Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Machell, N. H.
Right arrow Articles by Farookhi, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Machell, N. H.
Right arrow Articles by Farookhi, R.
Agricola
Right arrow Articles by Machell, N. H.
Right arrow Articles by Farookhi, R.
Biology of Reproduction 63, 797-804 (2000)
© 2000 Society for the Study of Reproduction, Inc.


Regular article

Developmental Expression and Distribution of N- and E-Cadherin in the Rat Ovary1

Naomi H. Machell2,,a, Orest W. Blaschukc, and Riaz Farookhia,b

a Departments of Physiology, b Obstetrics and Gynecology, and c Surgery (Division of Urology), McGill University, Montreal, Quebec, Canada H3A 1A1

ABSTRACT

The calcium-dependent cell adhesion molecules, cadherins, regulate intercellular junction formation, cell sorting, and the establishment of cell polarity. Their important role in tissue remodeling suggests an involvement in ovarian cellular rearrangements throughout postnatal development. The ovary has a complex topology, and the ovarian follicle undergoes significant cellular rearrangements during its development. Cadherins have been detected previously in whole ovaries and in ovarian cells and cell lines with some immunolocalization in fetal and adult ovaries. This study examines the expression and localization of N- and E-cadherin throughout prepubertal ovarian and follicular development in the rat. We analyzed ovarian cadherin expression in rats from Day 19–20 of gestation to 25 days postpartum, during which follicle formation and folliculogenesis are the dominant ovarian events. Reverse transcriptase polymerase chain reaction detected N- and E-cadherin mRNA expression in the ovaries at all the ages examined. Semiquantification of Western blots of whole ovary extracts confirmed the presence of ovarian N- and E-cadherin protein at all ages with both showing peak expression at 7 days of age. Immunostaining revealed N- and E-cadherin expression in follicular and extrafollicular cell types, but only E-cadherin showed follicle-stage-dependent expression. The changes in cadherin expression, concurrent with ovarian growth and folliculogenesis, suggest a function for cadherins in the morphological and functional development of the prepubertal rat ovary.

follicle, follicular development, oocyte development

INTRODUCTION

Classical cadherins are a large family of transmembrane glycoproteins that mediate homophilic, calcium-dependent cell adhesion. This family of cell adhesion molecules (CAMs) includes E(pithelial)-, N(eural)-, and P(lacental)-cadherin. These CAMs are involved in the establishment and maintenance of an organized tissue architecture during early development and continuing on into adulthood [13]. The classical cadherins interact with the actin cytoskeleton through associations with cytoplasmic proteins (catenins). They facilitate the formation of intercellular junctions as well as cell sorting and rearrangement [1, 4]. These molecules, therefore, are important in tissue remodeling processes.

Previous studies in our laboratory have shown that steroid hormones are important regulators of cadherin expression in tissues of the reproductive system. In neonatal mice, ovarian N- and E-cadherin can be upregulated by estrogen, and uterine E-cadherin expression upregulated by both estrogen and progesterone [57]. Two cadherins have been identified in cells isolated from rat ovaries. N-cadherin is expressed in granulosa cells and E-cadherin is present in the ovarian surface epithelium [810]. Estrogen increases N-cadherin expression in isolated rat ovarian granulosa cells [8, 9, 11]. We have shown that cadherins regulate gonadotropin-dependent cell differentiation and signal transduction in these cells [9, 12, 13]. In addition, N-cadherin-mediated granulosa cell adhesion has been shown to prevent these cells from undergoing apoptosis [1416]. Collectively, these findings establish a role for cadherins as mediators of granulosa cell function and suggest that these CAMs are important in folliculogenesis.

The prepubertal ovary is an appropriate model for following the stages of folliculogenesis, including the initial organization and the early growth of follicles that characterize the developing ovary. Neonatal rat ovaries contain a synchronized population of follicles compared to adult ovaries [1719]. The initial assembly of granulosa cell-oocyte collectives into rat primordial follicles occurs primarily during the second and third days after birth [17]. A number of follicles begin growing and differentiating by Day 3 into small preantral follicles [17] that are responsive to FSH [20]. Ovaries from 7-day-old animals lack antral follicles, but in both mice and rats, small preantral follicles are abundant and are growing at a faster rate than in the adult [18, 21, 22]. Follicles with fluid-filled antra are observed as early as Day 13 of age [23, 24]. The ovaries contain many large antral follicles by Day 21 of age [23]. During the processes of follicular organization and growth, many complex cellular interactions and rearrangements occur [17, 19]. This constant remodeling of the ovarian architecture could, we suspect, result from changes in cadherin expression. In order to investigate this possibility, we have examined N- and E-cadherin expression and their localization during postpartum ovarian and early follicular development.

MATERIALS AND METHODS

Animals

Treatment and general care of all animals were approved by the Animal Care Committee of the Royal Victoria Hospital and complied with the regulations established by the Canadian Council on Animal Care. Female Sprague-Dawley rats were purchased from Charles River (St. Constant, PQ, Canada) and housed under a 12L:12D cycle. Ovaries were dissected from animals on 19–20 days of gestation of timed pregnancies (e19–20), and 1, 3, 7, 15, and 25 days postpartum (p). Attention was paid to the careful removal of oviductal tissue because this tissue expresses E-cadherin (unpublished observation). The ages were selected because the ovaries at these developmental stages possess a relatively synchronized population of follicles that represent specific stages of early follicular development [17, 21, 23, 24]. In the case of fetal, p1, and p3 ovaries, pregnant females were purchased. The day of birth was considered postpartum Day 1 (p1). The p7 and p15 animals were purchased as litters with lactating mothers. The sample size (n) was 3–8 for each age group. Each sample consisted of pooled ovaries from approximately 2–28 animals, depending on the size of the ovaries. For example, about 28 fetal ovaries were required to make one protein extract compared to 2 ovaries from p25 animals. Ovaries were frozen on dry ice and stored at -80°C until processed for RNA or protein extraction. Ovaries were also dissected from 3-, 7-, and 25-day-old rats for the purposes of immunohistochemical examination. In this case, ovaries were fixed in methanol and postfixed in ethanol before paraffin embedding. Ovaries from at least four animals were examined in each age group in the immunofluorescence study. In this case, oviductal tissue was not completely removed in order to allow easier handling of the dissected ovaries.

Extraction of RNA and Reverse Transcriptase Polymerase Chain Reaction

Frozen ovaries were pulverized on dry ice, and the resulting powder was dissolved in solution D (4 M guanidine thiocyanate, 25 mM sodium citrate, 0.5% sarcosyl, 0.72% ß-mercaptoethanol) followed by vortexing and sonication of the solution. The solution was extracted twice with phenol-chloroform followed by alcohol precipitation of RNA as described by Chomczynski and Sacchi [25]. Total RNA (5 µg) was reverse transcribed using murine Maloney leukemia virus reverse transcriptase (Pharmacia Biotech Inc., Baie d'Urfé, PQ, Canada) and a mixture of random hexamer primers (Pharmacia Biotech). Polymerase chain reaction (PCR) was performed using 100 ng of cDNA and oligonucleotide primers specific for conserved sequences of mouse N-cadherin (Genbank Acc. No. M31131) or human E-cadherin (Genbank Acc. No. L08599). The primer sequences for N-cadherin were: forward, CAAGAGCTTGTCAGAATCAGG (nucleotides [nt] 864–884), and reverse, CATTTGGATCATCCGCATC (nt 1227–1209) and for E-cadherin: forward, CCTTCCTCCCAATACATCTCCC (nt 1950–1971), and reverse, TCTCCGCCTCCTTCTTCATC (nt 2381–2362). Taq DNA polymerase (Pharmacia Biotech) was used in the PCR reaction that was conducted with an annealing temperature of 55°C, elongation at 72°C for 1 min, and denaturing at 94°C for 30 sec, for 35 cycles. The products of the PCR procedure were visualized on a 1% agarose gel containing 1 µg/ml ethidium bromide in TBE buffer (89 mM Tris base, 89 mM boric acid, 2 mM EDTA). The PCR products from 25-day-old animals underwent gel purification, cloning and sequence analysis to confirm the identity of the PCR products.

Protein Extraction

Frozen tissue was pulverized on dry ice and added to 1.5 ml ice-cold extraction buffer (10 mM Tris, pH 7.4, containing 1 mM CaCl2, and 1 µg/ml of protease inhibitors, pepstatin A, PMSF, leupeptin, soybean trypsin inhibitor, and aprotinin). The suspension was sonicated twice for 10 sec at 5 W (Vibra Cell, Sonics and Materials Inc., Danbury, CT) and centrifuged at 10 000 x g for 10 min to remove insoluble material. The supernatant was recentrifuged at 100 000 x g for 1 h at 4°C and the pellet resuspended in extraction buffer. Total extracts of rat ovary, heart, and uterus were prepared as described above but without the high-speed centrifugation. Solubilization buffer for SDS-PAGE (final concentrations of 62.5 mM Tris, pH 6.8, containing 2% SDS, 10% glycerol, and 5% ß-mercaptoethanol) was added to the samples. The samples were boiled for 5 min, frozen, and stored at -40°C until needed. Sample protein content was assayed by analysis of amido black-stained dot blots using known concentrations of BSA to construct a standard curve [26].

SDS-PAGE and Western Blotting

Protein samples (4 µg) were resolved by SDS-PAGE on an 8% running gel with a 5% stacking gel [27]. A protein extract from the ovaries of a proestrous rat was included on each gel. This sample acted as a standard for normalization and allowed comparisons between samples run on separate gels. The resolved proteins were electrophoretically transferred [28] overnight at 0.8 A onto a polyvinylidene fluoride membrane (Bio/Can Scientific Inc., Mississauga, ON, Canada) in transfer buffer (25 mM Tris, pH 8.0, 192 mM glycine, and 20% methanol) containing 0.1% SDS. Membranes were stained with Ponceau-S (Sigma, Oakville, ON, Canada) to confirm protein transfer and destained in Tris-buffered saline with Tween 20 (TBS-T) (25 mM Tris, pH 8.0, 150 mM NaCl 0.1% Tween 20).

Membranes were immersed in blocking buffer (I-Block from Bio/Can Scientific) for 1 h at room temperature and incubated overnight at room temperature with mouse monoclonal antibodies against either N- or E-cadherin. The anti-N-cadherin (13A9) [29] was diluted 1:150, and the anti-E-cadherin antibody (clone 36) (Transduction Laboratories, Bio/Can Scientific) [30] was diluted 1:125 in blocking buffer. Total extracts from rat heart and uterus (20 µg) were used as positive controls. Blots were washed twice (5 min/wash) with TBS-T followed by three washes (5 min/wash) in blocking buffer. Membranes were incubated 2 h at room temperature with an alkaline phosphatase-conjugated second antibody (rabbit anti-mouse IgG, Bio/Can Scientific) diluted 1:2500 in blocking buffer. The blots were washed as before with two additional washes of 5 min in assay buffer (0.1 M diethanolamine, 1 mM MgCl2, pH 10) as per manufacturer's instructions for the chemiluminescent detection system (Bio/Can Scientific). The chemiluminescence substrate (CSPD; Bio/Can Scientific) was diluted 1:100 in assay buffer and incubated with the blots for 5 min in the dark. The substrate was removed and the membranes wrapped in cellophane and exposed to film (Kodak BioMax; VWR Canlab., Ville St-Marie, PQ, Canada). Multiple exposure times were used, and appropriate films were chosen for subsequent analysis.

Immunofluorescence

Paraffin sections (4–5 µm thick) were deparaffinized in xylenes and a graded alcohol series, and then rehydrated in phosphate buffer (PB: 0.1 M Na2HPO4, pH 7.4) for 45 min. As an antigen retrieval step, all slides were incubated in a Triton X-100 solution (0.4% in PB) for 30 min at 37°C and then washed twice for 5 min in PB. Other antigen-retrieval methods were tested, such as heating, steaming [30], anionic and ionic detergents, and combinations of these. The nonionic detergent, Triton X-100, consistently produced the best results. Primary antibodies toward N-cadherin and E-cadherin were diluted 1:3 in PB and incubated on the slides overnight at 37°C in a humid chamber. Different dilutions of the primary antibodies were assessed, with some staining observed at 1:8–1:4 for both antibodies and none if an antigen-retrieval step was not included (data not shown). After incubation with the primary antibody, slides were washed three times for 15 min each in PB. Secondary antibodies, rabbit anti-mouse IgG, conjugated to fluorescein isothiocyanate (FITC) were diluted (1:400) in PB and incubated on the slides in the dark at room temperature for 2 h in the humid chamber. Slides were washed as described above, mounted (Moviol 4-88 with 2.5% 1,4 diazabicyclo-[2.2.2]octane), and counterstained with 0.5 µg/µl 4',6'-diamidino-2-phenylindole (DAPI). Negative controls consisted of mouse serum used at the same dilution as the primary antibodies, as well as slides that were incubated with only the secondary antibody. Control tissues, rat brain, uterus, and heart were stained as well to verify antibody specificity. Observations of ovaries from at least four animals at 3, 7, and 25 days of age translates to observations of approximately 500, 300, and 100, primordial, primary, and antral follicles, respectively. Images were captured digitally using a computer image analysis system attached to an Olympus BX60 fluorescence microscope.

Statistical Analysis

Densitometric analysis of scanned films was used to quantify the Western blots. Optical density values of all bands were normalized to the value obtained for the standard sample (rat proestrous ovary extract) that was included on each gel. This allowed comparison between samples run on different gels. Each value was then calculated as a percentage of mean peak (the highest mean value for the data set). For both N- and E-cadherin, the mean peak was at p7. The data are shown as averages with corresponding standard errors. Data were analyzed by ANOVA, and multiple comparisons were performed using the Duncan's multiple range test with a significance level of P < 0.05. Statistically significant differences are represented graphically as groups not sharing the same letter assignment.

RESULTS

Messenger RNA for N- and E-Cadherin in Fetal and Prepubertal Rats

Reverse transcriptase PCR with specific primers to N- and E-cadherin yielded products of the appropriate size as predicted from the primer positions, i.e., 364 and 432 base pairs for the mouse and human sequences, respectively (Fig. 1, A and B). Ovary extracts from all of the prepubertal ages examined indicated the presence of both N- and E-cadherin mRNA. At least three different PCR reactions for each sample were performed. Sequence analysis of PCR products from 25-day-old rat ovaries confirmed the amplification of N- and E-cadherin transcripts by these primers in rat tissue (data not shown).



View larger version (53K):
[in this window]
[in a new window]
 
FIG. 1. Transcripts of N- and E-cadherin are present in prepubertal rat ovaries. Representative PCR products visualized with ethidium bromide staining showing DNA markers on either side, with demarcation of corresponding base pair numbers. A minimum of three samples per age group was tested, and results were replicated at least three times. Products from amplification with N-cadherin- (A) and E-cadherin- (B) specific primers at 364 and 432 base pairs, respectively. e19–20, 19–20-day gestation embryonic ovaries; p, postpartum; 1–25, number of days postpartum. The day of birth was considered postpartum Day 1 (p1)

Cadherin Detection with Western Blotting

The N-cadherin-specific monoclonal antibody recognized a single protein species of 130 kDa in the ovarian extracts (Fig. 2A). The E-cadherin-specific monoclonal antibody recognized a protein species of 120 kDa, but commonly a second band with lower molecular mass near 110 kDa also appeared (Fig. 2B).



View larger version (62K):
[in this window]
[in a new window]
 
FIG. 2. The N- and E-cadherin-enriched tissue extracts and antibody specificity. A) Representative Western blot probed with anti-N-cadherin antibody showing an enriched N-cadherin signal in an ovary extract after a high-speed (100 000 x g) centrifugation, compared to a total ovary extract (4 µg each). Rat uterus is negative for N-cadherin, whereas rat heart is positive (20 µg each). B) Representative Western blot probed with anti-E-cadherin antibody showing an enriched E-cadherin signal in an ovary extract after a high-speed (100 000 x g) centrifugation, compared to a total ovary extract (4 µg each). Rat uterus is positive for E-cadherin, whereas rat heart is negative (20 µg each). 130 and 120, estimated Mr x 10-3 of the major bands for N- and E-cadherin, respectively; arrowheads, position of molecular weight markers 116 and 97.4 (Mr x 10-3) top to bottom for both panels; Ot, total ovary protein extract; O100, ovarian extract protein pellet from a 100 000 x g centrifugation; U, rat uterus; H, rat heart

The pellet from the high-speed centrifugation (100 000 x g) in the ovarian tissue protein extraction was enriched in E- and N-cadherin compared with the total extract (Fig. 2). Total extracts from rat heart and uterus, known to contain N- and E-cadherin, respectively, were used as positive controls (Fig. 2) [7, 31]. The uterus contained little if any N-cadherin (Fig. 2A) and the rat heart no E-cadherin (Fig. 2B), and so these tissues also served as the appropriate negative controls for Western blotting.

Ovarian N- and E-Cadherin Protein Levels in Fetal and Prepubertal Rats

The relative N- and E-cadherin levels in the ovaries of fetal and prepubertal rats are shown in Figures 3 and 4. The upper panels show representative composite immunoblots and the lower panels summarize the densitometric analysis for ovarian N- and E-cadherin expression from six separate blots. The highest N- and E-cadherin levels were observed in p7 ovaries (Figs. 3 and 4). Hence, the densitometric analyses are shown as a percentage of the mean peak value. This permits comparisons to be made and obviates the arbitrary selection of a particular age as the normalizing value. Expression of N-cadherin in e19–20, p1, and p3 ovaries was approximately 30% of the p7 values. The p15 and p25 ovaries also expressed comparably lower N-cadherin levels (Fig. 3). Expression of E-cadherin in e19–20, p1, p3, p15, and p25 ranged between 30–65% of the p7 values (Fig. 4). The overall pattern of E-cadherin expression in fetal and prepubertal rat ovaries was similar to that of N-cadherin, notably with regard to peak expression at p7. Unlike N-cadherin, E-cadherin protein expression showed a significant age-related decline over the p7–p25 age period.



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 3. Ovarian N-cadherin in prepubertal rats of different ages. A) Representative Western blot probed with anti-N-cadherin antibody showing a reactive band near 130 (Mr x 10-3). B) Quantification using densitometric analysis of Western blots probed with anti-N-cadherin antibody and visualized by chemiluminescence. Values are represented as a percentage of mean peak value for the data set (n = 3–8 ovarian extracts) after standardization against a proestrous sample run on all gels. Statistical analysis performed was a Duncan's multiple range test (P < 0.05). Statistically significant differences between groups are represented as those not sharing at least one letter assignment. e19–20, 19–20-day gestation embryonic ovaries; p, postpartum; 1–25, number of days postpartum. The day of birth was considered postpartum Day 1 (p1)



View larger version (44K):
[in this window]
[in a new window]
 
FIG. 4. Ovarian E-cadherin in prepubertal rats of different ages. A) Representative Western blot probed with anti-E-cadherin antibody showing a reactive band near 120 (Mr x 10-3). B) Quantification using densitometric analysis of Western blots probed with anti-E-cadherin antibody and visualized by chemiluminescence. Values are represented as a percentage of mean peak value for the data set (n = 3–8 ovarian extracts) after standardization against a proestrous sample run on all gels. Statistical analysis performed was a Duncan's multiple range test (P < 0.05). Statistically significant differences between groups are represented as those not sharing at least one letter assignment. e19–20, 19–20-day gestation embryonic ovaries; p, postpartum; 1–25, number of days postpartum. The day of birth was considered postpartum Day 1 (p1)

Immunostaining of N- and E-Cadherin in Control Tissues

The rat brain, known to express N-cadherin [31], showed discrete staining localized to Purkinje cells within the cerebellum (Fig. 5A). This is similar to N-cadherin expression reported in the adult mouse cerebellum [32]. The rat uterus did not show staining for N-cadherin (Fig. 5B), but uterine E-cadherin staining localized to the epithelium lining the lumen (Fig. 5C). The rat heart was negative for E-cadherin staining (Fig. 5D). These discrete staining patterns demonstrate the specificity of each antibody within rat tissues.



View larger version (64K):
[in this window]
[in a new window]
 
FIG. 5. Immunofluorescent staining of control rat tissues. A) Staining with anti-N-cadherin antibody, 13A9, of Purkinje cells (arrowheads) in the cerebellum of a 21-day-old rat. B) The rat uterus is negative for N-cadherin staining. C) Staining with anti-E-cadherin antibody in epithelial cells lining the lumen of the rat uterus. D) The rat heart is negative for E-cadherin staining. Cadherin staining is visualized with FITC (green)-labeled secondary antibodies and is overlain with an image of DAPI (blue)-counterstained nuclei. Scale bars: A, 25 µm; B and C, 20 µm; D, 50 µm

Ovarian N- and E-Cadherin Protein Distribution in Prepubertal Rats

Immunofluorescent staining for N-cadherin revealed a low level of ubiquitous staining in both 3- and 7-day-old ovaries (Fig. 6, A and B). Fluorescence appeared in all cell types visible in the ovary at these ages including oocytes, granulosa cells, interstitium, and surface epithelium. All oocytes showed peripheral staining, but cytoplasmic staining varied in intensity (Fig. 6, A and B). Staining in 25-day-old rat ovaries was present throughout much of the ovary, but with portions of the interstitial tissue stained less, notably the elongated interstitial cells near the hilus (Fig. 6C). The granulosa cells and oocytes in these animals showed pronounced staining (Fig. 6C). Another monoclonal antibody (GC-4; Sigma-Aldrich Canada Ltd., Oakville, ON, Canada), raised against chicken N-cadherin, stained rat ovaries with patterns similar to 13A9 but had overall weaker staining at the same dilutions (data not shown). Both negative controls, secondary antibody alone, and mouse serum gave similar results and only the former is shown (Figs. 6D, 7D, 8E, 9E).



View larger version (115K):
[in this window]
[in a new window]
 
FIG. 6. Indirect immunofluorescence labeling for N-cadherin of sections of rat ovaries of different ages. A) Three-day-old ovary showing ubiquitous staining including primordial follicles (arrowheads), interstitium (i), and surface epithelium (arrow). B) Seven-day-old ovary showing ubiquitous staining including primordial (arrowheads) and preantral follicles, and surface epithelium (arrow). C) Twenty-five-day-old ovary depicting an area near the hilus. Long spindle-shaped interstitial cells (i) are stained less than nearby preantral follicles (arrowheads). D) Negative control from a 25-day-old incubated only with the secondary antibody. D') The same area as in D showing the DAPI counterstaining. Scale bar represents 100 µm

Expression of E-cadherin was also found to be pervasive in 3- and 7-day-old ovaries (Fig. 7, A and B) but was more restricted in the ovaries of 25-day-old rats (Fig. 7C). Staining for E-cadherin in primordial follicles in the 7-day-old appears brighter compared with the surrounding cells (Fig. 7B). Oocytes of primordial follicles show peripheral staining for E-cadherin with variation in the amount of cytoplasmic staining (Fig. 7, A and B). Staining in the 25-day-old was largely confined to areas of the interstitium, theca, and surface epithelium (Fig. 7C).



View larger version (108K):
[in this window]
[in a new window]
 
FIG. 7. Indirect immunofluorescence labeling for E-cadherin of sections of rat ovaries of different ages. A) Three-day-old ovary showing ubiquitous staining including primordial follicles (arrowheads), interstitium (i), and surface epithelium (arrow). B) Seven-day-old ovary showing ubiquitous staining including brighter primordial follicles (arrowheads), interstitium (i), as well as surface epithelium (arrow). C) Twenty-five-day-old ovary showing mainly interstitial cell staining (i) with nearby preantral follicles dimly stained (arrowheads). D) Negative control from a 25-day-old incubated only with the secondary antibody. D') The same area as in D showing the DAPI counterstaining. Scale bar represents 100 µm

Distribution of N- and E-Cadherin During Follicular Development

Immunostaining for N-cadherin in the 25-day-old animal was present in follicles at all stages of development (Fig. 8). Both the oocytes and granulosa cells in 25-day-olds showed staining in the primordial and early growing primary follicles (Fig. 8, A and B) that was similar to what was observed for the 3- and 7-day-old animals (Fig. 6, A and B). Staining of N-cadherin was also present in larger preantral and antral follicles (Fig. 8, C and D). Staining for E-cadherin was observed in oocytes and granulosa cells of primordial follicles in 3-, 7-, and 25-day-olds (Figs. 7A and 9A). This follicular staining was diminished in the oocyte compared to the granulosa cells in primary follicles (Figs. 7B and 9B), with staining becoming undetectable in both the oocyte and granulosa cells in larger follicles (Fig. 9, C and D).



View larger version (118K):
[in this window]
[in a new window]
 
FIG. 8. Indirect immunofluorescence for N-cadherin of 25-day-old rat ovaries in different follicle stages. A, A') Primordial follicle. B, B') Primary follicle. C, C') Preantral follicle. D, D') Antral follicle. E, E') Preantral follicle in a negative control incubated with only the secondary antibody. The duplicate image for each letter denoted by ' represents the same area visualizing the DAPI staining and the arrowheads and arrows correspond for each pair. Arrowhead, oocyte; arrow, granulosa cell. Scale bar in A represents 25 µm and is the same for B. Scale bar in C represents 50 µm. Scale bar in D represents 100 µm and is the same in E.



View larger version (96K):
[in this window]
[in a new window]
 
FIG. 9. Indirect immunofluorescence for E-cadherin of 25-day-old rat ovaries in different follicle stages. A, A') Primordial follicle. B, B') Primary follicle. C, C') Preantral follicle. D, D') Antral follicle. E, E') Antral follicle in a negative control incubated with only the secondary antibody. The duplicate image for each letter denoted by ' represents the same area visualizing the DAPI staining and the arrowheads and arrows correspond for each pair. Arrowhead, oocyte; arrow, granulosa cell; t, theca; s, surface epithelium. Scale bar in A represents 25 µm and is the same for B. Scale bar in C represents 50 µm. Scale bar in D represents 100 µm and is the same in E.

DISCUSSION

Follicle formation and folliculogenesis are the dominant developmental events of the vertebrate ovary. Although primordial follicle formation and the initiation of follicle development occurs in the ovary of many mammals during fetal development [3335] (except for the rodent where these occur in the immediate postpartum period) [17], subsequent folliculogenesis extends throughout the reproductive life of the female. Considerable progress has been made in our understanding of the regulation of physiological and molecular events involved in follicle maturation and ovulation [36, 37]. In contrast, little is known with respect to the underlying mechanisms involved in the morphogenetic processes controlling ovarian follicle formation and folliculogenesis. The results from our study indicate that cadherins may play an important role in these processes. Although cadherins have been previously detected in ovarian tissue and cells, this is the first study detailing cadherin expression during the prepubertal period where follicle development is beginning.

Our results show that both N- and E-cadherin mRNA and protein are expressed in the ovary throughout prepubertal development in the rat. The secondary bands in our Western blots for E-cadherin have often been observed in this type of analysis [3842], and a similar size band has been recently identified as a degradation product of internalized E-cadherin [43]. This internal degradation product was not included in the analysis and only the 120-kDa band was used in the quantification. The use of a high-speed centrifugation step in the protein extraction method to enrich the extracts in cadherins was particularly important for analysis of the fetal and newborn ovaries from which only small amounts of protein could be extracted. This enriched protein preparation was used for all the subsequent Western blot analyses of rat ovarian N- and E-cadherin. In our study, the highest levels of N- and E-cadherin are seen in ovaries of 7-day-old animals by Western blotting. Interestingly, in the rat testis and mouse and porcine ovary, E-cadherin mRNA and protein levels show a decline with increasing age [1, 40, 41]. These observations would be consistent with the idea that cadherins play a role in the organizational processes of the early developing ovary.

It is not clear what regulatory factors or stimuli are responsible for the elevation in ovarian N- and E-cadherin in 7-day-old rats. We have previously shown that exogenous estrogen can stimulate ovarian N- and E-cadherin expression in neonatal and prepubertal rodents, but it is an unlikely candidate because Carson and Smith [24] have shown minimal ovarian estrogen production in the 7-day-old. The levels of other circulating hormones, such as the gonadotropins or progesterone, are also low in rats 1 wk of age [44]. Insulin-like growth factor, basic fibroblast growth factor, transforming growth factor-ß, and cAMP can downregulate cadherin expression, and these factors are expressed in the developing ovary [16, 4553]. Hence, there are a number of candidate factors that could be responsible for changes in cadherin expression in the prepubertal ovary.

Our immunostaining data indicate that there are also dramatic changes in the distribution pattern of N- and E-cadherin expression in the prepubertal ovary. At 7 days of age, the oocytes and the investing granulosa cells of primordial follicles exhibit brighter staining for E-cadherin compared to the stromal cells (Figs. 6B and 7B), unlike the 3-day-olds that had more homogeneous staining throughout the ovary. This could account for the elevated levels of E-cadherin detected at this age by Western blotting compared to the 3-day-olds. Elevation of N-cadherin protein levels at 7 days of age compared to 3-day-olds may be due to an overall increase in expression throughout the ovary which would not be detected by our immunostaining technique due to intensity compensation by the image capture system. To our knowledge, expression of both N- and E-cadherin in follicle-enclosed oocytes is a novel observation. Expression of N- and E-cadherin in oocytes of embryonic mice, and E-cadherin in human ovaries and ovulated mouse oocytes, has been previously shown [5458]. Our observation of higher ovarian cadherin expression at 7 days of age compared to just after primordial follicle formation (between the day of birth and Day 3 in the rat) [17] could function to consolidate and maintain these structures. The fact that intense staining for N- and E-cadherin is still seen in primordial follicles in ovaries of 25-day-old animals (Figs. 8A and 9A) is consistent with this possibility. It is intriguing that E-cadherin expression in both the oocyte and in the investing granulosa cells was follicle-stage dependent (Fig. 9). The loss of E-cadherin expression may trigger the initiation or allow for the entry of primordial follicles into the pool of growing follicles. The signal for the initiation of primordial follicle growth remains unknown, although recent studies suggest that kit ligand (stem cell factor) interaction with its receptor, c-kit, may be part of this signal [59, 60]. Our observed decline in granulosa cell E-cadherin expression could be related to the decrease in adherens junctions in maturing follicles—particularly those of the preovulatory stage [61, 62].

Unlike E-cadherin, N-cadherin expression is maintained in the granulosa cells and oocytes of follicles as they progress through the preantral and antral stages of follicular development. Antrum formation must involve alteration of adhesion in what were previously adherent granulosa cells. The lack of any changes in N-cadherin expression in follicles undergoing antrum formation suggests that either this CAM is not involved in the process of antrum formation, or that other factors that can alter N-cadherin-mediated adhesion function, in a highly position-specific manner, are brought into play.

The distribution patterns of ovarian N- and E-cadherin expression in the extrafollicular areas are also complex. Our immunostaining detected both N- and E-cadherin expression in the surface epithelium of the ovary that remained unchanged over the entire developmental period examined. N-cadherin has also been detected in cultured rat ovarian surface epithelial cells [15]. Expression of E-cadherin in isolated rat and porcine ovarian surface epithelial cells has been previously reported [10, 42]. Expression of E-cadherin has also been reported for human ovarian surface epithelium [63], although there are reports that challenge this finding [43]. Expression of E-cadherin in the interstitial cells of the rat ovary is retained during development, with expression in some, but not all theca cells. Ryan et al. [41] have reported E-cadherin expression in isolated theca cells of the pig. E-cadherin is viewed as an important adhesion molecule for most epithelia and N-cadherin appears to be more prevalent in nonepithelial tissues such as in the heart and brain [31]. Yet, in the developing ovary, E-cadherin expression is most abundant in the mesenchymal theca-interstitial compartment, while N-cadherin is prevalent in the more epithelial compartment (i.e., the membrana granulosa). These observations indicate that categorization of cadherins to particular cell types cannot be generalized and depend on the nature of the tissue under examination.

Previous studies have shown that cadherins are involved in follicular function at the late preantral and antral stages of follicle development [8, 1214, 16]. The studies presented here advance the knowledge of cadherin expression during prepubertal ovarian development. They are the first to localize and detail changes in cadherin expression in follicles and maturing oocytes. The distribution of cadherin expression suggests a degree of compartmentalization coincident with developmental and organizational processes within the ovary. This is consistent with the idea that cadherins could have an important role in the production and maintenance of the ovarian architecture during growth and folliculogenesis.

ACKNOWLEDGMENTS

We thank Dr. Karen Knudsen (Lankenau Medical Research Centre, Wynnewood, PA) for her kind donation of the anti-N-cadherin antibody used in this study. Our thanks also go to Debbie Blake (Department of Obstetrics and Gynecology, McGill University, QC) for the sequencing of PCR products.

FOOTNOTES

First decision: 1 March 2000.

1 Supported by grants to O.W.B. (MRC #MT13471) and R.F. (MRC #MR1109, NSERC #215876–98), and an NSERC studentship to N.H.M. Back

2 Correspondence: Naomi H. Machell, Royal Victoria Hospital, F3.45 Women's Pavilion, 687 Pine Avenue West, Montreal, PQ, Canada H3A 1A1. FAX 514 843 1662; nmachell{at}muhc.mcgill.ca Back

Accepted: April 21, 2000.

Received: January 28, 2000.

REFERENCES

  1. Munro SB, Blaschuk OW. A comprehensive survey of the cadherins expressed in the testes of fetal, immature, and adult mice utilizing the polymerase chain reaction. Biol Reprod 1996; 55:822–827.[Abstract]
  2. Gumbiner BM. Cell adhesion: the molecular basis of tissue architecture and morphogenesis. Cell 1996; 84:345–357.[CrossRef][Medline]
  3. Vleminckx K, Kemler R. Cadherins and tissue formation: integration adhesion and signaling. Bioessays 1999; 21:211–220.[CrossRef][Medline]
  4. Steinberg MS, Takeichi M. Experimental specification of cell sorting, tissue spreading, and specific spatial patterning by quantitative differences in cadherin expression. Proc Natl Acad Sci USA 1994; 91:206–209.[Abstract/Free Full Text]
  5. MacCalman CD, Farookhi R, Blaschuk OW. Estradiol regulates E-cadherin mRNA levels in the surface epithelium of the mouse ovary. Clin Exp Metastasis 1994; 12:276–282.[CrossRef][Medline]
  6. MacCalman CD, Farookhi R, Blaschuk OW. Estradiol regulates N-cadherin mRNA levels in the mouse ovary. Dev Genet 1995; 16:20–24.[CrossRef][Medline]
  7. MacCalman CD, Farookhi R, Blaschuk OW. Estradiol and progesterone regulate E-cadherin mRNA levels in the mouse uterus. Endocrine 1994; 2:485–490.
  8. Blaschuk OW, Farookhi R. Estradiol stimulates cadherin expression in rat granulosa cells. Dev Biol 1989; 136:564–567.[CrossRef][Medline]
  9. Farookhi R, Blaschuk OW. Cadherins and ovarian follicular development. In: Gibori G (ed.), Signaling Mechanisms and Gene Expression in the Ovary. New York: Springer-Verlag; 1991: 254–260.
  10. Hoffman AG, Burghardt RC, Tilley R, Auersperg N. An in vitro model of ovarian epithelial carcinogenesis: changes in cell-cell communication and adhesion occurring during neoplastic progression. Int J Cancer 1993; 54:828–838.[Medline]
  11. Farookhi R, Geng CS, MacCalman CD, Blaschuk OW. Hormonal regulation of N-cadherin mRNA levels in rat granulosa cells. Ann NY Acad Sci 1997; 816:165–172.[Abstract/Free Full Text]
  12. Farookhi R, Desjardins J. Luteinizing hormone receptor induction in dispersed granulosa cells requires estrogen. Mol Cell Endocrinol 1986; 47:13–24.[CrossRef][Medline]
  13. Harandian F, Farookhi R. Contact-dependent cell interactions determine hormone responsiveness and desensitization in rat granulosa cells. Endocrinology 1998; 139:1700–1707.[Abstract/Free Full Text]
  14. Peluso JJ, Pappalardo A, Trolice MP. N-cadherin-mediated cell contact inhibits granulosa cell apoptosis in a progesterone-independent manner. Endocrinology 1996; 137:1196–1203.[Abstract]
  15. Trolice MP, Pappalardo A, Peluso JJ. Basic fibroblast growth factor and N-cadherin maintain rat granulosa cell and ovarian surface epithelial cell viability by stimulating the tyrosine phosphorylation of the fibroblast growth factor receptors. Endocrinology 1997; 138:107–113.[Abstract/Free Full Text]
  16. Makrigiannakis A, Coukos G, Christofidou-Solomidou M, Gour BJ, Radice GL, Blaschuk O, Coutifaris C. N-cadherin-mediated human granulosa cell adhesion prevents apoptosis: a role in follicular atresia and luteolysis? Am J Pathol 1999; 154:1391–1406.[Abstract/Free Full Text]
  17. Rajah R, Glaser EM, Hirshfield AN. The changing architecture of the neonatal rat ovary during histogenesis. Dev Dyn 1992; 194:177–192.[Medline]
  18. Hirshfield AN, DeSanti AM. Patterns of ovarian cell proliferation in rats during the embryonic period and the first three weeks postpartum. Biol Reprod 1995; 53:1208–1221.[Abstract]
  19. Tsafriri A. Ovulation as a tissue remodeling process. Proteolysis and cumulus expansion. Adv Exp Med Biol 1995; 377:121–140.[Medline]
  20. Sokka T, Huhtaniemi I. Ontogeny of gonadotrophin receptors and gonadotrophin-stimulated cyclic AMP production in the neonatal rat ovary. J Endocrinol 1990; 127:297–303.[Abstract]
  21. Pedersen T. Follicle growth in the immature mouse ovary. Acta Endocrinol 1969; 62:117–132.
  22. Hage AJ, Groen-Klevant AC, Welschen R. Follicle growth in the immature rat ovary. Acta Endocrinol 1978; 88:375–382.
  23. Mulheron GW, Quattropani SL, Nolin JM. The ontogeny of immunoreactive, endogenous FSH and LH in the rat ovary during early folliculogenesis. Proc Soc Exp Biol Med 1989; 190:91–97.[Abstract]
  24. Carson R, Smith J. Development and steroidogenic activity of preantral follicles in the neonatal rat ovary. J Endocrinol 1986; 110:87–92.[Abstract]
  25. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162:156–159.[Medline]
  26. Dieckmann-Schuppert A, Schnittler HJ. A simple assay for quantification of protein in tissue sections, cell cultures, and cell homogenates, and of protein immobilized on solid surfaces. Cell Tissue Res 1997; 288:119–126.[CrossRef][Medline]
  27. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970; 227:680–685.[CrossRef][Medline]
  28. Towbin H, Gordon J. Immunoblotting and dot immunobinding—current status and outlook. J Immunol Methods 1984; 72:313–340.[CrossRef][Medline]
  29. Knudsen KA, Soler AP, Johnson KR, Wheelock MJ. Interaction of alpha-actinin with the cadherin/catenin cell-cell adhesion complex via alpha-catenin. J Cell Biol 1995; 130:67–77.[Abstract/Free Full Text]
  30. Peralta Soler A, Knudsen KA, Tecson-Miguel A, McBrearty FX, Han AC, Salazar H. Expression of E-cadherin and N-cadherin in surface epithelial-stromal tumors of the ovary distinguishes mucinous from serous and endometrioid tumors. Hum Pathol 1997; 28:734–739.[CrossRef][Medline]
  31. Linnemann D, Gaardsvoll H, Dalseg AM, Zhernosekov D, Lundgren T, Edvardsen K, Bock E. Characterization of N-cadherin messenger RNA and polypeptide expression in rat. Int J Dev Neurosci 1994; 12:441–450.[CrossRef][Medline]
  32. Redies C, Takeichi M. Expression of N-cadherin mRNA during development of the mouse brain. Dev Dyn 1993; 197:26–39.[Medline]
  33. Christenson RK, Ford JJ, Redmer DA. Maturation of ovarian follicles in the prepubertal gilt. J Reprod Fertil 1985; 33(suppl):21–36.
  34. Trounson AO, Chamley WA, Kennedy JP, Tassell R. Primordial follicle numbers in ovaries and levels of LH and FSH in pituitaries and plasma of lambs selected for and against multiple births. Aust J Biol Sci 1974; 27:293–299.[Medline]
  35. Crisp TM. Organization of the ovarian follicle and events in its biology: oogenesis, ovulation or atresia. Mutat Res 1992; 296:89–106.[Medline]
  36. Richards JS. Hormonal control of gene expression in the ovary. Endocrinol Rev 1994; 15:725–751.[CrossRef][Medline]
  37. Richards JS, Russell DL, Robker RL, Dajee M, Alliston TN. Molecular mechanisms of ovulation and luteinization. Mol Cell Endocrinol 1998; 145:47–54.[CrossRef][Medline]
  38. Oka H, Shiozaki H, Kobayashi K, Inoue M, Tahara H, Kobayashi T, Takatsuka Y, Matsuyoshi N, Hirano S, Takeichi M, Mori T. Expression of E-cadherin cell adhesion molecules in human breast cancer tissues and its relationship to metastasis. Cancer Res 1993; 53:1696–1701.[Abstract/Free Full Text]
  39. Mege R-M, Matsuzaki F, Gallin WJ, Goldberg JI, Cunningham BA, Edelman GM. Construction of epithelioid sheets by transfection of mouse sarcoma cells with cDNAs for chicken cell adhesion molecules. Proc Natl Acad Sci USA 1988; 85:7274–7278.[Abstract/Free Full Text]
  40. Wu JC, Gregory CW, DePhilip RM. Expression of E-cadherin in immature rat and mouse testis and in rat Sertoli cell cultures. Biol Reprod 1993; 49:1353–1361.[Abstract]
  41. Ryan PL, Valentine AF, Bagnell CA. Expression of epithelial cadherin in the developing and adult pig ovary. Biol Reprod 1996; 55:1091–1097.[Abstract]
  42. Sundfeldt K, Piontkewitz Y, Ivarsson K, Nilsson O, Hellberg P, Brannstrom M, Janson PO, Enerback S, Hedin L. E-cadherin expression in human epithelial ovarian cancer and normal ovary. Int J Cancer 1997; 74:275–280.[CrossRef][Medline]
  43. Le TL, Yap AS, Stow JL. Recycling of E-cadherin: a potential mechanism for regulating cadherin dynamics. J Cell Biol 1999; 146:219–232.[Abstract/Free Full Text]
  44. Dohler KD, Wuttke W. Serum LH, FSH, prolactin and progesterone from birth to puberty in female and male rats. Endocrinology 1974; 94:1003–1008.[Medline]
  45. Kuzmenko YS, Stambolsky D, Kern F, Bochkov VN, Tkachuk VA, Resink TJ. Characteristics of smooth muscle cell lipoprotein binding proteins (p105/p130) as T-cadherin and regulation by positive and negative growth regulators. Biochem Biophys Res Commun 1998; 246:489–494.[CrossRef][Medline]
  46. Kuzmenko YS, Kern F, Bochkov VN, Tkachuk VA, Resink TJ. Density- and proliferation status-dependent expression of T-cadherin, a novel lipoprotein-binding glycoprotein: a function in negative regulation of smooth muscle cell growth? FEBS Lett 1998; 434:183–187.
  47. Portella G, Cumming SA, Liddell J, Cui W, Ireland H, Akhurst RJ, Balmain A. Transforming growth factor beta is essential for spindle cell conversion of mouse skin carcinoma in vivo: implications for tumor invasion. Cell Growth Differ 1998; 9:393–404.[Abstract]
  48. Caulin C, Scholl FG, Frontelo P, Gamallo C, Quintanilla M. Chronic exposure of cultured transformed mouse epidermal cells to transforming growth factor-beta 1 induces an epithelial-mesenchymal transdifferentiation and a spindle tumoral phenotype. Cell Growth Differ 1995; 6:1027–1035.[Abstract]
  49. Levacher C, Gautier C, Saez JM, Habert R. Immunohistochemical localization of transforming growth factor beta 1 and beta 2 in the fetal and neonatal rat ovary. Differentiation 1996; 61:45–51.[CrossRef][Medline]
  50. Bendell JJ, Dorrington J. Estradiol-17 beta stimulates DNA synthesis in rat granulosa cells: action mediated by transforming growth factor-beta. Endocrinology 1991; 128:2663–2665.[Abstract]
  51. Levy MJ, Hernandez ER, Adashi EY, Stillman RJ, Roberts CT Jr, LeRoith D. Expression of the insulin-like growth factor (IGF)-I and -II and the IGF-I and -II receptor genes during postnatal development of the rat ovary. Endocrinology 1992; 131:1202–1206.[Abstract]
  52. Gospodarowicz D, Plouet J, Fujii DK. Ovarian germinal epithelial cells respond to basic fibroblast growth factor and express its gene: implications for early folliculogenesis. Endocrinology 1989; 125:1266–1276.[Abstract]
  53. Coutifaris C, Kao LC, Sehdev HM, Chin U, Babalola GO, Blaschuk OW, Strauss JF. E-cadherin expression during the differentiation of human trophoblasts. Development 1991; 113:767–777.[Abstract]
  54. Lin LH, DePhilip RM. Sex-dependent expression of placental (P)-cadherin during mouse gonadogenesis. Anat Rec 1996; 246:535–544.[CrossRef][Medline]
  55. Campbell S, Swann HR, Seif MW, Kimber SJ, Aplin JD. Cell adhesion molecules on the oocyte and preimplantation human embryo. Hum Reprod 1995; 10:1571–1578.[Abstract/Free Full Text]
  56. Vestweber D, Gossler A, Boller K, Kemler R. Expression and distribution of cell adhesion molecule uvomorulin in mouse preimplantation embryos. Dev Biol 1987; 124:451–456.[CrossRef][Medline]
  57. Packer AI, Elwell VA, Parnass JD, Knudsen KA, Wolgemuth DJ. N-cadherin protein distribution in normal embryos and in embryos carrying mutations in the homeobox gene Hoxa-4. Int J Dev Biol 1997; 41:459–468.[Medline]
  58. Mackay S, Nicholson CL, Lewis SP, Brittan M. E-cadherin in the developing mouse gonad. Anat Embryol (Berl) 1999; 200:91–102.[CrossRef][Medline]
  59. Parrot JA, Skinner MK. Kit-ligand/stem cell factor induces primordial follicle development and initiates folliculogenesis. Endocrinology 1999; 140:4262–4271.[Abstract/Free Full Text]
  60. Yoshida H, Takakura N, Kataoka H, Kunisada T, Okamura H, Nishikawa SI. Stepwise requirement of c-kit tyrosine kinase in mouse ovarian follicle development. Dev Biol 1997; 184:122–137.[CrossRef][Medline]
  61. Rotmensch S, Dor J, Furman A, Rudak E, Mashiach S, Amsterdam A. Ultrastructural characterization of human granulosa cells in stimulated cycles: correlation with oocyte fertilizability. Fertil Steril 1986; 45:671–679.[Medline]
  62. Amsterdam A, Rotmensch S. Structure-function relationships during granulosa cell differentiation. Endocr Rev 1987; 8:309–337.[Medline]
  63. Inoue M, Ogawa H, Miyata M, Shiozaki H, Tanizawa O. Expression of E-cadherin in normal, benign, and malignant tissues of female genital organs. Am J Clin Pathol 1992; 98:76–80.[Medline]



This article has been cited by other articles:


Home page
ReproductionHome page
T. Sato, Y. Kanai, T. Noma, M. Kanai-Azuma, S. Taya, T. Matsui, M. Ishii, H. Kawakami, M. Kurohmaru, K. Kaibuchi, et al.
A close correlation in the expression patterns of Af-6 and Usp9x in Sertoli and granulosa cells of mouse testis and ovary
Reproduction, November 1, 2004; 128(5): 583 - 594.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Ricken*, P. Lochhead, M. Kontogiannea, and R. Farookhi
Wnt Signaling in the Ovary: Identification and Compartmentalized Expression of wnt-2, wnt-2b, and Frizzled-4 mRNAs
Endocrinology, July 1, 2002; 143(7): 2741 - 2749.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. W. Wright, S. Toth-Fejel, R. L. Stouffer, and K. D. Rodland
Proliferation of Rhesus Ovarian Surface Epithelial Cells in Culture: Lack of Mitogenic Response to Steroid or Gonadotropic Hormones
Endocrinology, June 1, 2002; 143(6): 2198 - 2207.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Machell, N. H.
Right arrow Articles by Farookhi, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Machell, N. H.
Right arrow Articles by Farookhi, R.
Agricola
Right arrow Articles by Machell, N. H.
Right arrow Articles by Farookhi, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS