAG-1 produced by the sheep placenta are probably not proteolytically active due to amino acid substitutions near the catalytic center [7, 16]. In boPAG-1, the highly conserved glycine in the DTG motif has been mutated to an alanine. In ovPAG-1, the catalytic aspartic acid in the carboxyl-terminal lobe has been mutated to a glycine [7].
Several novel PAG have been cloned from bovine and ovine placenta [17]. Other PAG have been purified from Day 100 ovine placenta [18]. While some of these proteins are localized to binucleate cells [7, 18], others (such as boPAG-2) seem to be expressed throughout the trophectoderm [19]. Together, these reports indicated that the PAG represent a large family of placenta-expressed proteins. A major aim of the studies described here has been to study the relationships among the various PAG family members in terms of their structures and phylogenetic origins and determine whether these features are correlated with expression patterns during pregnancy. A goal has been to identify PAG that might be suitable antigens for an improved pregnancy test in cattle.
MATERIALS AND METHODS
Materials
The DNA restriction enzymes and AMV reverse transcriptase were purchased from Promega (Madison, WI). [
-32P]-Deoxy ATP (3000 Ci/mmol), [-32P]CTP (3000 Ci/mmol) and [-35S]-deoxy ATP (1000–1500 Ci/mmol) were purchased from NEN Research Products (New England Nuclear, Boston, MA). Taq-polymerase was from Gibco BRL (Grand Island, NY). Sequenase v.2 was from US Biochemical (Cleveland, OH). MagnaGraph nylon membranes were from Micron Separations Inc. (Westboro, MA). All other reagents were purchased from Sigma (St. Louis, MO).
Cloning of Bovine PAG Transcripts
Two procedures were used to clone additional boPAG transcripts: reverse transcription (RT)-polymerase chain reaction (PCR) and library screening. For the RT-PCR, cellular RNA (from Day 25 and term placentas) was reverse transcribed into cDNA with a poly dT oligonucleotide. The PAG in Day 25 placenta were amplified by PCR with a mixture of oligonucleotides that flanked the open reading frame (5' primer mix: PAGf1, aggaaagaagcatgaagtgg; boPAGex5', cccaagcttatgaagtggcttgtgctcct) (3' primer mix: pPAG3', gttctcgagcttgaagcagcyccagcattta [where y is c or t]; oPAG23', gcggaattccatttacacagcaggagc; eqPAG3', gttctcgagcttataccgcagtagccagtcc; ovPAG3', ttcctgaacaagtccaagcattta; bPAG3', gcgctcgagttacactgcccgtgccaggc). The conditions used for PCR on the Day 25 RT reactions were 94°C (30 sec), 50°C (30 sec), and 72°C (1 min) for 35 cycles. For the reactions on term RNA, two general primers were used instead of the primer mixtures (boPAGex5' and boPAGex3', gggaagcttgggccgctagcttacactgcccgtgccaggccaatcctgtcatttc). The resulting PCR products lacked the last five codons of the open reading frame. The conditions were 94°C (1 min), 42°C (1 min), and 72°C (1 min) for 35 cycles. The PCR products were cloned into the pGEM-T Easy vector (Promega) and 106 clones were partially sequenced. Those clones representing novel PAG were sequenced fully on both strands. For the RT-PCR on term placenta, 16 clones were analyzed and two novel PAG were fully sequenced.
In the second procedure, a Day 25 bovine cDNA library, constructed in 
ZAPII (Clontech, Palo Alto, CA) [17], was screened by hybridization with a mixed probe of [32P]-labeled boPAG-5, boPAG-9, equine PAG, and porcine PAG-2 fragments comprising the first ~250 nucleotides of each cDNA [17, 20, 21]. The probes were generated by PCR by including [32P-]dATP in reactions containing one tenth the normal amount of dATP. Hybridization was carried out at 42°C in 50% formamide, 5x standard saline citrate (SSC), 0.5% SDS, 5x Denhardt's, and 0.1 mg/ml herring sperm DNA [22]. Positive clones were analyzed by restriction endonuclease digestion. Sixty-four clones of the anticipated length were partially sequenced. Those clones representing novel boPAG were fully sequenced on both strands.
Sequence Analysis
The amino acid sequences of bovine and ovine PAG were first assembled into multiple sequence alignments by pairwise comparisons of the sequences with the PILEUP program of the Wisconsin Package, version 10.0, Genetics Computer Group (GCG) (Madison, WI), to introduce gaps for optimal alignment. The complete alignment is available from the authors upon request. A distance matrix was created (DISTANCES program, GCG) and a phylogenetic tree was constructed (GROWTREE, GCG) by a neighbor-joining procedure.
Tissues
Bovine placentas were collected from a local abattoir. The stage of pregnancy was estimated by measurement of crown–rump length. Ovine conceptuses and placentae were obtained surgically on specific days after breeding. All animals used in these experiments were maintained and handled according to protocols approved by the Animal Care and Use Committee at the University of Missouri.
Northern Analysis of Bovine Placental RNA
Short (~250 bp) fragments from the boPAG-1 and boPAG-9 cDNA were labeled by nick translation with [32P-]dATP [22]. The blot (20 µg RNA/lane) was hybridized to each probe at 55°C in 50% formamide, 5x SSC, 0.5% SDS, 5x Denhardt's, and 0.1 mg/ml herring sperm DNA and washed three times at 65°C in 0.1x SSC and 0.5% SDS. To control for RNA loading, full-length boPAG-1 and boPAG-2 probes were mixed and hybridized to the blot under less stringent conditions (42°C).
Generation of Probe Constructs for Ribonuclease Protection Assays (RPA) and In Situ Hybridization
Briefly, regions of nucleotide sequence that provided the most variability among different PAG members, i.e., those regions that were the least conserved, were selected as probes for RPA and in situ hybridization. In the case of boPAG-2, -4, -8, -9, -10, and -11, a 563-bp sequence, encompassing exons 6, 7, 8, and 9, was amplified by PCR (forward, cctcttttgccttctacttga; reverse, gcgctcgagttacactgcccgtgccaggc). The primers annealed to conserved regions flanking the variable regions used as probe. In the case of boPAG-1, -5, -6, and -7, another region of the cDNA (407 bp), corresponding to exons 3, 4, and 5, was amplified by PCR. Again, two well-conserved primers (forward, tgggtaacatcaccattggaa; reverse, ttctgagcctgtttttgcc) were used. These same primers were used to generate probes comprising exons 3–5 for each ovPAG as well. The PCR products were subcloned into the TA cloning vector (Invitrogen, Carlsbad, CA). The orientation and sequences of the inserts were determined by sequencing. A probe for boPAG-3 (previously described as boPAG-1 variant) [23], was not generated because its similarity to boPAG-1 would preclude a clear interpretation of its expression pattern in the in situ hybridization studies.
Ribonuclease Protection Assays (RPA)
Riboprobes (cRNA) were prepared by the Riboprobe Preparation System (Promega). The subcloned cDNA fragments were transcribed in vitro into cRNA in the presence of [32P-]CTP. Total cellular RNA was extracted from placental tissue at different stages of pregnancy by using guanidium isothiocyanate and purified over cesium chloride gradients [24]. Twenty micrograms of RNA was used for each RPA reaction following the manufacturer's recommendations (Ambion Inc., Austin, TX). Briefly, sample RNA was coprecipitated with 32P-labeled probes (2 x 106 cpm/sample) and the pellet suspended in 10 µl of hybridization buffer and incubated at 68°C for 10 min. Unhybridized cRNA was digested with a mixture of RNase A/T1 for 45 min at 37°C. The cRNA probe/mRNA hybrids were precipitated, separated in 6% acrylamide gels and visualized by autoradiography.
In Situ Hybridization
Probes were prepared essentially as described in the above section except that [35S-]CTP was used as a substrate to label the cRNA. Unincorporated [35S-]CTP was removed by centrifugation through a Sephadex G-50 column. The control probes (sense cRNA) were prepared in the same manner. The probes were used within 3 days. In situ hybridization was performed as described previously [18, 21]. Placental tissue (Day 100 ovine placentomes and Day 200 bovine placentomes) was sectioned (14 µm) at -18°C on an IEC cryostat (International Equipment Co., Needham Heights, MA) and mounted onto prechilled microscope slides. The sections were fixed in 4% formaldehyde in PBS for 5 min, washed in 2x SSC (1x SSC; 0.3 M NaCl, 0.03 M sodium citrate, pH 7.0) for 2 min, acetylated in 0.25% acetic anhydride in 0.1 M triethanolamine (pH 8.0) for 10 min, rinsed twice in 2x SSC and dehydrated sequentially through 70%, 80%, 95%, and 100% ethanol. To increase the accessibility of the target mRNA, the tissue was soaked to remove lipid membranes in 100% chloroform for 5 min, rehydrated in 100% ethanol for 2 min, 95% ethanol for 2 min, and air dried. Hybridization was performed by application of about 200 µl of probe solutions (4 x 106 cpm) to cover each section and incubated at 55°C for 12–18 h. After hybridization, the slides were dipped in 2x SSC to remove the excess hybridization buffer, treated with RNase A (50 µg/ml in PBS) for 30 min at 37°C to eliminate probes that were not hybridized. The sections were then washed at 55°C in 2x SSC for 15 min, in 50% formamide in 2x SSC for 30 min, and twice in 0.1x SSC for 15 min. Slides were again dehydrated, air dried, coated with Kodak NTB-2 emulsion (Eastman Kodak, Rochester, NY), and exposed for 1–4 wk at 4°C. Finally, the slides were developed, counterstained with hematoxylin and eosin, and examined microscopically.
RESULTS
Cloning of PAG Transcripts from Day 25 and Term Bovine Placenta
The cloning of several new bovine and ovine PAG was described previously [17]. These were bovine PAG-4 through PAG-12 and ovine PAG-2 through PAG-9 (PAG are numbered in the order in which they were discovered). To characterize better the scope of the PAG family within ruminants, further cloning work was performed.
In term placenta, RT-PCR cloning led to the identification of two PAG (boPAG-13 and -14) that were distinct from those described previously [17]. In Day 25 placenta RNA, two procedures were employed to identify PAG cDNA: RT-PCR and hybridization screening of a cDNA expression library. In the RT-PCR procedure, 5' and 3' primer mixtures were used to amplify PAG cDNA. The oligonucleotides annealed to conserved sequences encompassing the beginning and end of the open reading frames of PAG genes that had been characterized earlier [17]. Of the several hundred cDNA that were cloned following RT-PCR, 106 were sequenced. This procedure identified six novel clones that differed by at least 5% in nucleotide sequence identity from other boPAG cDNA [17]. These PAGs have been named boPAG-15 through -20 to reflect the order in which they were characterized. The most common transcripts found at Day 25 by this screening procedure were boPAG-2 and boPAG-9.
Hybridization screening of the Day 25 placental cDNA library with a mixture of cDNA probes revealed many positive phage clones. In this procedure, the most common cDNA were those for boPAG-2 and boPAG-8, but a broad range of others was also present. A single novel PAG was identified by this approach, boPAG-21.
Figure 1 is an unrooted GROWTREE phylogram based on the degree of divergence of amino acid sequences among the PAG that have so far been cloned from cattle and sheep ([17]; this manuscript). From this analysis, the bovine and ovine PAG can be divided into two clearly distinct groupings. One branch of the tree contains boPAG-2, -8, -10, -11, -12, -13, and ovPAG-2. The other, larger branch is comprised of the remaining PAG that have been identified so far.
|
Localization of PAG mRNA by In Situ Hybridization
In situ hybridization was used to characterize the cell-specific expression of several PAG. Although in situ hybridization may not be capable of distinguishing between closely related mRNA, we have previously shown that boPAG-1 and boPAG-2 mRNA, which exhibit 73% nucleotide sequence conservation across their open reading frames, showed no appreciable cross-hybridization in the conditions at which the in situ hybridizations were performed. In those experiments, it was demonstrated that boPAG-1 mRNA was confined to trophoblast binucleate cells [7], while boPAG-2 and presumably its close relatives were expressed more uniformly throughout the trophectoderm [19]. Here, this approach has been carried further in order to determine the cell-specific expression of additional PAG genes from sheep and cattle (ovPAG 1–9 and boPAG 1, 2, 4–11).
Figure 2 demonstrates examples of the in situ analysis. The micrographs show clearly that ovPAG-2 was expressed throughout the trophectoderm, even as early as Day 13 after conception (Fig. 2, A–F). In contrast, ovPAG-3 was expressed predominantly in binucleate cells as indicated by the localized expression pattern seen in the placentome cross-sections (Fig. 2, G and H). In Figure 2, I–L, are examples of PAG expression in bovine placentomes. Shown are examples of expression throughout the trophectoderm (boPAG-8; Fig. 2, I and J) and binucleate cell expression (PAG-9; Fig. 2, K and L). Notably, those PAG found to be expressed predominantly in binucleate cells also provided some signal, albeit fairly weak, over the trophectoderm as a whole. It is possible that this hybridization to mononucleate cells is the result of a somewhat broader expression pattern than observed earlier with boPAG-1 and ovPAG-1 [7]. Figure 3 summarizes the expression pattern of the ovine and bovine PAG mRNA. In sheep, only ovPAG-2 was expressed in both mononucleate and binucleate cells. In cattle, PAG-2, -8, -10, and -11 were expressed throughout trophectoderm while PAG-1, -4, -5, -6, -7, and -9 were expressed predominantly in binucleated cells within trophectoderm.
|
|
Temporal Expression of PAG in Bovine and Ovine Placental RNA
During the cloning of PAG from libraries and from PCR analysis of reverse-transcribed RNA, it became clear that some PAG were expressed at certain stages and were absent at others. To investigate this further, Northern blotting was performed on placental RNA from different stages of pregnancy with short PAG probes. The hybridization was performed under stringent conditions to compare the expression of individual PAG. In Figure 4, differences in expression between transcripts similar to boPAG-9 and boPAG-1, respectively, are clearly evident, with boPAG-9-like transcripts being expressed predominantly in early pregnancy and boPAG-1-like transcript expression becoming prevalent at later stages. Northern blot analysis, however, may not be ideal for assessing the presence or absence of individual transcripts because of the varying degrees of cross-hybridization that can occur between the probe and transcripts related in nucleotide sequence.
|
In order to provide further confirmation that there were changes in the relative expression of different boPAG as pregnancy progressed, the presence of individual PAG mRNAs was assessed by RNase protection with specific antisense probes. Figure 5A shows representative assays performed on 20 µg of bovine placenta RNA extracted at seven different stages of pregnancy. It is evident from Figure 5A that the different PAG transcripts assayed were not equally represented at each stage of pregnancy. For example, boPAG-1 was not detectable at Day 25, but was expressed at Days 45, 60, 88, 150, and 250. It was absent in RNA from term placenta. By contrast, boPAG-2 mRNA was represented at all stages. Bovine PAG-9, a clone in the same grouping as boPAG-1, was present at Day 25 and its expression seemed to decline as pregnancy progressed, until, like boPAG-1, it was undetectable at term. It should be noted that there are minor discrepancies in the expression patterns exhibited between Figures 4 and 5, particularly for boPAG-1. Whether this is due to individual animal variation, or errors associated with using crown-rump as an estimate of gestational age, is not known. However, the results obtained from the RNase protection assays are consistent with the data obtained in the Northern analysis.
|
Ribonuclease protection assays were carried out on RNA isolated from sheep conceptuses and placental tissue throughout pregnancy. Figure 5B provides an example of such data for ovPAG-2 and ovPAG-3. Ovine PAG-2 transcripts were present at all stages of pregnancy examined, whereas mRNA for the latter was not detected at the two earliest stages (Days 13 and 16). The protection data emphasize that, at each of the stages examined, many different RNA transcripts were present that closely resembled, but were not identical, to the PAG probes used in the assays. This multiplicity is evident from the "ladders" of partially protected probe observed in many of the lanes (Fig. 5B). Some of these bands are as dense or denser than the full-length protected band. It seems reasonable to assume that these transcripts were closely related in sequence, but not identical, to the mRNA under analysis, because the probes themselves were fully digested in the presence of yeast RNA. Figure 5B also illustrates an important point regarding how the protection assay could discriminate easily between closely related transcripts. Indeed, as few as three base mismatches could be differentiated. The probe constructs for ovPAG-2 and ovPAG-3 were generated with the same primers. The primers were a perfect match for the ovPAG-3 cDNA, but they produced mismatches at three positions relative to the ovPAG-2 mRNA. These mismatches can account for why the protected ovPAG-2 probe is slightly shorter than the one for ovPAG-3.
The protection assays were performed at least twice for each PAG riboprobe. The results are summarized in Fig. 6. Of the bovine PAG transcripts that were examined, most were present at Day 25, although PAG-1, -6, and -7 were not detectable until the Day 45 time point. Furthermore, those PAG that were expressed predominantly in binucleated cells were invariably absent in term placenta. Those PAG expressed more uniformly throughout trophectoderm were detectable at all stages examined. For sheep placental RNA, only ovPAG-2 was expressed at Day 13. At Day 16, ovPAG-5 and ovPAG-7 expression was detectable. The onset of expression of ovPAG-3, -6, -8, and -9 occurred still later in pregnancy. At Days 88, 100, and 130, all seven genes were expressed.
|
DISCUSSION
Pregnancy diagnosis is an important part of sound reproductive management, particularly in the dairy industry. The main aim of this study was to characterize the expression of the novel PAG described earlier [17] in order to identify candidate PAG that may provide antigens with which to establish a test for pregnancy that overcomes the disadvantages of existing procedures. Toward this end, three approaches were applied for the study of this gene family. The first was to identify novel PAG expressed in the bovine placenta to understand better the scope of the PAG family in cattle. The second was to investigate the cell-specific expression of several recently discovered PAG to determine whether there are any particular features that distinguish those PAG that are binucleate cell-specific from those that are expressed throughout the trophectoderm. The third aim was to examine the temporal patterns of expression of these PAG. Are there, for example, ones that predominate in early versus late pregnancy? Clearly, the ideal antigen for an early test would be a PAG that was expressed in binucleate cells around the time of implantation. Such a molecule would most likely enter the maternal bloodstream and might provide a useful indicator of pregnancy status.
The cloning work described here confirms that numerous PAG genes are expressed in the placenta of cattle. Our cutoff for novel genes was greater than 5% nucleotide sequence difference from previously identified PAG members. This decision was made arbitrarily to reduce the amount of complete, bidirectional sequencing that had to be done, but it undoubtedly led to our disregarding many novel transcripts that were not allelic forms. Some of the new cDNA identified in this work were found to possess mutations within their active-site regions that would be predicted to disrupt catalysis or enzyme–substrate interactions, as has been described previously [17]. For example, boPAG-19 (accession no. AF192336) has an isoleucine in place of the normally invariant threonine within the DTG motif in the carboxyterminal lobe of the molecule. Bovine PAG-20 (accession no. AF192337) has a mutation reminiscent of boPAG-1 in which the glycine in the DTG motif within the aminoterminal lobe has been substituted with an alanine. This type of substitution may interfere with catalysis by displacing a water molecule that resides between the catalytic aspartic acids and is involved in the catalytic mechanism [7, 16]. Several splice variants, lacking various exons, have been identified in the grouping representing bo and ovPAG-1 (data not shown). The biological importance of these splice variants is not yet understood. It is also worth noting that the PAG-1 group has a surprisingly high rate of nonsynonymous substitutions within the coding regions of these cDNA (manuscript in preparation). It appears that these PAG are undergoing diversification at a rapid pace.
The in situ hybridization experiments performed on both cattle and sheep tissues showed that the PAGs were distributed into two groups: those that were expressed predominantly in binucleate cells and those PAG whose mRNA was found throughout the trophectoderm. A simple phylogenetic tree based on amino acid sequences (Fig. 1) demonstrated that this analysis could separate the two kinds of PAG. It would appear that the binucleate cell group probably evolved by the duplication, and subsequent amplification, of a precursor gene that belonged to the PAG-1 grouping. Based on the phylogenetic analysis, eight of the newly discovered bovine PAG (boPAG-14, -15, -16, -17, -18, -19, -20, and -21), whose expression has not been studied by in situ hybridization, would be predicted to be expressed predominantly in binucleate cells. Conversely, boPAG-13 would be expected to be expressed throughout the trophectoderm because of its close similarity to boPAG-2.
The RNase protection assays performed on bovine placental RNA showed that different PAG genes had different temporal patterns of expression during pregnancy. Because this technique allows transcripts differing by only a few nucleotides to be distinguished, its use was highly appropriate in the present study where many closely related genes are coexpressed. Bovine PAG-2 and boPAG-11 have been detected in in vitro-derived blastocysts (unpublished). These PAG forms are detectable throughout gestation and belong to the group expressed in both mononucleate and binucleate cells of the trophectoderm. Several other PAG genes became apparent as early as Day 25, including boPAG-4, -5, -8, -9, -10, and -11. Notably, boPAG-1, -6, and -7 were not detectable at this stage, although some partially protected bands were noted (data not shown). Finally, most boPAG become undetectable at term. Of those that were tested, only boPAG-2, -8, -10, and -11 were detectable in RNA from this stage. Somewhat comparable observations were made regarding PAG expression in the sheep placenta. The dominant transcript in early pregnancy, ovPAG-2, was expressed at all stages, whereas others (e.g., ovPAG-3) were initiated at later times. Term placenta was not analyzed. These temporal shifts in PAG gene expression are not unlike those observed in rodents where the same trophoblast giant cells produce a changing complement of placental lactogens as pregnancy progresses [25].
Bovine PAG-1, PSPB, and PP60 have each been used to provide sensitive tests for pregnancy in cattle and related ruminants based on their apparent presence in the blood as early as the third week postinsemination [10, 12, 13]. These proteins have identical N-terminal sequences and are presumably identical or very closely related (unpublished results). Concentrations of these antigens have been reported to be low and somewhat variable in early pregnancy. As pregnancy proceeds, concentrations of the antigen rise over two orders of magnitude and can exceed 1 µg per ml of blood close to term. As a result, PAG-1-reactive material persists in maternal blood postpartum and can confound pregnancy tests on cows bred within 2 mo of calving [10, 14]. Interestingly, such persistence of antigen has not been noted in sheep, where levels decline immediately after the end of pregnancy [26]. In contrast to these earlier reports, our data strongly suggest that PAG-1 is not a major product of the cow trophoblast at Day 25 of pregnancy. Transcript frequency was extremely low, as judged by both RT-PCR and library screening (data not shown), and no mRNA could be detected by the highly sensitive RNase protection procedure. Indeed, immunoscreening of the bovine Day 25 placental library with an anti-PAG-1 serum revealed only the cDNA for boPAG-4, a transcript with 76% identity to that for boPAG-1 (data not shown). Presumably, boPAG-1 and boPAG-4 share a common epitope(s) that allows the boPAG-1 antiserum to bind to boPAG-4 fusion proteins expressed during the library screen. We propose, therefore, that the predominant protein antigen in the blood of pregnant cows around Day 25 that is recognized by the current PAG radioimmunoassays [12, 13] is probably boPAG-4, or a similar antigen, and not boPAG-1. Neither boPAG-1 nor boPAG-4 appears to be an ideal candidate for a pregnancy test because boPAG-1 is expressed minimally, if at all, at Day 25, and both are highly expressed until at least Day 250. Each may contribute to the high levels of circulating PAG detectable in the postpartum period. A better candidate might be a protein such as boPAG-9 that appears to be expressed predominantly in early pregnancy. Furthermore, because boPAG-9 is a product of the invasive binucleate cells, it is likely to enter the maternal blood circulation.
ACKNOWLEDGMENTS
We thank Jim Bixby for his assistance with the sequencing and analysis of the clones.
FOOTNOTES
First decision: 21 December 1999.
1 Supported by USDA/NRI grant 96-35203-3257 and a grant from Monsanto Co. The PAG cDNA sequences described in this manuscript have been deposited in the GenBank database (bovine PAG accession numbers: M73961, L06153, L06153, AF020506-AF020514, and AF192330–AF192338; ovine PAG accession numbers: M73962, U30251, and U94789-U94795). 
2 Correspondence: Dr. R. Michael Roberts, Department of Animal Sciences, University of Missouri, 158 Animal Science Research Center, 920 E. Campus Dr., Columbia, MO 65211-5300. FAX: 573 882 6827; robertsrm{at}missouri.edu
3 Current address: Proctor and Gamble Co., Miami Valley Laboratories, P.O. Box 538707, Cincinnati, OH 45253-8707.
4 Both individuals contributed equally to the work described in this manuscript.
Accepted: January 24, 2000.
Received: November 24, 1999.
REFERENCES
This article has been cited by other articles:
|
|
 |
|
  N. I Alexopoulos, P. Maddox-Hyttel, P. Tveden-Nyborg, N. T D'Cruz, T. R Tecirlioglu, M. A Cooney, K. Schauser, M. K Holland, and A. J French Developmental disparity between in vitro-produced and somatic cell nuclear transfer bovine days 14 and 21 embryos: implications for embryonic loss Reproduction, October 1, 2008; 136(4): 433 - 445. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. G Lea, P. Wooding, I. Stewart, L. T Hannah, S. Morton, K. Wallace, R. P Aitken, J. S Milne, T. R Regnault, R. V Anthony, et al. The expression of ovine placental lactogen, StAR and progesterone-associated steroidogenic enzymes in placentae of overnourished growing adolescent ewes Reproduction, April 1, 2007; 133(4): 785 - 796. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K Klisch, A Boos, M Friedrich, K Herzog, M Feldmann, N. Sousa, J. Beckers, R Leiser, and G Schuler The glycosylation of pregnancy-associated glycoproteins and prolactin-related protein-I in bovine binucleate trophoblast giant cells changes before parturition. Reproduction, November 1, 2006; 132(5): 791 - 798. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. R Arnold, V. Bordignon, R. Lefebvre, B. D Murphy, and L. C Smith Somatic cell nuclear transfer alters peri-implantation trophoblast differentiation in bovine embryos. Reproduction, August 1, 2006; 132(2): 279 - 290. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. E. Echternkamp, K. A. Vonnahme, J. A. Green, and S. P. Ford Increased vascular endothelial growth factor and pregnancy-associated glycoproteins, but not insulin-like growth factor-I, in maternal blood of cows gestating twin fetuses J Anim Sci, August 1, 2006; 84(8): 2057 - 2064. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Bertolini, C. R Wallace, and G. B Anderson Expression profile and protein levels of placental products as indirect measures of placental function in in vitro-derived bovine pregnancies Reproduction, January 1, 2006; 131(1): 163 - 173. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Song, T. E. Spencer, and F. W. Bazer Cathepsins in the Ovine Uterus: Regulation by Pregnancy, Progesterone, and Interferon Tau Endocrinology, November 1, 2005; 146(11): 4825 - 4833. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. A. Perry, M. F. Smith, M. C. Lucy, J. A. Green, T. E. Parks, M. D. MacNeil, A. J. Roberts, and T. W. Geary From the Cover: Relationship between follicle size at insemination and pregnancy success PNAS, April 5, 2005; 102(14): 5268 - 5273. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. V. Patel, O. Yamada, K. Kizaki, T. Takahashi, K. Imai, S. Takahashi, Y. Izaike, L. A. Schuler, T. Takezawa, and K. Hashizume Expression of Trophoblast Cell-Specific Pregnancy-Related Genes in SomaticCell-Cloned Bovine Pregnancies Biol Reprod, April 1, 2004; 70(4): 1114 - 1120. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. L. Hughes, J. A. Green, H. Piontkivska, and R. M. Roberts Aspartic Proteinase Phylogeny and the Origin of Pregnancy-Associated Glycoproteins Mol. Biol. Evol., November 1, 2003; 20(11): 1940 - 1945. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Chen, C. S. Rosenfeld, R. M. Roberts, and J. A. Green An Aspartic Proteinase Expressed in the Yolk Sac and Neonatal Stomach of the Mouse Biol Reprod, October 1, 2001; 65(4): 1092 - 1101. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. M. Roberts The Place of Farm Animal Species in the New Genomics World of Reproductive Biology Biol Reprod, February 1, 2001; 64(2): 409b - 417. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
