Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O'Bryan, M. K.
Right arrow Articles by Hedger, M. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O'Bryan, M. K.
Right arrow Articles by Hedger, M. P.
Agricola
Right arrow Articles by O'Bryan, M. K.
Right arrow Articles by Hedger, M. P.
Biology of Reproduction 63, 1285-1293 (2000)
© 2000 Society for the Study of Reproduction, Inc.


Regular Article

Inducible Nitric Oxide Synthase in the Rat Testis: Evidence for Potential Roles in Both Normal Function and Inflammation-Mediated Infertility1

Moira K. O'Bryana, Stefan Schlatt3,a, Orapin Gerdpraserta, David J. Phillipsa, David M. de Kretsera, and Mark P. Hedger2,a

a Monash Institute of Reproduction and Development, Monash University, Clayton, 3168, Australia

ABSTRACT

In vitro data have indicated that nitric oxide (NO) inhibits Leydig cell testosterone production, suggesting that NO may play a role in the suppression of steroidogenesis and spermatogenic function during inflammation. Consequently, we investigated expression of the inflammation-inducible isoform of NO synthase (iNOS) in the inflamed adult rat testis and the ability of a broad-spectrum inhibitor of NO production, L-nitro-L-arginine methyl ester, to prevent Leydig cell dysfunction during inflammation. Unexpectedly, immunohistochemical and mRNA data established that iNOS is expressed constitutively in Leydig cells and in a stage-specific manner in Sertoli, peritubular, and spermatogenic cells in the normal testis. Expression was increased in a dose-dependent manner in all these cell types during lipopolysaccharide (LPS)-induced inflammation. In noninflamed testes, treatment with the NO synthase inhibitor reduced testicular interstitial fluid formation and testosterone production without any effect on serum LH levels. Administration of the inhibitor did not prevent the suppression of testicular interstitial fluid and testosterone production that occurs within 6 h after LPS treatment. Collectively, these data indicate a novel role for iNOS in autocrine or paracrine regulation of the testicular vasculature, Leydig cell steroidogenesis, and spermatogenesis in the normal testis. The data suggest that increased NO is not the major cause of acute Leydig cell dysfunction in the LPS-treated inflammation model, although a role for NO in this process cannot be excluded, particularly at other time points. Moreover, up-regulation of iNOS may contribute to the seminiferous epithelium damage caused by LPS-induced inflammation.

interstitial cells, Leydig cells, nitric oxide, Sertoli cells, spermatogenesis, testes

INTRODUCTION

There is a considerable body of clinical evidence suggesting that testis function is compromised during illness or infection, resulting in a temporary or permanent impairment of fertility [13]. This impairment is manifested as a decrease in both serum testosterone levels and in sperm counts. The mechanisms underlying this inhibition are poorly understood. Consequently, we have adopted the experimental model of lipopolysaccharide (LPS)-induced inflammation to investigate the effects and causes of inflammation-mediated infertility in the adult male rat. Our studies showed that a single injection of a relatively low dose of LPS, consistent with a mild bacterial infection, resulted in a partial inhibition of testosterone secretion between 6–24 h later [4]. This inhibition was not due to reduced secretion of pituitary LH, but rather to a loss of Leydig cell steroidogenic capacity. Spermatogenesis appeared to be unaffected. In contrast, injection of a higher dose of LPS that induced endotoxemia and death in a small proportion of the animals caused both inhibition of the Leydig cell and significant damage to the seminiferous epithelium, i.e., germ cell loss through sloughing and apoptosis. This damage occurred in spite of the persistence of intratesticular testosterone concentrations that should have been sufficient to maintain spermatogenesis, suggesting that separate mechanisms mediate the inhibition of steroidogenesis and the seminiferous tubule damage [4].

Several inflammatory mediators are produced within the normal testis, where they are believed to be involved in regulating Leydig cell function and spermatogenic development [5, 6]. Production of these mediators is increased by inflammatory stimuli. A number of recent in vitro studies have indicated that the inflammatory vasodilator nitric oxide (NO) is capable of inhibiting steroidogenesis by the Leydig cells, the granulosa luteal cells, and the adrenal cortex [710]. Production of NO occurs through the action of one of three nitric oxide synthase (NOS) enzymes. Immunohistochemical studies have shown that the endothelial (type III) isoform is present in both human Leydig and Sertoli cells [11], and that the neuronal isoform (type I) is present in human and rat testes [1215]. Administration of the broad-spectrum NO inhibitor, L-nitro-L-arginine methyl ester (L-NAME) to adult rats resulted in an elevation in serum testosterone levels 2 h postinjection, indicating that NO is involved in regulating normal testosterone production [15, 16]. In another study using an intraperitoneal sepsis model, a brief infusion of L-NAME stimulated serum testosterone levels in both septic and nonseptic control rats, suggesting that inhibition of testosterone production during inflammation involves the action of NO [17].

It is the inducible isoform of NOS (type II or iNOS) that is up-regulated in many tissues in response to an inflammatory episode [18, 19]. In contrast to types I and III that require calcium influx into the cell in order to be activated, iNOS is calcium independent and produces relatively larger amounts of NO than the other two isoforms [19, 20]. Given the pre-existing in vitro studies linking NO and testosterone production, the aim of the present study was to investigate the potential role of NO, and iNOS specifically, in testicular function during systemic inflammation. Unexpectedly, these studies found that iNOS is actually expressed in the normal testis, suggesting a unique role for this induced enzyme in the function of a normal tissue.

MATERIALS AND METHODS

Animals and Reagents

Adult male Sprague-Dawley rats (80–100 days old) were obtained from the Monash University Central Animal House and maintained under standardized conditions of lighting (12L:12D) and nutrition (food and water ad libitim) throughout the experimental period. Studies were performed in accordance with the National Health and Medical Research Council Guidelines on Ethics in Animal Experimentation, and were approved by the Monash Medical Centre Animal Experimentation Ethics Committee. Animals received constant monitoring throughout the period of the study.

Reagents were obtained from Sigma Chemical Company (St. Louis, MO) unless otherwise stated. The rat 1536-base pair (bp) partial iNOS cDNA plasmid was generously provided by Dr. David Nikolic-Paterson (Department of Nephrology, Monash Medical Centre, Clayton, Australia) and the sequence confirmed by direct sequencing.

Experiment 1: Low Dose and High Dose LPS Time-Course Study

The tissues used for this experiment were obtained as previously described [4]. Briefly, adult male Sprague-Dawley rats were injected (i.p.) with pyrogen-free saline (1.0 ml/kg weight) alone or saline containing either a low dose (0.1 mg/kg body weight) or a high dose (5.0 mg/kg body weight) of LPS (Escherichia coli, serotype 0127:B8) and killed at various time points between 1–72 h (low dose group) or 3–72 h (high dose group) after injection for collection of tissues. These doses represented a mild systemic inflammation (low dose LPS) or severe endotoxemia (high dose LPS), respectively [4]. A small number of rats treated with the high dose of LPS that died of shock-related symptoms prior to collection of tissues were eliminated from the study. Blood was obtained via cardiac puncture under ether anesthesia, and one testis was removed, weighed, and used for collection of interstitial fluid (IF), which is an indirect measure of changes in testicular vascular function [21]. The remaining testes were either snap-frozen and stored at -70°C to be used for RNA extraction or perfused in situ with Bouin's fixative and processed for embedding in paraffin for histology and immunohistochemistry [22]. Sections of 5 µm thickness were cut from embedded testis blocks, floated onto Superfrost plus microscope slides (Biolab Scientific, Australia), dried overnight at 37°C, and stored appropriately prior to use. Liver samples were taken and snap-frozen and stored at -70°C to be used as control tissues for mRNA studies.

Experiment 2: Inhibition of NO in Normal Rats

The previous work from our laboratory has shown that a maximum inhibition of testosterone production (to 30% of control) after LPS treatment occurs at 6 h after injection [4]. While there have been several studies of the acute effects of L-NAME administration on the testis [7, 1517], there are no published data concerning the response of the testis to inhibition of NO by L-NAME treatment for periods greater than 2 h. Consequently, the effect of NO inhibition on pituitary-testicular function was investigated over a total period of 9 h using serial s.c. injections of L-NAME (30 mg/kg), which is a maximum effective dose based on previous studies in the testis and other organs [15, 16, 23]. Groups of rats (n = 6 rats/group) received multiple injections (100 µl/100 g body weight, s.c.) of either pyrogen-free saline or L-NAME (30 mg/ml) in saline, at three hourly intervals, as follows: group 1, injections of L-NAME at 0 h, 3 h, and 6 h, samples collected at 9 h; group 2, injections of L-NAME at time 0 h, and saline alone at 3 h and 6 h, samples collected at 9 h; group 3, injections of saline alone at 0 h, 3 h, and 6 h, samples collected at 9 h; group 4, injections of L-NAME at 0 h and 3 h, samples collected 6 h; group 5, injections of L-NAME at 0 h, and saline alone at 3 h, samples collected at 6 h; group 6, injections of saline alone at 0 h and 3 h, samples collected at 6 h; group 7, injection of L-NAME at 0 h, samples collected at 3 h; group 8, injection of saline alone at 0 h, samples collected 3 h. All tissue samples were collected and processed as outlined in experiment 1 above.

Experiment 3: Inhibition of NO in LPS-Treated Rats

The effect of inhibition of NO on pituitary-testicular function during LPS-induced inflammation was investigated. Rats (n = 6 rats/group) were injected (s.c.) with either pyrogen-free saline or L-NAME (30 mg/ml) in saline, as in experiment 2. At 3 h after the first injection, rats received a second injection of either saline or L-NAME, followed by an injection (i.p.) of pyrogen-free saline alone, or saline containing either a low dose (0.1 mg/kg body weight) or a high dose (5.0 mg/kg body weight) of LPS (E. coli, serotype 0127:B8, as in experiment 1). At 6 h after the first injection, rats received a third injection of either saline or L-NAME, and all rats were killed at 9 h after the first injection. In this experimental design, rats were killed at 6 h after treatment with either dose of LPS or saline, having received multiple injections of either L-NAME or saline alone throughout the 9-h period prior to death. Nine hours after the first L-NAME injection was the longest experimental period that could be used in this study, due to the onset of lethargy, cardiac/respiratory distress, and poor physical appearance, particularly in the LPS-treated rats, resulting from the prolonged period of hypertension caused by inhibition of endogenous NO [19]. Tissues were collected and processed as described in experiment 1 above, with the exception that testes taken for collection of IF were subsequently homogenized in Dulbecco PBS (pH 7.4) and processed for collection of whole testis cytosols, as previously described [21, 24]. The collection of testis cytosols was necessary because there was insufficient volume in many of the IF samples for accurate measurement of intratesticular testosterone in this experiment. Both IF and whole testis cytosols are suitable measures of intratesticular testosterone concentrations [21].

Hormone Assays

Serum LH was measured by specific double-antibody RIA, using reagents supplied by the National Institute of Diabetes and Digestive and Kidney Diseases (Bethesda, MD), as previously described [24]. Serum and testicular cytosol testosterone concentrations were measured by [3H]-testosterone RIA after hexane-chloroform extraction [21, 24]. Testicular IF was assayed without extraction for testosterone content by 125I-testosterone RIA [25].

Inducible NOS Immunohistochemistry

Inducible NOS protein was immunolocalized using an avidin-biotin amplified peroxidase method. Antibody access in dewaxed and rehydrated sections was improved using an antigen retrieval method that required treating sections in 0.05 M glycine, pH 3.5 in a microwave at 2.25 W/ml/min for 3 min followed by 0.3 W/ml/min for 8 min [22]. Nonspecific antibody binding was eliminated by preincubating sections with 10% normal sheep serum. Inducible NOS was localized using a rabbit antiserum raised against amino acids 1126–1144 of mouse iNOS (no. sc-650, Santa Cruz Biotechnology Inc., Santa Cruz, CA). This antibody has been shown to react specifically with rat iNOS and has no cross-reactivity with either type I or type III NOS in either immunohistochemical or Western blotting protocols [26, 27]. The sections were sequentially incubated with the primary antibody overnight at 4°C, a secondary-biotinylated sheep anti-rabbit antibody (1:1000; Amrad, Melbourne, Australia) at room temperature for 1 h, and streptavidin-conjugated horseradish peroxidase (1:1000; Amrad). Excess reagents were removed by washing in Tris-buffered saline (50 mM Tris HCl, 150 mM NaCl, pH 7.6). Peroxidase activity was visualized using 3',3'-diaminobenzidine tetrahydrochloride (DAB). Sections were counterstained with Harris' hematoxylin, blued using Scott's tap water, dehydrated, and mounted using DPX under glass coverslips. Sections were analyzed and photographed using a BH2 microscope (Olympus, Tokyo, Japan).

The specificity of the immunohistochemical staining in our hands was established using either nonimmune rabbit sera in place of the primary antibody solution or by preabsorbing the iNOS antiserum using the iNOS immunogen peptide, as outlined by the manufacturer (Santa Cruz). Preabsorbed antiserum was used in the same immunohistochemical protocol on testis sections from 6-h high dose LPS-treated rats that had been shown to contain high levels of iNOS by subsequent immunohistochemical and mRNA studies.

Inducible NOS-Macrophage Double Labeling Immunohistochemistry

Sections were double labeled with the iNOS antiserum and with the tissue-fixed macrophage monoclonal antibody, ED2 (Serotec, Oxford, UK), using a modification of a previously described method [22]. In brief, iNOS immunohistochemistry was carried out essentially as outlined in the previous section, with ED2 added to the primary antibody solution. Bound ED2 was detected by addition of an alkaline phosphatase conjugated anti-mouse serum to the secondary antibody solution (1:100; Dako, Copenhagen, Denmark). Alkaline phosphatase activity was visualized using fast red as a substrate, subsequent to iNOS/DAB development. Sections were counterstained with Harris' hematoxylin and mounted under glass coverslips using GVA mount (Zymed, San Fransico, CA).

Amplification of iNOS by Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)

The rat iNOS cDNA was amplified and sequenced from normal and LPS-treated testis and liver (6 h postinjection) by RT-PCR. Total RNA was purified using the method of Chomczynski and Sacchi [28] and reverse-transcribed to cDNA using avian myeloblastosis virus RT as outlined by the manufacturer (Promega Corporation, Madison, WI). The equivalent of 0.25 µg of testis RNA was used for the PCR amplification of a 314-bp iNOS cDNA product using iNOS-specific primers, designed from the published rat sequence [29], and Pyrococcus furiosus unit (pfu) polymerase (Stratagene, La Jolla, CA) in a touch-down PCR protocol. The sequence of the forward primer (5F) was ACCTCAAACAGGAAAACCAC and the reverse primer (5R) was ACTCTTGGAGTTCATGATGG (Geneworks, Adelaide, Australia). Cycling conditions were 30 cycles of denaturation at 94°C for 30 sec, followed by annealing at 60–45°C (decreasing at 0.5°C increments) for 1 min, followed by extension at 72°C for 1 min [30]. Following the touch-down protocol, the signal was further amplified by 10 rounds of cycling as follows: denaturation at 94°C for 45 sec, annealing at 45°C for 1 min and extension at 72°C for 1 min, followed by a final extension of 5 min at 72°C. The 314-bp product was gel purified using the Wizard PCR Preps DNA Purification System (Promega Corporation) and the sequence confirmed to be genuine rat iNOS from Big Dye-terminator reactions using an ABI model 377 gene sequencer (Perkin Elmer, Cheshire, UK) at The Wellcome Trust Joint Core Facility for DNA Sequencing, Monash Medical Centre (Clayton, Australia). The RT-PCR products were sequenced for a minimum of two animals per treatment group.

Northern Blot Analysis

The testicular iNOS response to acute LPS-mediated inflammation was further confirmed by Northern blot analysis using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression to normalize loading (corresponding to 56–757 bp of the rat GAPDH cDNA). Approximately 20 µg of RNA from LPS-treated and control testes was fractionated by electrophoresis on 1% agarose formaldehyde gels and transferred to Nytran Plus membranes (Schleicher & Schuell, Keene, NH) in 10x saline sodium citrate (SSC: 0.15 M NaCl, 0.015 M sodium citrate). The RNA was fixed onto the membranes by baking at 80°C for 1 h. Prehybridization was carried out in Ultrahyb (Ambion Inc., Austin, TX) at 43°C for 2 h. The {alpha}32P-labeled cDNA probes were synthesized from the iNOS and GAPDH plasmid inserts following excision with BamHI and HindIII and labeling with {alpha}32P-dATP using Strip-EZ DNA Probe Synthesis kit (Ambion Inc.). Unincorporated nucleotides were removed using a Probe Quant G-50 microcolumn (Pharmacia Biotech, Uppsala, Sweden). Hybridization was performed overnight at 42°C in the prehybridization buffer in the presence of 2 x 106 cpm/ml of probe. The membranes were washed to a maximum stringency of 0.1x SSC/0.1% SDS at 65°C prior to phosphoimage analysis (Fujix, Fuji Photo Film Corporation, Tokyo, Japan) and quantitated using MacBass version 2.5 software supplied by the manufacturer. Experiments were repeated for a minimum of two animals per treatment group.

Database Searches

The Blast-N program was used to search expression sequence tag databases (dbest) for the expression of iNOS sequence in various tissues [31].

Statistics

Data were analyzed by two-way analysis of variance after appropriate transformation to normalize data and equalize variance where necessary, in conjunction with the Student-Newman-Keuls multiple range test. All data presented are mean ± SEM. All statistical analyses were performed using Sigmastat version 1.0 software (Jandel Corp., San Rafael, CA).

RESULTS

Inducible NOS Immunohistochemistry

There was no immunostaining of testis sections from rats treated 6 h earlier with LPS probed with preabsorbed iNOS antiserum (Fig. 1A), indicating the specificity of the antisera. These testes were chosen for preabsorption studies as they had been shown, at both a mRNA and protein level, to contain high levels of iNOS. This time point is, however, prior to the appearance of visible spermatogenic damage that became evident at 12 h postinjection [4]. Substitution of the primary antibody for nonimmune rabbit serum also confirmed the absence of background staining (data not shown). In normal (i.e., saline-injected control) rat testes, iNOS protein was localized in both the seminiferous tubules and the intertubular tissue. Within the seminiferous tubules, iNOS was seen in elongating spermatids at stage IX of the cycle of the seminiferous epithelium (Fig. 1B), and in pachytene spermatocytes at stages IX–XII, most prominently at stages X–XI (Fig. 1C). Low levels of iNOS staining were seen within peritubular cells (Fig. 1C) and Sertoli cells in the majority of tubules (Fig. 1D). Peritubular cells in association with stage XII–XIV epithelium, however, had relatively lower levels of iNOS protein as indicated by the relative intensity of immunohistochemical staining (Fig. 1D). The most intense staining for iNOS in the normal testis was seen in association with Leydig cells (Fig. 1E). Interstitial cells, with the histological appearance of resident macrophages were negative for iNOS immunoreactivity at all time points and treatment groups, and this was confirmed by double labeling for iNOS and the resident macrophage marker, ED2 (Fig. 1E). Vascular endothelial and smooth muscle cells in normal rats did not contain detectable iNOS protein (Fig. 1E).



View larger version (107K):
[in this window]
[in a new window]
 
FIG. 1. A representative immunohistochemical distribution of iNOS protein in the normal and LPS-treated rat testis. A) Negative control section from a high dose LPS-treated rat testis 6 h after LPS injection probed with the iNOS antiserum preabsorbed with the immunizing peptide. B–E) A normal rat testis probed with the iNOS antiserum. Within the normal rat testis iNOS protein was found in low levels within discrete populations of elongating spermatids and was most easily visible in step 9 spermatids (et, B), and pachytene spermatocytes (pc, C). Inducible NOS immunostaining was also seen within peritubular cells at most stages of the seminiferous cycle (pt, C) with the exception of stage XII tubules (D) and in low levels within Sertoli cell cytoplasm (sc, D). The majority of staining within the normal testis, however, was confined to the Leydig cells (lc, D and E). Testicular macrophages (m) were not stained for iNOS protein and were distinguished from Leydig cells using double labeling for iNOS and the resident macrophage marker ED2 (E) (b, blood vessel). F–H) Following injection with LPS an increase in iNOS immunostaining was seen within germ cells (F), Sertoli cells (G), and Leydig cells (H). Rats were killed 6 h following injection with 5 mg/kg LPS. The cell marked by an arrowhead in H is a resident testicular macrophage that did not express iNOS protein in response to LPS injection. Magnifications: A, B) x40, B, C, G, H) x1000, D) x200, and E) x100. Bars = 25 µm

Administration of LPS to rats resulted in a time- and dose-dependent up-regulation of iNOS protein in several testicular cell types. At both low (0.1 mg/kg) and high (5 mg/kg) doses of LPS, there was an increase in germ cell (Fig. 1F), Sertoli cell (Fig. 1G), and Leydig cell (Fig. 1H) expression of iNOS protein as judged by the relative intensity of staining (Table 1). There was an increase in iNOS staining intensity within the germ cells that normally expressed iNOS protein and in the number of tubule cross-sections that had detectable iNOS staining (Fig. 1F). The increase in expression was more dramatic in the high dose LPS-treated animals compared with the low dose treated animals; however, the cell types involved and the time course of staining were similar. Within both groups of LPS-treated animals, a greater proportion of pachytene spermatocytes contained iNOS protein staining, compared with normal testes. In the low dose LPS-treated animals, iNOS staining was observed in pachytene spermatocytes throughout stages VII–XII at 6–18 h after LPS injection. In rats treated with high dose LPS, increased pachytene spermatocyte staining was observed throughout stages VII–XIII at 3–24 h after LPS injection (Fig. 1F). Injection of LPS did not stimulate iNOS expression within all intertubular cell types, and, in particular, cells with monocyte/macrophage nuclear characteristics did not express iNOS protein in LPS-treated rat testes (Fig. 1H, arrowhead). Expression of iNOS throughout the testis had returned to the control pattern by 24 h after LPS injection (Table 1). Due to the complexity of these data, a complete summary of these observations is also provided in Table 1.


View this table:
[in this window]
[in a new window]
 
TABLE 1. A summary of the relative iNOS protein immunohistochemical staining seen in specific cell types of the rat testes killed at varying times following injection of 0.1 or 5 mg LPS/kg body weight

Confirmation of iNOS Expression in Normal and LPS-Treated Testes by RT-PCR, Expressed Sequence Tag (EST) Database Searches, and Northern Blot Analysis

The presence of iNOS in the normal rat testis was confirmed by RT-PCR amplification of an iNOS cDNA from saline-injected control rats (Fig. 2, lane B). The specificity of the RT-PCR reactions was confirmed by amplification of iNOS from LPS-treated liver (Fig. 2, lane C, 6 h post-LPS injection), which is a well-characterized source of iNOS, and from direct sequencing of the RT-PCR products. Further, iNOS cDNA was amplified from testis of 6 h post-LPS-treated rats (Fig. 2, lane D). Results were obtained for two separate sets of rats. The increased intensity of staining of the iNOS amplicon is suggestive, but not conclusive, of increased iNOS expression. In order to establish the up-regulation of testicular iNOS mRNA expression following exposure of rats to LPS, Northern blots were performed.



View larger version (96K):
[in this window]
[in a new window]
 
FIG. 2. A representative RT-PCR analysis of iNOS mRNA in saline-treated control rat testis and LPS-treated testis (6 h post-LPS injection). An LPS-treated liver (6 h post-LPS injection) was included as a positive control. An iNOS cDNA of 314 bp, as estimated from comparison to molecular size markers (A) and direct sequencing was detected in untreated testis (B), LPS-treated liver (C), and LPS-treated testis (D). The specificity of the RT-PCR reaction is indicated by the lack of a band in the water (E) and no RT controls (F). Direct sequencing of PCR products was used to confirm that the bands were genuine rat iNOS, and results were repeated twice with different animals

Expression of iNOS mRNA was not detectable by Northern blot analysis in control or low dose LPS-treated rat testis or liver, presumably because of the relative insensitivity of Northern blotting versus RT-PCR. In the high dose LPS-treated rats, however, an mRNA transcript of a size consistent with that previously published for iNOS [32] was observed in both liver (Fig. 3A) and testes (Fig. 3C). The time course of iNOS mRNA up-regulation following LPS treatment in the liver (i.e., 3–12 h postinjection) was consistent with previously published data [33]. Testicular iNOS mRNA was most dramatically increased at the 3-h and 6-h time points following high dose LPS treatment, although a reduced level of expression continued out to 18 h after LPS injection (Fig. 3). A similar result was obtained using samples from three separate animals at each time point.



View larger version (41K):
[in this window]
[in a new window]
 
FIG. 3. A representative Northern blot analysis of iNOS expression in the testis and liver following exposure to a high dose of LPS. Rats were injected with 5 mg/kg body weight with LPS and killed at the times indicated in hours along the bottom axis. A) Inducible NOS transcript of the appropriate size (~4 kb) was seen in LPS-treated liver 3, 6, and 12 h following injection of LPS. B) The relative mRNA loading was indicated by probing the same membrane for GAPDH. C) Following exposure to LPS, iNOS mRNA was detected in the testis at 3 h and 6 h postinjection. Lesser amounts of iNOS mRNA were detected out to 24 h postinjection. D) The relative mRNA loading was indicated by probing the same membrane for GAPDH

Expression of iNOS in the normal human testis is indicated in the EST databases where, at the time of preparing this manuscript, in excess of a dozen iNOS sequence entries were found in the human testis database (e.g., accession numbers: AA431389, AA432369, AA432381, and AA393074). At the time of writing, very few rat EST entries had been deposited into the database.

Nitric Oxide Inhibition and Testicular Function in Normal Rats

Single and repeated (three hourly) injections of L-NAME (30 mg/kg) caused a significant decrease (59% of control) in testicular IF volume by 6 h after the first injection (Fig. 4A), and a significant decrease in intratesticular (IF) testosterone (37% of control) and serum testosterone (46% of control) concentrations by 9 h (Fig. 4, B and C). Neither single nor repeated injections of L-NAME had any effect on serum LH concentrations (Fig. 4D). These data indicate that testicular steroidogenesis is relatively stable at 3 h and 6 h after L-NAME treatment, although prolonged inhibition of endogenous NO has a suppressive effect on testicular steroidogenesis in vivo.



View larger version (40K):
[in this window]
[in a new window]
 
FIG. 4. The effect of L-NAME on male rat A) IF volumes, B) serum and C) IF testosterone concentrations, and D) serum LH concentrations. Rats were injected with either saline at three hourly intervals (controls, open bars), L-NAME at time zero and saline subsequently (hatched bars), or with L-NAME at three hourly intervals (solid bars) and killed at the times indicated along the x-axis. Statistical comparisons are with the appropriate time-matched controls that received saline injections only: ns, no significant difference from control rats; *, a significant difference from control rats (P < 0.05)

Nitric Oxide Inhibition and the Testicular Response to LPS Treatment

As observed in the previous experiment, repeated (three hourly) injections of L-NAME caused reductions in IF volume (Fig. 5A) and testosterone concentrations in whole testis cytosols (Fig. 5B) and serum (Fig. 5C) but had no effect on serum LH levels (Fig. 5D). Testosterone concentration data for the limited number of IF samples obtained in this experiment were entirely consistent with the cytosol testosterone results (data not shown). Low dose (0.1 mg/kg) and high dose (5 mg/kg) LPS treatment caused reductions in IF volume and testosterone concentrations similar to those caused by L-NAME treatment. While pretreatment with L-NAME enhanced the inhibitory effect of low dose LPS on IF volume (to 7% of control), L-NAME had no additional effect in the presence of a high dose of LPS (Fig. 5A). Equally, L-NAME had no effect on the inhibition of testosterone production caused by LPS treatment (Fig. 5, B and C). Similar testosterone results were obtained for the available IF samples (data not shown). These data indicate that NO does not play a major role in mediating the inhibitory effects of LPS on IF volume or testosterone production at this time point in vivo.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 5. The effect of combined LPS injection (high or low doses) and L-NAME on IF volume (A), serum testosterone concentrations (B), testicular testosterone concentrations (C), and serum LH concentrations (D). The dose of LPS administered is indicated along the x-axis. Open bars indicate rats that received LPS/saline but no L-NAME, and the solid bars indicate rats that received both LPS/saline and L-NAME. All rats were killed 6 h after injection of LPS. Statistical comparisons are between untreated control rats (CONT) and the LPS-treated groups of rats that did not receive L-NAME (arrows and level of significance at the top of each panel) or between saline-injected and L-NAME-injected rats (untreated and LPS-treated): *P < 0.05; **P < 0.01; ***P < 0.001; ns, no significant difference from saline-injected rats (P > 0.05)

A significant reduction in serum LH was observed following injection of a high dose, but not a low dose, of LPS (Fig. 5D). Pretreatment with LPS had no significant effect on this response; however, in two rats treated with both a high dose of LPS and L-NAME, serum LH levels were considerably higher than controls resulting in a very large error value for this treatment group (Fig. 5D). This was consistent with a role for NO in the inhibitory response of the pituitary to LPS treatment, although there appears to be considerable variation among animals with respect to this response.

DISCUSSION

The protein and mRNA data presented herein clearly indicate that iNOS is expressed constitutively in Leydig cells and within Sertoli cells and spermatogenic cells at specific stages of development in the normal rat testis. This expression in normal testes was not due to any ongoing intratesticular inflammatory event as indicated by the relative lack of iNOS expression in endothelial and smooth muscle cells. Supporting evidence that iNOS is also constitutively expressed in the human testis, but not in other tissues, was provided by a survey of the EST databases. Because iNOS lacks the calcium regulation of the other two NOS isoforms, the presence of iNOS in the normal testis suggests that NO is being produced by this enzyme in the testis under normal conditions. These data represent unique evidence for a role of this induced enzyme in the normal function of a tissue.

Production of iNOS by the Sertoli cells, as well as a small subset of pachytene spermatocytes and stage IX elongating spermatids in the normal testis suggests an important regulatory role for this enzyme in spermatogenesis. The low levels of iNOS expression by Sertoli cells under basal conditions is further supported by the in vitro data of Stéphan et al. [34] and Bauché et al. [35]. Given the highly complex and coordinated series of events that regulate the conversion of a stem cell to a spermatozoa, transient NO production by iNOS would be a suitable mediator of rapid changes that occur during spermatogenesis [36]. Consequently, our data suggest that NO generated from iNOS may be involved in discrete regulatory processes within Sertoli cells, pachytene spermatocytes, and elongating spermatids.

The demonstration of iNOS within the Leydig cells provides an explanation for the observations of two types of staining for NADPH-diaphorase (an indicator of NOS activity) in human Leydig cells [12]. The particulate form observed within a subpopulation of Leydig cells was found to be the type I isoform. The diffuse cytoplasmic form present in all Leydig cells was not identified but may have been iNOS that is soluble within the cytoplasm [20]. The type III isoform of NOS has been immunolocalized to human Leydig and Sertoli cells [11]. It now appears that the NADPH-diaphorase activity observed in these cells may be due to iNOS as well. In contrast to the type I and III isoforms that produce NO only following a calcium influx and the binding of calmodulin [21, 37], iNOS produces NO in a calcium-independent manner. However, a study suggesting that the testis contains relatively low NOS activity [38] indicates that the actual level of activity of iNOS compared with the other NOS isoforms in the testis requires further examination. In any case, these data indicate that all three NOS isoforms may have a role in regulating testis function.

In the present study, prolonged inhibition of endogenous NO production by L-NAME in normal rats was found to reduce testicular IF formation and testosterone production, indicating a role for endogenously produced NO in the regulation of testicular blood flow and/or pressure and Leydig cell function under normal conditions. Earlier studies have indicated a role for endogenous NO in the acute regulation of testosterone secretion. Adams and colleagues [7, 16] showed that administration of L-NAME to adult rats resulted in a dose-dependent increase in testosterone secretion under either control conditions or in the presence of morphine, which is a potent suppressor of testosterone secretion, 2 h following injection. Acute inhibition of testicular steroidogenesis by NO also has been indicated by studies of the administration of NO substrates in vivo [7, 16, 39], and in vitro studies that show that NO is produced by the Leydig cells and inhibits Leydig cell steroidogenic enzyme activity [8, 4042]. In the present study, however, we found that at 3 h after injection with the same dose of L-NAME used in the earlier studies, serum and intratesticular testosterone levels had returned to normal. Testosterone production then proceeded to fall below control levels by 9 h after the initial injection. The decline in testicular testosterone concentration, moreover, was accompanied by a decline in IF volume, indicating an even larger fall in overall testosterone production. This progressive decline in testicular testosterone production and serum testosterone concentrations was not due to decreased serum LH levels, which remained within the normal range throughout the entire experiment [4].

Collectively these data suggest that the decrease in testosterone secretion during prolonged inhibition of NO production in vivo may be due to other effects, such as prolonged interference with testicular blood flow, that are independent of the direct effects of NO at the Leydig cell or anterior pituitary. Certainly, the reduction in IF volume seen following prolonged L-NAME treatment was suggestive of reduced blood flow to the testis. However, Lissbrant and colleagues [13] found that testicular blood flow was proportional to systemic blood pressure and actually increased for a period of at least 30 min after L-NAME injection. Moreover, increasing NO production through administration of NO substrates inhibited IF formation at 2 h [16]. These data indicate that endogenous NO has an acute negative effect on testicular blood flow and fluid formation, which is not consistent with the effects seen at the later time period. In fact, the very slow onset of effects observed in the present study tends to suggest that prolonged hypertension or secondary intratesticular responses to extended NO inhibition, rather than the direct effects of NO, may be responsible for these later effects.

Stimulation with either a low or high dose of LPS in vivo caused a dose-dependent increase in the expression of iNOS mRNA and protein in Leydig cells, Sertoli cells, and germ cells that reached a peak 6–12 h later then gradually declined. This was entirely consistent with the normal inflammatory response observed in other tissues and an earlier report [43] that iNOS mRNA is up-regulated within the testis following exposure to LPS. However, L-NAME did not prevent the inhibition of IF volume and testicular steroidogenesis that occurs within the first 6 h after LPS treatment. Thus, it appears that NO may not be the major inflammatory intermediate responsible for the inhibitory effects of LPS on IF volume and testosterone production at this time point [4]. In fact, the effects of L-NAME administration were almost identical to the effects of LPS-induced inflammation, suggesting the possibility of a common mode of action, although mediated by different mechanisms. However, because it is not possible to be certain of completely blocking NO production in the testis using this approach, a role for NO at some level cannot be excluded. Moreover, L-NAME has been shown to be able to reverse the inhibitory effects of sepsis on testosterone production at later time points [17]. Further studies are needed to resolve the apparently complex role of NO in regulating Leydig cell function during testicular inflammation.

The implications for testicular function of the up-regulation of iNOS in Sertoli cells, germ cells, and Leydig cells in response to LPS administration are equally difficult to predict. Up-regulation of testicular iNOS expression following treatment with a high dose of LPS may contribute to the seminiferous epithelium damage, i.e., germ cell sloughing and apoptosis, that occurs in these animals [4]. Depending on the milieu within which it is produced, NO can act to ameliorate or potentiate the cytotoxic effects of reactive oxygen species (ROS) [4345]. Data from other tissues has suggested that it may be the balance between NO and ROS that determines if NO acts in a protective or a destructive capacity [44, 46]. Nonetheless, an increase in the production of ROS, or the inappropriate NO-mediated activation of intracellular pathways may in part contribute to the observed germ cell damage, sloughing, and apoptosis from seminiferous tubules following LPS treatment [4]. Furthermore, there is increasing evidence that ROS may be an important factor in mediating damage either to human testis and sperm function manifested as infertility [47]. This damage is mediated through a variety of effects ranging from direct cytotoxicity to lipid peroxidative changes in membrane fluidity to DNA fragmentation. Unfortunately, it was not possible to extend the current experiments to investigate the effects of NO on spermatogenesis that becomes evident around 18 h after high dose LPS treatment, because of the adverse effects of L-NAME in conjunction with LPS on animal well-being at longer time points.

Finally, while NO has been implicated as a mediator of the actions of inflammatory cytokines at the hypothalamic-pituitary level [48], we observed evidence for this in only a few animals in the present study. This suggests that, in comparison to the more consistent response of the testis, there may be considerable animal-to-animal variation in the response of the central nervous system to various inflammatory mediators.

In summary, these studies have identified for the first time a potential role for iNOS in regulating the normal functions of a particular organ, i.e., the testis. A role for iNOS in mediating inflammatory damage on the testis during inflammation is also suggested by data in the present study, although its relative importance as well as the mechanisms involved remain to be determined. Further studies are clearly warranted to determine the physiological role of this enzyme in normal and pathological function of the testis.

ACKNOWLEDGMENTS

We thank Kim Sebire and Julie Muir for their excellent technical assistance.

FOOTNOTES

First decision: 14 February 2000.

1 These studies were supported by research grants from the National Health and Medical Research Council of Australia. S.S. was supported by the Deutsche Forchungsgemeinschaft (grant Schla 394/1-1). M.K.O. is the recipient of a Peter Doherty postdoctoral fellowship from the National Health and Medical Research Council of Australia. Back

2 Correspondence. FAX: 61 3 9594 7111; mark.hedger{at}med.monash.edu.au Back

3 Current address: Institut für Reproductionsmedizin der Universität Münster, Domagkstr. 11, 48149 Münster, Germany. Back

Accepted: June 7, 2000.

Received: January 19, 2000.

REFERENCES

  1. Adamopoulos DA, Lawerence DM, Vassilopoulos P, Contoyiannis PA, Swyer GIM. Pituitary-testicular interrelationships in mumps orchitis and other viral infections. Br Med J 1078; 1:1177–1180.
  2. Cutolo ME, Chan MK, Movat HZ. Sex hormone status of patients with rheumatoid arthritis: evidence of low serum concentrations at baseline and after human chorionic gonadotrophin stimulation. Arthritis Rheum 1988; 31:1314–1317.[Medline]
  3. Buch JP, Havlovec SK. Variation in sperm penetration assay related to viral illness. Fertil Steril 1991; 55:844–846.[Medline]
  4. O'Bryan MK, Schlatt S, Phillips DJ, de Kretser DM, Hedger MP. Bacterial lipopolysaccharide-induced inflammation compromises testicular function at multiple levels in vivo. Endocrinology 2000; 141:238–246.[Abstract/Free Full Text]
  5. Jégou B, Cudicini C, Gomez E, Stéphan JP. Interleukin-1, interleukin-6 and the germ cell-Sertoli cell cross-talk. Reprod Fertil Dev 1995; 7:723–730.[CrossRef][Medline]
  6. Hales DB. Leydig cell-macrophage interactions: an overview. In: Payne AH, Hardy MP, Russell LD (eds.), The Leydig Cell. Vienna: Cache River Press; 1996: 451–465.
  7. Adams ML, Meyer ER, Cicero TJ. Effects of nitric oxide-related agents on opioid regulation of rat testicular steroidogenesis. Biol Reprod 1996; 54:1128–1134.[Abstract]
  8. del Punta K, Charreau EH, Pignataro OP. Nitric oxide inhibits Leydig cell steroidogenesis. Endocrinology 1996; 137:5337–5343.[Abstract]
  9. Van Voorhis BJ, Dunn MS, Snyder GN, Weiner CP. Nitric oxide: an autocrine regulator of human granulosa-luteal cell steroidogenesis. Endocrinology 1994; 135:1799–1806.[Abstract]
  10. Cameron LA, Hinson JP. The role of nitric oxide derived from L-arginine in the control of steroidogenesis, and perfusion medium flow rate in the isolated perfused rat adrenal gland. J Endocrinol 1993; 139:415–423.[Abstract]
  11. Zini A, O'Bryan M, Magid MS, Schlegel PN. Immunohistochemical localization of endothelial nitric oxide synthase in human testis, epididymis and vas deferens suggest a possible role for nitric oxide in spermatogenesis, sperm maturation, and programmed cell death. Biol Reprod 1996; 55:935–941.[Abstract]
  12. Davidoff MS, Middendorff R, Mayer B, Holstein AF. Nitric oxide synthase (NOS-I) in Leydig cells of the human testis. Arch Histol Cytol 1995; 58:17–30.[Medline]
  13. Lissbrant E, Lofmark U, Collin O, Bergh A. Is nitric oxide involved in the regulation of the rat testicular vasculature? Biol Reprod 1997; 56:1221–1227.[Abstract]
  14. Wang Y, Goligorsky MS, Lin M, Wilcox JN, Marsden PA. A novel, testis-specific mRNA transcript encoding an NH2-terminal truncated nitric-oxide synthase. J Biol Chem 1997; 272:11392–11401.[Abstract/Free Full Text]
  15. Adams ML, Nock B, Truong R, Cicero TJ. Nitric oxide control of steroidogenesis: endocrine effects of NG-nitro-L-arginine and comparison to alcohol. Life Sci 1992; 50:PL35–PL40.
  16. Adams ML, Meyer ER, Sewing BN, Cicero TJ. Effects of nitric oxide-related agents on rat testicular function. J Pharmacol Exp Ther 1994; 269:230–237.[Abstract/Free Full Text]
  17. Sharma AC, Sam AD, Lee LY, Hales DB, Law WR, Ferguson JL, Bosmann HB. Effects of NG-nitro-L-arginine methyl ester on testicular blood flow and serum steroid hormones during sepsis. Shock 1998; 9:416–421.[Medline]
  18. Xie Q-W, Cho HJ, Calaycay J, Mumford RA, Swiderek KM, Lee TD, Ding A, Trosco T, Nathan C. Cloning and characterization of inducible nitric oxide synthase from mouse macrophages. Science 1992; 256:225–228.[Abstract/Free Full Text]
  19. Schmidt HHHW, Walter U. NO at work. Cell 1994; 78:919–925.[CrossRef][Medline]
  20. Stuehr DJ. Structure-function aspects in the nitric oxide synthases. Annu Rev Pharmacol Toxicol 1997; 37:339–359.[CrossRef][Medline]
  21. Meinhardt A, Bacher M, Metz C, Bucala R, Wreford N, Lan H, Atkins R, Hedger M. Local regulation of macrophage subsets in the adult rat testis: examination of the roles of the seminiferous tubules, testosterone, and macrophage-migration inhibitory factor. Biol Reprod 1998; 59:371–378.[Abstract/Free Full Text]
  22. Schlatt S, de Kretser DM, Hedger MP. Mitosis of resident macrophages in the adult rat testis. J Reprod Fertil 1999; 116:223–228.[Abstract]
  23. Rees DD, Palmer RMJ, Schulz R, Hodson H, Moncada S. Characterization of three inhibitors of endothelial nitric oxide synthase in vitro and in vivo. Br J Pharmacol 1990; 101:746–752.[Medline]
  24. Sun YT, Wreford NG, Robertson DM, de Kretser DM. Quantitative cytological studies of spermatogenesis in intact and hypophysectomized rats: identification of androgen-dependent stages. Endocrinology 1990; 127:1215–1223.[Abstract]
  25. Kerr JB, Robertson DM, de Kretser DM. Morphological and functional characterization of interstitial cells from mouse testes fractionated on Percoll density gradients. Endocrinology 1985; 116:1030–1043.[Abstract]
  26. Chandrasekar B, Melby PC, Troyer DA, Colston JT, Freeman GL. Temporal expression of pro-inflammatory cytokines and inducible nitric oxide synthase in experimental acute chagasic cardiomyopathy. Am J Pathol 1998; 152:925–934.[Abstract]
  27. Kallio EA, Koskinen PK, Aavik E, Vaali K, Lemstrom KB. Role of nitric oxide in experimental obliterative bronchiolitis (chronic rejection) in the rat. J Clin Invest 1997; 100:2984–2994.[Medline]
  28. Chomczynski P, Sacchi N. Single step method of RNA isolation by acid guanidinium thiocynanate-phenol-chloroform extraction. Anal Biochem 1987; 162:156–159.[Medline]
  29. Galea E, Reis DJ, Feinstein DL. Cloning and expression of inducible nitric oxide synthase from rat astrocytes. J Neurosci Res 1994; 37:406–414.[CrossRef][Medline]
  30. Katsahamas S, Hearn MTW. Application of an optimised reverse transcriptase-polymerase chain reaction method for the determination of the cDNA nucleotide sequence of porcine fibroblast growth factor. J Biochem Biophys Methods 1997; 33:231–243.
  31. Althschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990; 215:403–410.[CrossRef][Medline]
  32. Lowenstein CJ, Glatt CS, Bredt DS, Snyder SH. Cloned and expressed macrophage nitric oxide synthase contrasts with the brain enzyme. Proc Natl Acad Sci U S A 1992; 298:249–258.
  33. Mori M, Gotoh T, Nagasaki A, Takiguchi M, Sonoki T. Regulation of the urea cycle enzyme gene in nitric oxide synthesis. J Inherited Metab Dis 1998; 21(suppl 1):59–71.
  34. Stéphan J-P, Guillemois C, Jégou B, Bauché F. Nitric oxide production by Sertoli cells in response to cytokines and lipopolysaccharide. Biochem Biophys Res Commun 1995; 213:218–224.[CrossRef][Medline]
  35. Bauché F, Stéphan J-P, Touzalin AM, Jégou B. In vitro regulation of an inducible-type NO synthase in the rat seminiferous tubule cells. Biol Reprod 1998; 58:431–438.[Abstract/Free Full Text]
  36. de Kretser DM, Loveland KL, Meinhardt A, Simorangkir D, Wreford N. Spermatogenesis. Hum Reprod 1998; 13(suppl):1–8.
  37. Abu-Soud HM, Stuehr DJ. Nitric oxide synthases reveal a role for calmodulin in controlling electron transfer. Proc Natl Acad Sci U S A 1993; 90:10769–10772.[Abstract/Free Full Text]
  38. Burnett AL, Ricker DD, Chamness SL, Maguire MP, Crone JK, Bredt DS, Snyder SH, Chang TSK. Localization of nitric oxide synthase in the reproductive organs of the male rat. Biol Reprod 1995; 52:1–7.[Abstract]
  39. Gaytán F, Bellido C, Aguilar R, Morales C, van Rooijen N, Aguilar E. Role of the testis in the response of the pituitary-testicular axis to nitric oxide-related agents. Eur J Endocrinol 1997; 137:301–308.[Abstract]
  40. Welch C, Watson ME, Poth M, Hong T, Francis GL. Evidence to suggest nitric oxide is an interstitial regulator of Leydig cell steroidogenesis. Metabolism 1995; 44:234–238.[CrossRef][Medline]
  41. Tatsumi N, Fujisawa M, Kanzaki M, Okuda Y, Okada H, Arakawa S, Kamidono S. Nitric oxide production by cultured rat Leydig cells. Endocrinology 1997; 138:994–998.[Abstract/Free Full Text]
  42. Pomerantz DK, Pitelka V. Nitric oxide is a mediator of the inhibitory effect of activated macrophages on production of androgen by the Leydig cell of the mouse. Endocrinology 1998; 139:922–931.[Abstract/Free Full Text]
  43. Nagasaki A, Gotoh T, Takeya M, Yu Y, Takiguchi M, Matsuzaki H, Takatsuki K, Mori M. Coinduction of nitric oxide synthase agrinosuccinate sythetase, and arginosuccinate lyase in lipopolysaccharide-treated rats. J Biol Chem 1996; 271:2658–2662.[Abstract/Free Full Text]
  44. Lipton SA, Choi YB, Sucher NJ, Chen HS. Neuroprotective versus neurodestructive effects of NO-related species. Biofactors 1998; 8:33–40.[Medline]
  45. Wolkow P. Involvement and dual effects of nitric oxide in septic shock. Inflamm Res 1998; 47:152–166.[CrossRef][Medline]
  46. Lipton SA, Choi YB, Pan ZH, Lei S, Chen HSV, Sucher NJ, Loscalzo J, Singel DJ, Stamler JS. A redox-based mechanism for the neuroprotective and neurodestructive effects of nitric oxide and related nitroso-compounds. Nature 1993; 364:626–632.[CrossRef][Medline]
  47. Aitken RJ. The Amoroso lecture. The human spermatozoon—a cell in crisis? J Reprod Fertil 1999; 115:1–7.[Abstract]
  48. McCann SM, Kimura M, Karanth S, Yu WH, Rettori V. Nitric oxide controls the hypothalamic-pituitary response to cytokines. Neuroimmunomodulation 1997; 4:98–106.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
B. A. Weissman, C. M. Sottas, P. Zhou, C. Iadecola, and M. P. Hardy
Testosterone production in mice lacking inducible nitric oxide synthase expression is sensitive to restraint stress
Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E615 - E620.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
V. Cerec, C. Piquet-Pellorce, H. A.A. Aly, A.-M. Touzalin, B. Jegou, and F. Bauche
Multiple Pathways for Cationic Amino Acid Transport in Rat Seminiferous Tubule Cells
Biol Reprod, February 1, 2007; 76(2): 241 - 249.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
H. Wang, S. K. Dey, and M. Maccarrone
Jekyll and Hyde: Two Faces of Cannabinoid Signaling in Male and Female Fertility
Endocr. Rev., August 1, 2006; 27(5): 427 - 448.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Y. Vera, K. Erkkila, C. Wang, C. Nunez, S. Kyttanen, Y. Lue, L. Dunkel, R. S. Swerdloff, and A. P. Sinha Hikim
Involvement of p38 Mitogen-Activated Protein Kinase and Inducible Nitric Oxide Synthase in Apoptotic Signaling of Murine and Human Male Germ Cells after Hormone Deprivation
Mol. Endocrinol., July 1, 2006; 20(7): 1597 - 1609.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
L. Cotton, G. M. Gibbs, L. G. Sanchez-Partida, J. R. Morrison, D. M. de Kretser, and M. K. O'Bryan
FGFR-1 signaling is involved in spermiogenesis and sperm capacitation
J. Cell Sci., January 1, 2006; 119(1): 75 - 84.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
N. P.Y. Lee, D. D. Mruk, C.-h. Wong, and C. Y. Cheng
Regulation of Sertoli-Germ Cell Adherens Junction Dynamics in the Testis Via the Nitric Oxide Synthase (NOS)/cGMP/Protein Kinase G (PRKG)/{beta}-Catenin (CATNB) Signaling Pathway: An In Vitro and In Vivo Study
Biol Reprod, September 1, 2005; 73(3): 458 - 471.
[Abstract] [Full Text] [PDF]


Home page
J. Gerontol. A Biol. Sci. Med. Sci.Home page
A. P. S. Hikim, Y. Vera, D. Vernet, M. Castanares, M. Diaz-Romero, M. Ferrini, R. S. Swerdloff, N. F. Gonzalez-Cadavid, and C. Wang
Involvement of Nitric Oxide-Mediated Intrinsic Pathway Signaling in Age-Related Increase in Germ Cell Apoptosis in Male Brown-Norway Rats
J. Gerontol. A Biol. Sci. Med. Sci., June 1, 2005; 60(6): 702 - 708.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. Tfelt-Hansen, A. Ferreira, S. Yano, D. Kanuparthi, J. R. Romero, E. M. Brown, and N. Chattopadhyay
Calcium-sensing receptor activation induces nitric oxide production in H-500 Leydig cancer cells
Am J Physiol Endocrinol Metab, June 1, 2005; 288(6): E1206 - E1213.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. K. O'Bryan, O. Gerdprasert, D. J. Nikolic-Paterson, A. Meinhardt, J. A. Muir, L. M. Foulds, D. J. Phillips, D. M. de Kretser, and M. P. Hedger
Cytokine profiles in the testes of rats treated with lipopolysaccharide reveal localized suppression of inflammatory responses
Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2005; 288(6): R1744 - R1755.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
B. A. Weissman, E. Niu, R. Ge, C. M. Sottas, M. Holmes, J. C. Hutson, and M. P. Hardy
Paracrine Modulation of Androgen Synthesis in Rat Leydig Cells by Nitric Oxide
J Androl, May 1, 2005; 26(3): 369 - 378.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
M. Hedger, J. Klug, S. Frohlich, R. Muller, and A. Meinhardt
Regulatory Cytokine Expression and Interstitial Fluid Formation in the Normal and Inflamed Rat Testis Are Under Leydig Cell Control
J Androl, May 1, 2005; 26(3): 379 - 386.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. K. O'Bryan, L. M. Foulds, J. F. Cannon, W. R. Winnall, J. A. Muir, K. Sebire, A. I. Smith, H.-H. Keah, M. T. W. Hearn, D. M. de Kretser, et al.
Identification of a Novel Apolipoprotein, ApoN, in Ovarian Follicular Fluid
Endocrinology, November 1, 2004; 145(11): 5231 - 5242.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. C. Douglas, M. K. O'Bryan, M. P. Hedger, D. K. L. Lee, M. A. Yarski, A. I. Smith, and R. A. Lew
The Novel Angiotensin-Converting Enzyme (ACE) Homolog, ACE2, Is Selectively Expressed by Adult Leydig Cells of the Testis
Endocrinology, October 1, 2004; 145(10): 4703 - 4711.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
N. P.Y. Lee and C. Y. Cheng
Nitric Oxide/Nitric Oxide Synthase, Spermatogenesis, and Tight Junction Dynamics
Biol Reprod, February 1, 2004; 70(2): 267 - 276.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Lue, A. P. Sinha Hikim, C. Wang, A. Leung, and R. S. Swerdloff
Functional Role of Inducible Nitric Oxide Synthase in the Induction of Male Germ Cell Apoptosis, Regulation of Sperm Number, and Determination of Testes Size: Evidence from Null Mutant Mice
Endocrinology, July 1, 2003; 144(7): 3092 - 3100.
[Abstract] [Full Text] [PDF]