|
|
||||||||
Regular article |
a Departments of Physiology,
b Obstetrics and Gynecology, and
c Surgery (Division of Urology), McGill University, Montreal, Quebec, Canada H3A 1A1
ABSTRACT
The calcium-dependent cell adhesion molecules, cadherins, regulate intercellular junction formation, cell sorting, and the establishment of cell polarity. Their important role in tissue remodeling suggests an involvement in ovarian cellular rearrangements throughout postnatal development. The ovary has a complex topology, and the ovarian follicle undergoes significant cellular rearrangements during its development. Cadherins have been detected previously in whole ovaries and in ovarian cells and cell lines with some immunolocalization in fetal and adult ovaries. This study examines the expression and localization of N- and E-cadherin throughout prepubertal ovarian and follicular development in the rat. We analyzed ovarian cadherin expression in rats from Day 1920 of gestation to 25 days postpartum, during which follicle formation and folliculogenesis are the dominant ovarian events. Reverse transcriptase polymerase chain reaction detected N- and E-cadherin mRNA expression in the ovaries at all the ages examined. Semiquantification of Western blots of whole ovary extracts confirmed the presence of ovarian N- and E-cadherin protein at all ages with both showing peak expression at 7 days of age. Immunostaining revealed N- and E-cadherin expression in follicular and extrafollicular cell types, but only E-cadherin showed follicle-stage-dependent expression. The changes in cadherin expression, concurrent with ovarian growth and folliculogenesis, suggest a function for cadherins in the morphological and functional development of the prepubertal rat ovary.
follicle, follicular development, oocyte development
INTRODUCTION
Classical cadherins are a large family of transmembrane glycoproteins that mediate homophilic, calcium-dependent cell adhesion. This family of cell adhesion molecules (CAMs) includes E(pithelial)-, N(eural)-, and P(lacental)-cadherin. These CAMs are involved in the establishment and maintenance of an organized tissue architecture during early development and continuing on into adulthood [13]. The classical cadherins interact with the actin cytoskeleton through associations with cytoplasmic proteins (catenins). They facilitate the formation of intercellular junctions as well as cell sorting and rearrangement [1, 4]. These molecules, therefore, are important in tissue remodeling processes.
Previous studies in our laboratory have shown that steroid hormones are important regulators of cadherin expression in tissues of the reproductive system. In neonatal mice, ovarian N- and E-cadherin can be upregulated by estrogen, and uterine E-cadherin expression upregulated by both estrogen and progesterone [57]. Two cadherins have been identified in cells isolated from rat ovaries. N-cadherin is expressed in granulosa cells and E-cadherin is present in the ovarian surface epithelium [810]. Estrogen increases N-cadherin expression in isolated rat ovarian granulosa cells [8, 9, 11]. We have shown that cadherins regulate gonadotropin-dependent cell differentiation and signal transduction in these cells [9, 12, 13]. In addition, N-cadherin-mediated granulosa cell adhesion has been shown to prevent these cells from undergoing apoptosis [1416]. Collectively, these findings establish a role for cadherins as mediators of granulosa cell function and suggest that these CAMs are important in folliculogenesis.
The prepubertal ovary is an appropriate model for following the stages of folliculogenesis, including the initial organization and the early growth of follicles that characterize the developing ovary. Neonatal rat ovaries contain a synchronized population of follicles compared to adult ovaries [1719]. The initial assembly of granulosa cell-oocyte collectives into rat primordial follicles occurs primarily during the second and third days after birth [17]. A number of follicles begin growing and differentiating by Day 3 into small preantral follicles [17] that are responsive to FSH [20]. Ovaries from 7-day-old animals lack antral follicles, but in both mice and rats, small preantral follicles are abundant and are growing at a faster rate than in the adult [18, 21, 22]. Follicles with fluid-filled antra are observed as early as Day 13 of age [23, 24]. The ovaries contain many large antral follicles by Day 21 of age [23]. During the processes of follicular organization and growth, many complex cellular interactions and rearrangements occur [17, 19]. This constant remodeling of the ovarian architecture could, we suspect, result from changes in cadherin expression. In order to investigate this possibility, we have examined N- and E-cadherin expression and their localization during postpartum ovarian and early follicular development.
MATERIALS AND METHODS
Animals
Treatment and general care of all animals were approved by the Animal Care Committee of the Royal Victoria Hospital and complied with the regulations established by the Canadian Council on Animal Care. Female Sprague-Dawley rats were purchased from Charles River (St. Constant, PQ, Canada) and housed under a 12L:12D cycle. Ovaries were dissected from animals on 1920 days of gestation of timed pregnancies (e1920), and 1, 3, 7, 15, and 25 days postpartum (p). Attention was paid to the careful removal of oviductal tissue because this tissue expresses E-cadherin (unpublished observation). The ages were selected because the ovaries at these developmental stages possess a relatively synchronized population of follicles that represent specific stages of early follicular development [17, 21, 23, 24]. In the case of fetal, p1, and p3 ovaries, pregnant females were purchased. The day of birth was considered postpartum Day 1 (p1). The p7 and p15 animals were purchased as litters with lactating mothers. The sample size (n) was 38 for each age group. Each sample consisted of pooled ovaries from approximately 228 animals, depending on the size of the ovaries. For example, about 28 fetal ovaries were required to make one protein extract compared to 2 ovaries from p25 animals. Ovaries were frozen on dry ice and stored at -80°C until processed for RNA or protein extraction. Ovaries were also dissected from 3-, 7-, and 25-day-old rats for the purposes of immunohistochemical examination. In this case, ovaries were fixed in methanol and postfixed in ethanol before paraffin embedding. Ovaries from at least four animals were examined in each age group in the immunofluorescence study. In this case, oviductal tissue was not completely removed in order to allow easier handling of the dissected ovaries.
Extraction of RNA and Reverse Transcriptase Polymerase Chain Reaction
Frozen ovaries were pulverized on dry ice, and the resulting powder was dissolved in solution D (4 M guanidine thiocyanate, 25 mM sodium citrate, 0.5% sarcosyl, 0.72% ß-mercaptoethanol) followed by vortexing and sonication of the solution. The solution was extracted twice with phenol-chloroform followed by alcohol precipitation of RNA as described by Chomczynski and Sacchi [25]. Total RNA (5 µg) was reverse transcribed using murine Maloney leukemia virus reverse transcriptase (Pharmacia Biotech Inc., Baie d'Urfé, PQ, Canada) and a mixture of random hexamer primers (Pharmacia Biotech). Polymerase chain reaction (PCR) was performed using 100 ng of cDNA and oligonucleotide primers specific for conserved sequences of mouse N-cadherin (Genbank Acc. No. M31131) or human E-cadherin (Genbank Acc. No. L08599). The primer sequences for N-cadherin were: forward, CAAGAGCTTGTCAGAATCAGG (nucleotides [nt] 864884), and reverse, CATTTGGATCATCCGCATC (nt 12271209) and for E-cadherin: forward, CCTTCCTCCCAATACATCTCCC (nt 19501971), and reverse, TCTCCGCCTCCTTCTTCATC (nt 23812362). Taq DNA polymerase (Pharmacia Biotech) was used in the PCR reaction that was conducted with an annealing temperature of 55°C, elongation at 72°C for 1 min, and denaturing at 94°C for 30 sec, for 35 cycles. The products of the PCR procedure were visualized on a 1% agarose gel containing 1 µg/ml ethidium bromide in TBE buffer (89 mM Tris base, 89 mM boric acid, 2 mM EDTA). The PCR products from 25-day-old animals underwent gel purification, cloning and sequence analysis to confirm the identity of the PCR products.
Protein Extraction
Frozen tissue was pulverized on dry ice and added to 1.5 ml ice-cold extraction buffer (10 mM Tris, pH 7.4, containing 1 mM CaCl2, and 1 µg/ml of protease inhibitors, pepstatin A, PMSF, leupeptin, soybean trypsin inhibitor, and aprotinin). The suspension was sonicated twice for 10 sec at 5 W (Vibra Cell, Sonics and Materials Inc., Danbury, CT) and centrifuged at 10 000 x g for 10 min to remove insoluble material. The supernatant was recentrifuged at 100 000 x g for 1 h at 4°C and the pellet resuspended in extraction buffer. Total extracts of rat ovary, heart, and uterus were prepared as described above but without the high-speed centrifugation. Solubilization buffer for SDS-PAGE (final concentrations of 62.5 mM Tris, pH 6.8, containing 2% SDS, 10% glycerol, and 5% ß-mercaptoethanol) was added to the samples. The samples were boiled for 5 min, frozen, and stored at -40°C until needed. Sample protein content was assayed by analysis of amido black-stained dot blots using known concentrations of BSA to construct a standard curve [26].
SDS-PAGE and Western Blotting
Protein samples (4 µg) were resolved by SDS-PAGE on an 8% running gel with a 5% stacking gel [27]. A protein extract from the ovaries of a proestrous rat was included on each gel. This sample acted as a standard for normalization and allowed comparisons between samples run on separate gels. The resolved proteins were electrophoretically transferred [28] overnight at 0.8 A onto a polyvinylidene fluoride membrane (Bio/Can Scientific Inc., Mississauga, ON, Canada) in transfer buffer (25 mM Tris, pH 8.0, 192 mM glycine, and 20% methanol) containing 0.1% SDS. Membranes were stained with Ponceau-S (Sigma, Oakville, ON, Canada) to confirm protein transfer and destained in Tris-buffered saline with Tween 20 (TBS-T) (25 mM Tris, pH 8.0, 150 mM NaCl 0.1% Tween 20).
Membranes were immersed in blocking buffer (I-Block from Bio/Can Scientific) for 1 h at room temperature and incubated overnight at room temperature with mouse monoclonal antibodies against either N- or E-cadherin. The anti-N-cadherin (13A9) [29] was diluted 1:150, and the anti-E-cadherin antibody (clone 36) (Transduction Laboratories, Bio/Can Scientific) [30] was diluted 1:125 in blocking buffer. Total extracts from rat heart and uterus (20 µg) were used as positive controls. Blots were washed twice (5 min/wash) with TBS-T followed by three washes (5 min/wash) in blocking buffer. Membranes were incubated 2 h at room temperature with an alkaline phosphatase-conjugated second antibody (rabbit anti-mouse IgG, Bio/Can Scientific) diluted 1:2500 in blocking buffer. The blots were washed as before with two additional washes of 5 min in assay buffer (0.1 M diethanolamine, 1 mM MgCl2, pH 10) as per manufacturer's instructions for the chemiluminescent detection system (Bio/Can Scientific). The chemiluminescence substrate (CSPD; Bio/Can Scientific) was diluted 1:100 in assay buffer and incubated with the blots for 5 min in the dark. The substrate was removed and the membranes wrapped in cellophane and exposed to film (Kodak BioMax; VWR Canlab., Ville St-Marie, PQ, Canada). Multiple exposure times were used, and appropriate films were chosen for subsequent analysis.
Immunofluorescence
Paraffin sections (45 µm thick) were deparaffinized in xylenes and a graded alcohol series, and then rehydrated in phosphate buffer (PB: 0.1 M Na2HPO4, pH 7.4) for 45 min. As an antigen retrieval step, all slides were incubated in a Triton X-100 solution (0.4% in PB) for 30 min at 37°C and then washed twice for 5 min in PB. Other antigen-retrieval methods were tested, such as heating, steaming [30], anionic and ionic detergents, and combinations of these. The nonionic detergent, Triton X-100, consistently produced the best results. Primary antibodies toward N-cadherin and E-cadherin were diluted 1:3 in PB and incubated on the slides overnight at 37°C in a humid chamber. Different dilutions of the primary antibodies were assessed, with some staining observed at 1:81:4 for both antibodies and none if an antigen-retrieval step was not included (data not shown). After incubation with the primary antibody, slides were washed three times for 15 min each in PB. Secondary antibodies, rabbit anti-mouse IgG, conjugated to fluorescein isothiocyanate (FITC) were diluted (1:400) in PB and incubated on the slides in the dark at room temperature for 2 h in the humid chamber. Slides were washed as described above, mounted (Moviol 4-88 with 2.5% 1,4 diazabicyclo-[2.2.2]octane), and counterstained with 0.5 µg/µl 4',6'-diamidino-2-phenylindole (DAPI). Negative controls consisted of mouse serum used at the same dilution as the primary antibodies, as well as slides that were incubated with only the secondary antibody. Control tissues, rat brain, uterus, and heart were stained as well to verify antibody specificity. Observations of ovaries from at least four animals at 3, 7, and 25 days of age translates to observations of approximately 500, 300, and 100, primordial, primary, and antral follicles, respectively. Images were captured digitally using a computer image analysis system attached to an Olympus BX60 fluorescence microscope.
Statistical Analysis
Densitometric analysis of scanned films was used to quantify the Western blots. Optical density values of all bands were normalized to the value obtained for the standard sample (rat proestrous ovary extract) that was included on each gel. This allowed comparison between samples run on different gels. Each value was then calculated as a percentage of mean peak (the highest mean value for the data set). For both N- and E-cadherin, the mean peak was at p7. The data are shown as averages with corresponding standard errors. Data were analyzed by ANOVA, and multiple comparisons were performed using the Duncan's multiple range test with a significance level of P < 0.05. Statistically significant differences are represented graphically as groups not sharing the same letter assignment.
RESULTS
Messenger RNA for N- and E-Cadherin in Fetal and Prepubertal Rats
Reverse transcriptase PCR with specific primers to N- and E-cadherin yielded products of the appropriate size as predicted from the primer positions, i.e., 364 and 432 base pairs for the mouse and human sequences, respectively (Fig. 1, A and B). Ovary extracts from all of the prepubertal ages examined indicated the presence of both N- and E-cadherin mRNA. At least three different PCR reactions for each sample were performed. Sequence analysis of PCR products from 25-day-old rat ovaries confirmed the amplification of N- and E-cadherin transcripts by these primers in rat tissue (data not shown).
|
Cadherin Detection with Western Blotting
The N-cadherin-specific monoclonal antibody recognized a single protein species of 130 kDa in the ovarian extracts (Fig. 2A). The E-cadherin-specific monoclonal antibody recognized a protein species of 120 kDa, but commonly a second band with lower molecular mass near 110 kDa also appeared (Fig. 2B).
|
The pellet from the high-speed centrifugation (100 000 x g) in the ovarian tissue protein extraction was enriched in E- and N-cadherin compared with the total extract (Fig. 2). Total extracts from rat heart and uterus, known to contain N- and E-cadherin, respectively, were used as positive controls (Fig. 2) [7, 31]. The uterus contained little if any N-cadherin (Fig. 2A) and the rat heart no E-cadherin (Fig. 2B), and so these tissues also served as the appropriate negative controls for Western blotting.
Ovarian N- and E-Cadherin Protein Levels in Fetal and Prepubertal Rats
The relative N- and E-cadherin levels in the ovaries of fetal and prepubertal rats are shown in Figures 3 and 4. The upper panels show representative composite immunoblots and the lower panels summarize the densitometric analysis for ovarian N- and E-cadherin expression from six separate blots. The highest N- and E-cadherin levels were observed in p7 ovaries (Figs. 3 and 4). Hence, the densitometric analyses are shown as a percentage of the mean peak value. This permits comparisons to be made and obviates the arbitrary selection of a particular age as the normalizing value. Expression of N-cadherin in e1920, p1, and p3 ovaries was approximately 30% of the p7 values. The p15 and p25 ovaries also expressed comparably lower N-cadherin levels (Fig. 3). Expression of E-cadherin in e1920, p1, p3, p15, and p25 ranged between 3065% of the p7 values (Fig. 4). The overall pattern of E-cadherin expression in fetal and prepubertal rat ovaries was similar to that of N-cadherin, notably with regard to peak expression at p7. Unlike N-cadherin, E-cadherin protein expression showed a significant age-related decline over the p7p25 age period.
|
|
Immunostaining of N- and E-Cadherin in Control Tissues
The rat brain, known to express N-cadherin [31], showed discrete staining localized to Purkinje cells within the cerebellum (Fig. 5A). This is similar to N-cadherin expression reported in the adult mouse cerebellum [32]. The rat uterus did not show staining for N-cadherin (Fig. 5B), but uterine E-cadherin staining localized to the epithelium lining the lumen (Fig. 5C). The rat heart was negative for E-cadherin staining (Fig. 5D). These discrete staining patterns demonstrate the specificity of each antibody within rat tissues.
|
Ovarian N- and E-Cadherin Protein Distribution in Prepubertal Rats
Immunofluorescent staining for N-cadherin revealed a low level of ubiquitous staining in both 3- and 7-day-old ovaries (Fig. 6, A and B). Fluorescence appeared in all cell types visible in the ovary at these ages including oocytes, granulosa cells, interstitium, and surface epithelium. All oocytes showed peripheral staining, but cytoplasmic staining varied in intensity (Fig. 6, A and B). Staining in 25-day-old rat ovaries was present throughout much of the ovary, but with portions of the interstitial tissue stained less, notably the elongated interstitial cells near the hilus (Fig. 6C). The granulosa cells and oocytes in these animals showed pronounced staining (Fig. 6C). Another monoclonal antibody (GC-4; Sigma-Aldrich Canada Ltd., Oakville, ON, Canada), raised against chicken N-cadherin, stained rat ovaries with patterns similar to 13A9 but had overall weaker staining at the same dilutions (data not shown). Both negative controls, secondary antibody alone, and mouse serum gave similar results and only the former is shown (Figs. 6D, 7D, 8E, 9E).
|
Expression of E-cadherin was also found to be pervasive in 3- and 7-day-old ovaries (Fig. 7, A and B) but was more restricted in the ovaries of 25-day-old rats (Fig. 7C). Staining for E-cadherin in primordial follicles in the 7-day-old appears brighter compared with the surrounding cells (Fig. 7B). Oocytes of primordial follicles show peripheral staining for E-cadherin with variation in the amount of cytoplasmic staining (Fig. 7, A and B). Staining in the 25-day-old was largely confined to areas of the interstitium, theca, and surface epithelium (Fig. 7C).
|
Distribution of N- and E-Cadherin During Follicular Development
Immunostaining for N-cadherin in the 25-day-old animal was present in follicles at all stages of development (Fig. 8). Both the oocytes and granulosa cells in 25-day-olds showed staining in the primordial and early growing primary follicles (Fig. 8, A and B) that was similar to what was observed for the 3- and 7-day-old animals (Fig. 6, A and B). Staining of N-cadherin was also present in larger preantral and antral follicles (Fig. 8, C and D). Staining for E-cadherin was observed in oocytes and granulosa cells of primordial follicles in 3-, 7-, and 25-day-olds (Figs. 7A and 9A). This follicular staining was diminished in the oocyte compared to the granulosa cells in primary follicles (Figs. 7B and 9B), with staining becoming undetectable in both the oocyte and granulosa cells in larger follicles (Fig. 9, C and D).
|
|
DISCUSSION
Follicle formation and folliculogenesis are the dominant developmental events of the vertebrate ovary. Although primordial follicle formation and the initiation of follicle development occurs in the ovary of many mammals during fetal development [3335] (except for the rodent where these occur in the immediate postpartum period) [17], subsequent folliculogenesis extends throughout the reproductive life of the female. Considerable progress has been made in our understanding of the regulation of physiological and molecular events involved in follicle maturation and ovulation [36, 37]. In contrast, little is known with respect to the underlying mechanisms involved in the morphogenetic processes controlling ovarian follicle formation and folliculogenesis. The results from our study indicate that cadherins may play an important role in these processes. Although cadherins have been previously detected in ovarian tissue and cells, this is the first study detailing cadherin expression during the prepubertal period where follicle development is beginning.
Our results show that both N- and E-cadherin mRNA and protein are expressed in the ovary throughout prepubertal development in the rat. The secondary bands in our Western blots for E-cadherin have often been observed in this type of analysis [3842], and a similar size band has been recently identified as a degradation product of internalized E-cadherin [43]. This internal degradation product was not included in the analysis and only the 120-kDa band was used in the quantification. The use of a high-speed centrifugation step in the protein extraction method to enrich the extracts in cadherins was particularly important for analysis of the fetal and newborn ovaries from which only small amounts of protein could be extracted. This enriched protein preparation was used for all the subsequent Western blot analyses of rat ovarian N- and E-cadherin. In our study, the highest levels of N- and E-cadherin are seen in ovaries of 7-day-old animals by Western blotting. Interestingly, in the rat testis and mouse and porcine ovary, E-cadherin mRNA and protein levels show a decline with increasing age [1, 40, 41]. These observations would be consistent with the idea that cadherins play a role in the organizational processes of the early developing ovary.
It is not clear what regulatory factors or stimuli are responsible for the elevation in ovarian N- and E-cadherin in 7-day-old rats. We have previously shown that exogenous estrogen can stimulate ovarian N- and E-cadherin expression in neonatal and prepubertal rodents, but it is an unlikely candidate because Carson and Smith [24] have shown minimal ovarian estrogen production in the 7-day-old. The levels of other circulating hormones, such as the gonadotropins or progesterone, are also low in rats 1 wk of age [44]. Insulin-like growth factor, basic fibroblast growth factor, transforming growth factor-ß, and cAMP can downregulate cadherin expression, and these factors are expressed in the developing ovary [16, 4553]. Hence, there are a number of candidate factors that could be responsible for changes in cadherin expression in the prepubertal ovary.
Our immunostaining data indicate that there are also dramatic changes in the distribution pattern of N- and E-cadherin expression in the prepubertal ovary. At 7 days of age, the oocytes and the investing granulosa cells of primordial follicles exhibit brighter staining for E-cadherin compared to the stromal cells (Figs. 6B and 7B), unlike the 3-day-olds that had more homogeneous staining throughout the ovary. This could account for the elevated levels of E-cadherin detected at this age by Western blotting compared to the 3-day-olds. Elevation of N-cadherin protein levels at 7 days of age compared to 3-day-olds may be due to an overall increase in expression throughout the ovary which would not be detected by our immunostaining technique due to intensity compensation by the image capture system. To our knowledge, expression of both N- and E-cadherin in follicle-enclosed oocytes is a novel observation. Expression of N- and E-cadherin in oocytes of embryonic mice, and E-cadherin in human ovaries and ovulated mouse oocytes, has been previously shown [5458]. Our observation of higher ovarian cadherin expression at 7 days of age compared to just after primordial follicle formation (between the day of birth and Day 3 in the rat) [17] could function to consolidate and maintain these structures. The fact that intense staining for N- and E-cadherin is still seen in primordial follicles in ovaries of 25-day-old animals (Figs. 8A and 9A) is consistent with this possibility. It is intriguing that E-cadherin expression in both the oocyte and in the investing granulosa cells was follicle-stage dependent (Fig. 9). The loss of E-cadherin expression may trigger the initiation or allow for the entry of primordial follicles into the pool of growing follicles. The signal for the initiation of primordial follicle growth remains unknown, although recent studies suggest that kit ligand (stem cell factor) interaction with its receptor, c-kit, may be part of this signal [59, 60]. Our observed decline in granulosa cell E-cadherin expression could be related to the decrease in adherens junctions in maturing folliclesparticularly those of the preovulatory stage [61, 62].
Unlike E-cadherin, N-cadherin expression is maintained in the granulosa cells and oocytes of follicles as they progress through the preantral and antral stages of follicular development. Antrum formation must involve alteration of adhesion in what were previously adherent granulosa cells. The lack of any changes in N-cadherin expression in follicles undergoing antrum formation suggests that either this CAM is not involved in the process of antrum formation, or that other factors that can alter N-cadherin-mediated adhesion function, in a highly position-specific manner, are brought into play.
The distribution patterns of ovarian N- and E-cadherin expression in the extrafollicular areas are also complex. Our immunostaining detected both N- and E-cadherin expression in the surface epithelium of the ovary that remained unchanged over the entire developmental period examined. N-cadherin has also been detected in cultured rat ovarian surface epithelial cells [15]. Expression of E-cadherin in isolated rat and porcine ovarian surface epithelial cells has been previously reported [10, 42]. Expression of E-cadherin has also been reported for human ovarian surface epithelium [63], although there are reports that challenge this finding [43]. Expression of E-cadherin in the interstitial cells of the rat ovary is retained during development, with expression in some, but not all theca cells. Ryan et al. [41] have reported E-cadherin expression in isolated theca cells of the pig. E-cadherin is viewed as an important adhesion molecule for most epithelia and N-cadherin appears to be more prevalent in nonepithelial tissues such as in the heart and brain [31]. Yet, in the developing ovary, E-cadherin expression is most abundant in the mesenchymal theca-interstitial compartment, while N-cadherin is prevalent in the more epithelial compartment (i.e., the membrana granulosa). These observations indicate that categorization of cadherins to particular cell types cannot be generalized and depend on the nature of the tissue under examination.
Previous studies have shown that cadherins are involved in follicular function at the late preantral and antral stages of follicle development [8, 1214, 16]. The studies presented here advance the knowledge of cadherin expression during prepubertal ovarian development. They are the first to localize and detail changes in cadherin expression in follicles and maturing oocytes. The distribution of cadherin expression suggests a degree of compartmentalization coincident with developmental and organizational processes within the ovary. This is consistent with the idea that cadherins could have an important role in the production and maintenance of the ovarian architecture during growth and folliculogenesis.
ACKNOWLEDGMENTS
We thank Dr. Karen Knudsen (Lankenau Medical Research Centre, Wynnewood, PA) for her kind donation of the anti-N-cadherin antibody used in this study. Our thanks also go to Debbie Blake (Department of Obstetrics and Gynecology, McGill University, QC) for the sequencing of PCR products.
FOOTNOTES
1 Supported by grants to O.W.B. (MRC #MT13471) and R.F. (MRC #MR1109, NSERC #21587698), and an NSERC studentship to N.H.M. ![]()
2 Correspondence: Naomi H. Machell, Royal Victoria Hospital, F3.45 Women's Pavilion, 687 Pine Avenue West, Montreal, PQ, Canada H3A 1A1. FAX 514 843 1662; nmachell{at}muhc.mcgill.ca ![]()
Accepted: April 21, 2000.
Received: January 28, 2000.
REFERENCES
This article has been cited by other articles:
![]() |
T. Sato, Y. Kanai, T. Noma, M. Kanai-Azuma, S. Taya, T. Matsui, M. Ishii, H. Kawakami, M. Kurohmaru, K. Kaibuchi, et al. A close correlation in the expression patterns of Af-6 and Usp9x in Sertoli and granulosa cells of mouse testis and ovary Reproduction, November 1, 2004; 128(5): 583 - 594. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ricken*, P. Lochhead, M. Kontogiannea, and R. Farookhi Wnt Signaling in the Ovary: Identification and Compartmentalized Expression of wnt-2, wnt-2b, and Frizzled-4 mRNAs Endocrinology, July 1, 2002; 143(7): 2741 - 2749. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Wright, S. Toth-Fejel, R. L. Stouffer, and K. D. Rodland Proliferation of Rhesus Ovarian Surface Epithelial Cells in Culture: Lack of Mitogenic Response to Steroid or Gonadotropic Hormones Endocrinology, June 1, 2002; 143(6): 2198 - 2207. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |