Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Friedman, A.
Right arrow Articles by Meidan, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Friedman, A.
Right arrow Articles by Meidan, R.
Agricola
Right arrow Articles by Friedman, A.
Right arrow Articles by Meidan, R.
Biology of Reproduction 63, 1905-1912 (2000)
© 2000 Society for the Study of Reproduction, Inc.


Regular article

Role of Tumor Necrosis Factor {alpha} and Its Type I Receptor in Luteal Regression: Induction of Programmed Cell Death in Bovine Corpus Luteum-Derived Endothelial Cells

Aharon Friedman2,a, Shay Weiss2,a, Nizan Levyb, and Rina Meidan2,b

a Sections of Immunology and b Reproduction, Department of Animal Sciences, Faculty of Agricultural, Environmental and Food Sciences, Hebrew University of Jerusalem, Rehovot, Israel

ABSTRACT

The role of tumor necrosis factor {alpha} (TNF{alpha}) and its type I receptor (TNFRI) in structural luteolysis was investigated. A semiquatitative reverse-transcription polymerase chain reaction (RT-PCR) was used to characterize the pattern of TNFRI mRNA expression within the corpus luteum (CL) throughout the estrous cycle and its cellular distribution. Increase in TNFRI mRNA levels was recorded both in regressed luteal tissue and in CL of cows injected with prostaglandin F2{alpha}. All three major cell types composing the CL, steroidogenic (large and small) and endothelial cells expressed the TNFRI gene. A densitometric analysis of TNFRI mRNA expression revealed that resident endothelial cells had significantly higher levels of TNFRI mRNA than steroidogenic luteal cells. The physiological effects associated with TNFRI expression were investigated in the various luteal cell types. TNF{alpha}-induced programmed cell death (PCD) in dose- and time-dependent manners of cultured luteal endothelial cells (LECs) but not of in vitro luteinized steroidogenic cells. Several lines of evidence are provided to show that progesterone regulates luteal cell survival: 1) CL and LECs express progesterone receptor mRNA, 2) physiological levels of the steroid abolished TNF{alpha}-induced PCD of LECs, and 3) progesterone-producing cells are protected from PCD. In conclusion, this study suggests that TNF{alpha}-induced PCD during structural luteolysis is mediated by TNFRI, primarily affects endothelial cells, and that the decline in progesterone, preceding structural luteolysis, is a prerequisite for the initiation of apoptosis in endothelial cells.

corpus luteum, corpus luteum function, cytokines, hormone action, ovulatory cycle, reproductive immunology

INTRODUCTION

The luteolytic cascade of the bovine corpus luteum (CL) is primed by surges of uterine prostaglandin F2{alpha} (PGF2{alpha}). A rapid functional regression [1], characterized by inhibition of progesterone release, is followed by a phase of structural regression [2, 3]. During luteolysis, cells of the CL undergo programmed cell death (PCD), a process that has been morphologically described in humans, cows, pigs, mice, and golden hamsters [2, 47]. Unlike the well-characterized histological aspects, the cellular and molecular mechanisms associated with the apoptotic events in the CL are just beginning to become unraveled.

Immune cells and cytokines were shown to play a role in regulating luteal functions [8, 9]. In PGF2{alpha}-treated pig CL, macrophage numbers progressively increased within 24 h [10]. The probable source for these macrophages was circulation-derived monocytes emigrating in response to local chemotactic factors, such as monocyte chemoattractant protein-1 (MCP-1). Enhanced MCP-1 expression in CL during natural and PGF2{alpha}-induced luteolysis in domestic ruminants [11, 12] supports the contention that luteolysis involves macrophage recruitment.

Activated macrophages secrete tumor necrosis factor {alpha} (TNF{alpha}) in response to various stimuli, including PGF2{alpha} [13, 14], and were postulated to be its major source in pig and cow CL [14, 15]. TNF{alpha} inhibited progesterone production and enhanced PGF2{alpha} secretion from bovine and pig luteal cells [16, 17]. High levels of TNF{alpha} (>100 pg/ml) were detected in the bovine CL 36 h after PGF2{alpha}-induced luteolysis [18]. Similarly, high TNF{alpha} bioactivity was recorded in PGF2{alpha}-treated sheep CL and in LPS-treated rabbit CL [19, 20]. Surprisingly, luteal TNF{alpha} mRNA expression in bovine CL remained unchanged during PGF2{alpha}-induced luteolysis [21]. Combinations of interferon {gamma} (IFN-{gamma}) and TNF{alpha} decreased the number of viable mouse luteal cells on Days 3–6 of culture [6]. Although TNF{alpha} binding sites were identified in luteal membranes of various species [22, 23], the localization of these receptors to cell types composing the CL or the receptor subtype were not clearly identified.

The present study was undertaken to characterize the pattern of TNF receptor type I (TNFRI) mRNA expression throughout the bovine estrous cycle. We determined the cellular distribution and temporal expression patterns of the receptor following PGF2{alpha} administration and continued to examine the effects of this cytokine on the viability of luteal cell populations.

MATERIALS AND METHODS

Reagents

RPMI 1640, DMEM-F12, Na-pyruvate, penicillin-streptomycin, L-glutamin and fetal calf serun (FCS) were obtained from Biological Industries (Beit HaEmek, Israel). PGF2{alpha} analogue, Cloprostenol-Estrumate was obtained from Coopers (Berkhamsted, England). Forskolin, insulin, MTT [(3-(4,5-dimethyl-thiazoyl-2-yl)-2,5-diphenyltetrazolium bromide] and DAPI [4,6-diamidino-2-phenylindole] were obtained from Sigma (St. Louis, MO). SuperScript II RNase H- reverse transcriptase was obtained from Gibco BRL Life Technologies (Gaithersburg, MD). Deoxynucleotide triphosphates (dNTPs), random hexamer oligodeoxynucleotides, Taq DNA polymerase, and BglI were obtained from Farmentas (Vilnius, Lithuania). Oligonucleotide primers were synthesized by Biotechnology General (Kiryat Weizmann, Rehovot, Israel). Recombinant human TNF{alpha} (rhTNF{alpha}) and polyclonal rabbit anti-human TNF{alpha} (IP-300) were obtained from Genzyme (Cambridge, MA).

CL Collection and Luteal Cell Enrichment

Bovine CL were collected at different stages of the luteal phase as previously described [24]. Briefly, CL were collected at slaughter, and CL age was determined macroscopically as described by Fields and Fields [25]. In experiments in which PGF2{alpha} was used to induce luteolysis, a PGF2{alpha} analogue (500 µg cloprostenol) was injected (i.m.) at mid-cycle. Tissues were snap-frozen in liquid nitrogen and stored at -70°C. Total RNA was extracted from tissues by the guanidinium thiocyanate method [26]. Enriched populations of luteal cell types (large luteal cells [LLCs], small luteal cells [SLCs], and endothelial cells [ECs]) were isolated after collagenase digestion and centrifugal elutriation as previously described [27]. Briefly, collagenase-dissociated cells (100 x 106) were resuspended and subjected to centrifugal elutriation using a Sanderson elutriation chamber and the eluates were collected with continuous flow. The yield and viability of cells in each fraction was determined immediately after elutriation. Fraction 1 contained predominantly ECs (78.2% ± 9.7%) and SLCs (15.2% ± 4.1%; n = 3). Fraction 2 contained 81.6% ± 2.78% SLCs, 0.3% ± 0.22% LLCs, and 15.7% ± 2.08 ECs (n = 3). Fraction 4 contained 59.6% ± 6.62% LLCs, 21.6% ± 5.01% SLCs, and 18.1% ± 1.47% ECs (n = 3). RNA was extracted from fractions 1, 2, and 4 by the guanidinium thiocyanate method.

In Vitro Luteinized Granulosa and Theca Cells

Granulosa and theca cells were isolated from healthy bovine preovulatory follicles as previously described [28, 29]. Cells from individual follicles were cultured in 24-well plates (8 x 104 granulosa and 3 x 104 theca cells per well) for 8 days in DMEM-F12 media (basal media) containing 1% FCS, insulin (2 µg/ml), and forskolin (10 µM), conditions that were previously shown to induce cell luteinization [28, 29]. Luteinized theca and granulosa cells are referred to as LTCs and LGCs, respectively.

Endothelial Cell Culture

Luteal endothelial cells (LECs), derived from microvessels of the bovine CL were kindly provided by Dr. Katharina Spanel-Borowski (University of Leipzig, Germany) [30]. The endothelial cells (1 x 105/well) were grown in RPMI 1640 containing 10% FCS, 1 mM L-glutamin, 10 mM Na-pyruvate, 100 U/ml penicillin, and 100 µg/ml streptomycin on plates that had been precoated with collagen type I (Vitrogen 100). Experiments were performed on confluent cultures and cells were obtained from passages 4–10.

Semi-Quantitative RT-PCR

Semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) was carried out with the housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (G3PDH), as an internal standard. G3PDH is constitutively expressed and has been used effectively in studies on the regulation of gene expression in ovarian cells [27, 31, 32]. The RT-PCR amplification was calibrated in order to determine the optimal number of cycles that would allow detection of the appropriate mRNA transcripts while still keeping amplification for these genes in the log phase (primer dropping method [33]). G3PDH oligonucleotide primer pair (sense 5'-TGTTCCAGTATGATTCCACCC-3'; antisense 5'-TCCACCACCCTGTTGCTGTA-3') and P450 side chain cleavage (P450scc) oligonucleotide primer pair (sense 5'-AACGTCCCTCCAGAACTGTACC-3'; antisense 5'-CTTGCTTATGTCTCCCTCTGCC-3') were synthesized according to bovine sequences (GenBank accession numbers AF077815 and Y10214, respectively) [24]. The TNFRI primer pairs (sense 5'-GACCTGGAGAAGAGAGAGAGTC-3'; antisense 5'-CTTAGCATGTCGCTACCA-3') were synthesized according to bovine TNFRI cDNA (GenBank accession number U90937). This set of primers does not amplify TNF receptor type II (TNFRII).

The expected PCR product lengths were 850 base pairs (bp) for G3PDH, 395 bp for P450scc, and 604 bp for TNFRI. With the exception of luteal ECs, the number of cycles used for PCR reactions were 23 cycles for G3PDH and P450scc, and 27 cycles for TNFRI. When ECs were used, G3PDH was amplified for 21 cycles and TNFRI for 24 cycles. Computer searches and sequence alignments were performed with software from Genetics Computer Group, Inc. (Madison, WI). To verify the sequence of the TNFRI PCR product, it was cleaved at a unique restriction site using BglI. Figure 1 demonstrates the amplified cDNA and the expected 199- and 405-bp fragments obtained after enzymatic cleavage.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 1. Identification of the PCR product for TNFRI by means of the restriction enzyme, BglI. The expected size of the noncleaved PCR product was 604 bp. In the inverted image, these products were applied to the lane marked (-). Part of the PCR reaction was incubated for 2 h with BglI and applied to the lane marked (+). Lane M: 100-bp DNA ladder. The site of digestion is shown on the right, and the predicted fragment sizes after digestion were 405 and 199 bp

Detection of Cell Death

In situ apoptosis LECs, LTCs, and LGCs were grown to confluence on glass slides that had been precoated with collagen type I, and were then exposed to 100 ng/ml rhTNF{alpha} for 18 h (a dose previously shown to affect luteal steroidogenesis [34]). The cells were fixed with EFA (70% ethanol, 3.7% formaldehyde, 5% glacial acetic acid) for 10 min at -20°C, and then permeabilized with 0.25% Triton X-100 in PBS pH 7.4 for 15 min at room temperature. Apoptosis was determined by immunoperoxidase staining of 3'-OH digoxigenin-labeled ends according to a protocol supplied by the manufacturer (Apoptag S7100 kit, Intergen, Oxford, UK).

Quantification of apoptosis by nuclear morphology LECs, LTCs, and LGCs were grown to confluence on glass slides that had been precoated with collagen type I, and were then exposed to 100 ng/ml rhTNF{alpha} for 6, 12, and 24 h. Control cells were cultured for 24 h in the presence of media only. The cells were fixed with EFA for 10 min at -20°C and then permeabilized with 0.25% Triton X-100 in PBS for 15 min at room temperature. The slides were washed in PBS three times and stained with PBS containing 1 µg/ml DAPI at room temperature for 5 min, and then washed 3x with PBS and kept in a dark slide box until photographed under a fluorescence microscope.

Cytotoxic assays LECs, LTCs, and LGCs were grown to confluence in 96-well plates and were then exposed to rhTNF{alpha} (12.5–100 ng/ml) for 18 h in the presence or absence of progesterone (10-7 to 10-11 M). Cell viability was determined by MTT uptake as described previously [35]. Viable, stained cells were dissolved in dimethyl sulphoxide and absorbance (A) was measured at 570 nm with the reference filter set at 630 nm. Cells treated with media alone were considered to be an index for 100% viability, whereas cells treated Triton X-100 (4%) were considered as an index for 100% cytotoxicity. The percentage of cytotoxicity was calculated as follows:

Statistical Analysis

Data are presented as means ± SEM. Statistical analysis was carried out using the JMP package (version 3.2; SAS Institute Inc., Cary, NC). Densitometric values of PCR products were analyzed by one-way ANOVA. Percentage of apoptotic cells was analyzed by two-way ANOVA using time of incubation and TNF{alpha} dose as main effects and their interaction. Percentage of cytotoxicity was also analyzed by two-way ANOVA using progesterone and TNF{alpha} doses as main effects and their interaction.

RESULTS

TNFRI and P450scc mRNA expression was determined in CL collected during various stages of the estrous cycle (Fig. 2A): early (<Day 5) , mid (Days 5–8), late (Days 12–16), and regressed (>Day 18). High levels of P450scc were expressed through most of the luteal life span, with an increase toward mid cycle. In the regressed CL, a marked decline in the expression of P450scc mRNA was detected. TNFRI mRNA levels, on the other hand, were low throughout most stages of the cycle (early, mid, and late stages) with a significant increase occurring during the time of luteal regression (on Days 18–21 of the bovine cycle). In order to determine whether this up-regulation of TNFRI mRNA resulted from endogenous PGF2{alpha}, a luteolytic dose of PGF2{alpha} was administered to cows at mid-cycle. Indeed, PGF2{alpha} induced a significant increase in TNFRI mRNA levels within 24 h of injection (Fig. 2B). The fold increase of TNFRI mRNA as induced by PGF2{alpha} was similar to that observed during natural luteolysis (3.49 ± 0.66 and 3.47 ± 0.58, respectively).



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 2. Expression of TNFRI mRNA. A) During the bovine estrous cycle. Total RNA was extracted from CL collected at various stages of the cycle. An inverted image of a representative RT-PCR reaction for each cycle phase is shown in the top panel. The lower panel is a densitometric analysis of TNFRI and P450scc relative to G3PDH (mean ± SEM, n = 4 per group). Luteal phase stages: early, Days 3–5; mid, Days 7–8; late, Days 12–16; and regressed, Days 18–21. Different letters (uppercase for TNFRI and lowercase for P450scc) indicate significant (P < 0.05) statistical differences. B) Effect of PGF2{alpha}-induced luteolysis. A luteolytic dose of PGF2{alpha} analogue was injected into cows (n = 4) and TNFRI mRNA was measured by RT-PCR 24 h later and compared with that of control, noninjected cows (n = 4). Results are a densitometric analysis of TNFRI relative to G3PDH (mean ± SEM, n = 4). *Statistically (P < 0.05) significant differences from control, nontreated cows

TNFRI mRNA levels were then determined in enriched bovine luteal cell types. All three major cell populations comprising the CL (i.e., LLCs, SLCs, and endothelial cells) expressed the TNFRI gene (Fig. 3A). A densitometric analysis of TNFRI mRNA expression revealed that resident endothelial cells expressed significantly (P < 0.05) higher levels of TNFRI (2.1 ± 0.11) than did LLCs or SLCs (1.04 ± 0.02 and 1.66 ± 0.12, respectively, Fig. 3A). The TNFRI gene was also expressed in in vitro-luteinized granulosa cells (LGCs) and theca cells (LTCs) and in LECs in amounts similar to those found in cells enriched from bovine CL (Fig. 3B).



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 3. Expression of TNFRI mRNA in luteal cell types. A) In vivo-enriched bovine CL cells: large luteal (LLC), small luteal (SLC), and endothelial (EC). B) In vitro-luteinized granulosa cells (LGCs), luteinized theca cells (LTCs), and cultured luteal endothelial cells (LECs). Upper panel: an inverted image of a representative RT-PCR. Lower panel: the corresponding densitometric analysis of TNFRI relative to G3PDH (mean ± SEM, n = 3 individual CL for in vivo data and three experiments for in vitro data). Different letters (uppercase for in vivo and lowercase for in vitro) indicates statistically (P < 0.05) significant differences from other cell preparations

The effect of rhTNF{alpha} on LECs and steroidogenic luteal cells (LTCs and LGCs) was studied next. rhTNF{alpha} had a cytotoxic effect on these endothelial cells, which was both time-dependent (P < 0.001) and dose-dependent (P < 0.001; Figs. 4 and 5). Cell death was shown to be caused by PCD, as demonstrated by direct detection of 3' ends in the genomic DNA (Fig. 4A). A significant cytotoxic effect of TNF{alpha} was induced by 1.56 ng of TNF{alpha}/ml (P< 0.02; as compared with control untreated cells) and increased with increasing TNF{alpha} dosages (Fig. 4B). Cytotoxicity was TNF{alpha}-specific as it was abolished by polyclonal anti-rhTNF{alpha} antibodies (P < 0.001; Fig. 4B). In order to characterize PCD temporally, LECs were treated with 100 ng/ml rhTNF{alpha} at various time points and stained with DAPI (Fig. 5). Apoptotic nuclei in LEC cultures increased over a 24-h culture period. In contrast to LECs, steroidogenic luteal cells (LGCs and LTCs) did not undergo PCD following TNF{alpha} treatment (100 ng/ml) up to 48 h of culture (results not shown).



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 4. rhTNF{alpha}-Induced PCD in luteal endothelial cells. A) Direct immunoperoxidase detection of digoxigenin-labeled genomic DNA. LECs were exposed to 100 ng/ml TNF{alpha} for 18 h, and apoptotic nuclei are indicated by arrows. B) Percent cytotoxicity (defined in Materials and Methods) is plotted as a function of increasing rhTNF{alpha}. LECs were grown on 96-well plates and exposed to increasing concentrations of rhTNF{alpha} in the presence or absence of anti-rhTNF{alpha} polyclonal antibody. Viable cells were stained with MTT and the results are means ± SEM of three independent experiments. The percentages of cytotoxicity of nontreated cells or cells treated with anti-TNF antibody alone were 12 ± 1.74 and 11 ± 1.14, respectively



View larger version (51K):
[in this window]
[in a new window]
 
FIG. 5. Time course of PCD in luteal endothelial cells. Cells were grown on glass slides and incubated with 100 ng/ml rhTNF{alpha} for 6, 12, and 24 h. Nontreated cells were incubated in medium only for 24 h. Apoptosis was then determined by DAPI staining (see representative photographs), apoptotic cells (marked by arrows) appear with condensed and fragmented nuclei morphology. The slides were scored for apoptotic cells (200 cells in 5 fields) and results are mean ± SEM of four independent experiments. Lowercase letters indicate statistically significant (P < 0.05) differences between incubation times within the TNF{alpha}-treated group

As TNFRI expressing progesterone-producing cells appeared to be protected from TNF{alpha}-induced PCD, we investigated the effect of physiological concentrations of progesterone on LECs (Fig. 6). Progesterone itself did not affect the viability of endothelial cells. Addition of progesterone to rhTNF{alpha}-treated cells showed that this steroid prevented LECs from undergoing apoptosis (Fig. 6). The protective effect of progesterone was dependent on the rhTNF{alpha} doses tested (12.5–100 ng/ml), and a significant interaction of rhTNF{alpha} dose by progesterone dose was detected (P < 0.003). At 100 ng of rhTNF{alpha}/ml, 10-11 to 10-7 M of progesterone significantly reduced cytotoxicity by 40% to 55% (P<0.05), while at 50 ng of rhTNF{alpha}/ml, 10-7 and 10-9 M of progesterone abolished PCD (P<0.05) and 10-11 M reduced cytotoxicity by 40% (P <0.05) compared with cells that had been treated with rhTNF{alpha} alone. At lower rhTNF{alpha} concentrations, cytotoxicity was abolished by all doses of progesterone tested (P <0.05).



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 6. Effect of progesterone on TNF{alpha}-treated luteal endothelial cells. LECs were treated with rhTNF{alpha} with or without increasing doses of progesterone and percent cytotoxicity was determined. Results are means of three independent experiments ± SEM. Uppercase letters indicate statistical significant (P < 0.05) differences between TNF{alpha} doses, whereas italic lowercase letters indicate statistical significant (P < 0.05) differences between progesterone doses within each TNF{alpha} dose

As progesterone protected cultured endothelial cells from undergoing apoptosis, we investigated whether LECs expressed the progesterone receptor (PR) mRNA. To do so we used PR-specific primers described by Rueda et al. [36]. As shown in Figure 7, PR mRNA was expressed in CL tissue as well as in LECs.



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 7. Presence of progesterone receptor m-RNA in mid-cycle CL and luteal endothelial cells. Total RNA was extracted from mid-cycle CL (CL) and LECs, reverse-transcribed, and amplified using the following PR primers: sense: CCGTAAAGCCAGAGAACCACTT, anti-sense: TTATGATGACTCCTTCATCCGC [36].

DISCUSSION

The results described in this study show that 1) TNFRI mRNA was present in the major cell types (endothelial and steroidogenic) present in the bovine CL, 2) TNFRI expression increased during natural or PGF2{alpha}-induced luteal regression, 3) TNFRI-expressing endothelial cells underwent PCD in response to TNF{alpha}, and 4) progesterone protected PR-expressing endothelial cells from TNF{alpha} mediated PCD.

The CL is a transient gland that is composed of parenchymal steroidogenic cells (large and small, about 40% of the total cells in the gland) and stromal cells consisting mainly of endothelial cells, a major cell population within the CL (>50%) [37]. Many studies have indicated capillary regression and endothelial cell death as a hallmark of PGF2{alpha}-induced luteal regression; these include studies in the cow [2], pig [5], guinea pig [38], sheep [39], and human CL [40]. Steroidogenic luteal cells were found to undergo apoptosis at a later stage, when a massive degeneration of capillaries had already occurred [2, 5]. Our findings demonstrating that endothelial cells express high levels of TNFRI and that they are sensitive to TNF{alpha}-induced PCD in vitro, together with those demonstrating high levels of TNF{alpha} in regressing CL [1820], contribute to the understanding of the molecular mechanisms controlling apoptosis in the regressing CL.

TNF{alpha} plays a role in a variety of immunological and physiological functions [41], and many of the biological effects of soluble TNF{alpha} are mediated via TNFRI [42], including the initiation of PCD [43]. TNF{alpha} receptors are widely distributed in different tissues. Many cells express both TNF receptor types, but TNFRI is more commonly expressed, and especially so in cells of nonhematopoietic lineages (reviewed by Krakauer et al. [41]). Specific TNF{alpha} binding sites were previously demonstrated in porcine CL by the use of labeled cytokine [22] and, more recently, Sakumoto et al. [23] identified TNFRI in mRNA from bovine CL. Our data support and extend these findings in that all three major luteal cell populations (steroidogenic and endothelial cells) were found to contain mRNA for TNFRI, with endothelial cells expressing the highest levels of the receptor. The overall increase of TNFRI mRNA in the regressed CL, as observed in this study, could have resulted from a relative increase within each luteal cell type. Our data would imply that such an increase in endothelial cells may be physiologically relevant, as the other cell types did not undergo PCD in response to TNF{alpha}. Nevertheless, this implication requires further research.

In contrast to our results, a recent study did not find an increase in TNFRI toward the end of the bovine cycle [23]. The cause for this discrepancy is presently unresolved, particularly because the increase we show herein was not only observed in late cycle (natural luteolysis), but also in PGF2{alpha}-induced luteolysis.

Our data showing that progesterone protected CL-derived endothelial cells from TNF{alpha}-induced apoptosis, that these cells express the PR, and that progesterone-producing cells were resistant to apoptosis, all suggest that progesterone may serve as a regulator of luteal cell survival. This proposition is supported by the recent report of Rueda et al. [36] who demonstrated that inhibition of P450scc activity reduced progesterone synthesis and increased oligo-nucleosomal DNA fragmentation. The expression of the PR by endothelial cells as described herein supports the notion that progesterone may directly affect endothelial cell function as was previously indicated by studies demonstrating progesterone-dependent suppression of endothelin-1 (ET-1) production [44] and modulation of cell proliferation [45].

If progesterone blocks luteal cell death, it can explain why apoptosis during luteal regression always proceed the decline of progesterone secretion. This is analogous to the physiological sequence of events occurring in uterine epithelial cells where the fall in progesterone is followed by PCD of these cells [46]. Pecci et al. [47] demonstrated that removal of progesterone, or the addition of antiprogestins both increased the percentage of apoptotic cells in rat endometrial cell lines. The direct antiapoptotic effect of progesterone in these cells was achieved by increasing the amount of the apoptosis-inhibiting form of Bcl-X (Bcl-X long) relative to that of the apoptosis promoting form (Bcl-X short). In contrast to the endometrium, Bcl-X short was not detected in bovine luteal tissue (during pregnancy or regression), and the occurrence of apoptosis in the CL was associated with an increase in BAX, which is another proapoptotic member of the Bcl family [48]. Whether or not progesterone regulates the expression Bcl family members in various CL cell types remains to be determined.

We have previously shown that endothelial cell-derived ET-1 has a vital role in functional luteolysis; namely, in its initial step involving a decline in steroidogenic activity [49]. The findings reported herein and in our previous study [49] suggest that ET-1 may also regulate PCD during structural luteolysis as outlined in Figure 8. ET-1 may act by initially decreasing progesterone production and then by stimulating TNF{alpha} secretion from macrophages [49], thereby promoting the apoptotic cascade in CL cells. Moreover, elevated TNF{alpha} may induce a further increase in ET-1, as demonstrated by Woods et al. [50], thus suggesting that ET-1 and TNF{alpha} may act in a paracrine, positive feedback loop at the time of luteolysis.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 8. Effects of interaction between progesterone and TNF{alpha} on endothelial cell survival. A) During early-mid luteal phases: high levels of progesterone together with low levels of TNF{alpha} and TNFRI prevent PCD. B) During luteolysis: in response to PGF2{alpha}, endothelial cells secrete ET-1 and resident macrophages produce TNF{alpha}. ET-1 and TNF{alpha} up-regulate their production rates in a positive feedback loop and synergize to inhibit steroid production. Low progesterone levels and increased TNFRI expression allow TNF{alpha}-induced apoptosis to proceed

ACKNOWLEDGMENTS

The authors are grateful to Dr. John S. Davis of the University of Kansas, Wichita, for cDNA prepared from enriched bovine luteal cell types, and to Dr. Katharina Spanel-Borowski of the University of Leipzig, Germany, for bovine luteal microvascular endothelial cells.

FOOTNOTES

First decision: 17 November 1999.

1 Correspondence: Rina Meidan, Department of Animal Sciences, POB 12, Rehovot, 76100, Israel. FAX: 972 8 9465763; rina{at}agri.huji.ac.il Back

2 Both authors made equal contribution to this study. Back

Accepted: August 3, 2000.

Received: October 18, 1999.

REFERENCES

  1. Schallenberger E, Schams D, Bullermann B, Walters D. Pulsatile secretion of gonadotrophins ovarian steroids and ovarian oxytocin during prostaglandin-induced regression of the corpus luteum in the cow. J Reprod Fertil 1984; 71:493–501.[Abstract]
  2. Juengel JL, Garverick HA, Johnson AL, Youngquist RS, Smith MF. Apoptosis during luteal regression in cattle. Endocrinology 1993; 132:249–254.[Abstract]
  3. Pate JL. Cellular components involved in luteolysis. J Anim Sci 1994; 72:1884–1890.[Abstract]
  4. Shikone T, Yamoto M, Kokawa K, Yamashita K, Nishimori K, Nakano R. Apoptosis of human corpora lutea during cyclic luteal regression and early pregnancy. J Clin Endocrinol Metab 1996; 81:2376–2380.[Abstract]
  5. Bacci ML, Barazzoni AM, Forni M, Costerbosa GL. In situ detection of apoptosis in regressing corpus luteum of pregnant sow: evidence of an early presence of DNA fragmentation. Domest Anim Endocrinol 1996; 13:361–372.[CrossRef][Medline]
  6. Jo T, Tomiyama T, Ohashi K, Saji F, Tanizawa O, Ozaki M, Yamamoto R, Yamamoto T, Nishizawa Y, Terada N. Apoptosis of cultured mouse luteal cells induced by tumor necrosis factor-{alpha} and interferon-{gamma}. Anat Rec 1995; 241:70–76.[CrossRef][Medline]
  7. McCormack JT, Frienderichs MG, Limback SD, Greenwald GS. Apoptosis during spontaneous luteolysis in the cyclic golden hamsters: biochemical and morphological evidence. Biol Reprod 1998; 58:255–260.[Abstract/Free Full Text]
  8. Brannstrom M, Frieden B. Immune regulation of corpus luteum function. Semin Reprod Endocrinol 1997; 15:363–370.[Medline]
  9. Terranova PF, Rice VM. Review: cytokine involvement in ovarian processes. Am J Reprod Immunol 1997; 37:50–63.
  10. Hahnke KH, Christenson LK, Ford SP, Taylor M. Macrophage infiltration into the porcine corpus luteum during prostaglandin F2{alpha} induced luteolysis. Biol Reprod 1994; 50:10–15.[Abstract]
  11. Penny LA, Armstrong DG, Baxter G, Hogg C, Kindahl H, Barmley T, Watson ED, Webb R. Expression of monocyte chemoattractant protein-1 in the bovine corpus luteum around the time of natural luteolysis. Biol Reprod 1998; 59:1464–1469.[Abstract/Free Full Text]
  12. Tsai SJ, Juengel JL, Wiltbank MC. Hormonal regulation of monocyte chemoattractant protein-1 messenger ribonucleic acid expression in corpora lutea. Endocrinology 1997; 138:4517–4520.[Abstract/Free Full Text]
  13. Bemelmans MH, van-Tits LJ, Buurman WA. Tumor necrosis factor: function release and clearance. Crit Rev Immunol 1996; 16:1–11.[Medline]
  14. Wuttke W, Pitzel L, Knoke I, Theiling K, Jarry H. Immune-endocrine interactions affecting luteal function in pigs. J Reprod Fertil Suppl 1997; 52:19–29.[Medline]
  15. Zhao Y, Burbach JA, Roby KF, Terranova PF, Brannian JD. Macrophages as the major source of tumor necrosis factor {alpha} in the porcine corpus luteum. Biol Reprod 1998; 59:1385–1391.[Abstract/Free Full Text]
  16. Benyo DF, Pate JL. Tumor necrosis factor {alpha} alters bovine luteal cell synthetic capacity and viability. Endocrinology 1992; 130:854–860.[Abstract]
  17. Pitzel L, Jarry H, Wuttke W. Effect and interactions of prostaglandin F2{alpha}, oxytocin, and cytokines on steriogenesis of porcine luteal cells. Endocrinology 1993; 132:751–756.[Abstract]
  18. Shaw D, Britt J. Concentrations of tumor necrosis factor-{alpha} and progesterone within the bovine corpus luteum sampled by continuous-flow microdialysis during luteolysis in vivo. Biol Reprod 1995; 53:847–854.[Abstract]
  19. Ji I, Slaughter RG, Ellis JA, Ji TH, Murdoch WJ. Analyses of ovine corpora lutea for tumor necrosis factor mRNA and bioactivity during prostaglandin induces luteolysis. Mol Cell Endocrinol 1991; 81:77–80.[CrossRef][Medline]
  20. Bagavandoss P, Kunkel SL, Wiggins RC, Keyes PL. Tumour necrosis factor {alpha} production and localisation of macrophages and lymphocytes in the rabbit corpus luteum. Endocrinology 1988; 122:1185–1187.[Abstract]
  21. Petroff MG, Petroff BK, Pate JL. Expression of cytokine messenger ribonucleic acids in the bovine corpus luteum. Endocrinology 1999; 140:1018–1021.[Abstract/Free Full Text]
  22. Richards RG, Almond GW. Identification and distribution of tumor necrosis factor {alpha} receptors in pig corpora lutea. Biol Reprod 1994; 51:1285–1291.[Abstract]
  23. Sakumoto R, Berisha B, Kawate N, Schams D, Okuda K. Tumor necrosis factor-{alpha} and its receptor in bovine corpus luteum throughout the estrous cycle. Biol Reprod 2000; 62:192–199.[Abstract/Free Full Text]
  24. Mamluk R, Levy N, Rueda B, Davis J, Meidan R. Characterization and regulation of type A endothelin receptor gene expression in bovine luteal cell types. Endocrinology 1999; 140:2110–2116.[Abstract/Free Full Text]
  25. Fields MJ, Fields PA. Morphological characteristics of the bovine corpus luteum during the estrous cycle and pregnancy. Theriogenology 1996; 45:1295–1325.
  26. Chomoczynsky P, Sacchi N. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chlorophorm extraction. Anal Biochem 1987; 162:156–159.[Medline]
  27. Mamluk R, Chen D, Greber Y, Davis J, Meidan R. Characterization of prostaglandin F2{alpha} and LH receptors mRNA expression in different bovine luteal cell types. Biol Reprod 1998; 58:849–856.[Abstract/Free Full Text]
  28. Meidan R, Girsh E, Blum O, Aberdam E. In vitro differentiation of bovine theca and granulosa cells into small and large luteal-like cells: morphological and functional characteristics. Biol Reprod 1990; 43:913–921.[Abstract]
  29. Meidan R, Aberdam E, Aflalo L. Steroidogenic enzyme content and progesterone induction by cAMP-generating agents and prostaglandin F2{alpha} in bovine theca and granulosa cells luteinized in vitro. Biol Reprod 1992; 46:786–792[Abstract]
  30. Spanel-Borowski K, Van-der-Bosch J. Different phenotypes of cultured microvessel endothelial cells obtained from bovine corpus luteum, study by light microscopy and by electron microscopy (SEM). Cell Tissue Res 1990; 261:35–47.[CrossRef][Medline]
  31. Tsai SJ, Wiltbank MC, Bodensteiner KJ. Distinct mechanisms regulate induction of messenger ribonucleic acid for prostaglandin (PG) G/H synthase, PGE(EP3) receptor, and PGF2{alpha} receptor in bovine preovulatory follicles. Endocrinology 1996; 137:3348–3355.[Abstract]
  32. Smith GW, Gentry PC, Roberts RM, Smith MF. Ontogeny and regulation of luteinizing hormone receptor messenger ribonucleic acid within the ovine corpus luteum. Biol Reprod 1996; 54:76–83.[Abstract]
  33. Wong H, Anderson WD, Cheng T, Riabowol KT. Monitoring mRNA expression by polymerase chain reaction: the "primer-dropping" method. Anal Biochem 1994; 223:251–258.[CrossRef][Medline]
  34. Acosta TJ, Miyamoto A, Ozawa T, Wijayagunawardane PB, Sato K. Local release of steroid hormones, prostaglandin E2, and endothelian-1 from bovine mature follicles in vitro: effects of luteinizing hormone endothelin-1 and cytokines. Biol Reprod 1998; 59:437–443.[Abstract/Free Full Text]
  35. Mosman T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 1983; 65:55–63.[CrossRef][Medline]
  36. Rudea BR, Hendry IR, Hendry WJ, Stormshak F, Slayden OD, Davis JS. Decreased progesterone levels and progesterone receptor antagonists promote apoptotic cell death in bovine luteal cells. Biol Reprod 2000; 62:269–276.[Abstract/Free Full Text]
  37. O'Shea J, Rogers R, D'Occhio M. Cellular composition of cyclic corpus luteum of the cow. J Reprod Fertil 1989; 85:483–487.[Abstract]
  38. Azmi TI, O'Shea JD. Mechanism of deletion of endothelial cells during regression of the corpus luteum. Lab Invest 1984; 51:206–216.[Medline]
  39. Rueda BR, Wegner JA, Marion SL, Wahlen DD, Hoyer PB. Internucleosomal DNA fragmentation in ovine luteal tissue associated with luteolysis: in vivo and in vitro analyses. Biol Reprod 1995; 52:305–312.[Abstract]
  40. Gaytan F, Morales C, Garcia-Pardo L, Reymundo C, Bellido C, Sanchez-Criado JE. A quantitative study of changes in the human corpus luteum microvasculature during the menstrual cycle. Biol Reprod 1999; 60:914–919.[Abstract/Free Full Text]
  41. Krakauer T, Vilcek J, Oppenhiem JJ. Proinflammatory cytokines: TNF and IL-1 families, chemokines, TGF-ß and others. In: Paul WE (ed.), Fundamental Immunology, 4th ed. Philadelphia: Lippincott-Raven; 1999: 775–811.
  42. Grell M, Walant H, Zimmermann G, Scheurich P. The type 1 receptor (CD120a) is a high affinity receptor for soluble tumor necrosis factor. Proc Natl Acad Sci U S A 1998; 95:570–575.[Abstract/Free Full Text]
  43. Tartaglia LA, Ayres TM, Wong GH, Goeddel DV. A novel domain within the 55 Kd TNF receptor signals cell death. Cell 1993; 74:845–853.[CrossRef][Medline]
  44. Morey AK, Razandi M, Pedram A, Hu RM, Prins BA, Levin ER. Oestrogen and progesterone inhibit the stimulated production of endothelin-1. Biochem J 1998; 330:1097–1105.
  45. Vazquez F, Rodriguez-Manzaneque JC, Lydon JP, Edwards DP, O'Malley BW, Arispe LI. Progesterone regulates proliferation of endothelial cells. J Biol Chem 1999; 274:2185–2192.[Abstract/Free Full Text]
  46. Rotello RJ, Lieberman RC, Lepoff RB, Gerschenson LE. Characterization of uterine epithelium apoptotic cell death kinetics and regulation by progesterone and RU 486. Am J Pathol 1992; 140:449–456.[Abstract]
  47. Pecci A, Scholz A, Pelster D, Beato M. Progestins prevent apoptosis in a rat endometrial cell line and increase the ratio of bcl-XL to bcl-XS. J Biol Chem 1997; 272:11791–11798.[Abstract/Free Full Text]
  48. Rueda BR, Tilly KI, Botros IW, Jolly PD, Hansen TR, Hoyer PB, Tilly JL. Increased bax and interleukin-1beta-converting enzyme messenger ribonucleic acid levels coincide with apoptosis in the bovine corpus luteum during structural regression. Biol Reprod 1997; 56:186–193.[Abstract]
  49. Meidan R, Milvae RA, Weiss S, Levy N, Friedman A. Intraovarian regulation of luteolysis. J Reprod Fertil Suppl 1999; 54:217–228.[Medline]
  50. Woods M, Mitchell J, Wood E, Barker S, Walcot N, Rees G, Warner T. Endothelin-1 is induced by cytokines in human vascular smooth muscle cells: evidence for intracellular endothelin-converting enzyme. Mol Pharmacol 1999; 55:902–909.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
L. E. Henkes, B. T. Sullivan, M. P. Lynch, R. Kolesnick, D. Arsenault, M. Puder, J. S. Davis, and B. R. Rueda
Acid sphingomyelinase involvement in tumor necrosis factor {alpha}-regulated vascular and steroid disruption during luteolysis in vivo
PNAS, June 3, 2008; 105(22): 7670 - 7675.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. C. Peluffo, R. L. Stouffer, and M. Tesone
Activity and expression of different members of the caspase family in the rat corpus luteum during pregnancy and postpartum
Am J Physiol Endocrinol Metab, November 1, 2007; 293(5): E1215 - E1223.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
D. J. Skarzynski, I. Woclawek-Potocka, A. Korzekwa, M. M. Bah, K. Piotrowska, B. Barszczewska, and K. Okuda
Infusion of Exogenous Tumor Necrosis Factor Dose Dependently Alters the Length of the Luteal Phase in Cattle: Differential Responses to Treatment with Indomethacin and L-NAME, a Nitric Oxide Synthase Inhibitor
Biol Reprod, April 1, 2007; 76(4): 619 - 627.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
M. C Peluffo, L. Bussmann, R. L Stouffer, and M. Tesone
Expression of caspase-2, -3, -8 and -9 proteins and enzyme activity in the corpus luteum of the rat at different stages during the natural estrous cycle.
Reproduction, September 1, 2006; 132(3): 465 - 475.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Kisliouk, H. Podlovni, K. Spanel-Borowski, O. Ovadia, Q.-Y. Zhou, and R. Meidan
Prokineticins (Endocrine Gland-Derived Vascular Endothelial Growth Factor and BV8) in the Bovine Ovary: Expression and Role as Mitogens and Survival Factors for Corpus Luteum-Derived Endothelial Cells
Endocrinology, September 1, 2005; 146(9): 3950 - 3958.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
L. T. Budnik and B. Brunswig-Spickenheier
Differential effects of lysolipids on steroid synthesis in cells expressing endogenous LPA2 receptor
J. Lipid Res., May 1, 2005; 46(5): 930 - 941.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
K. Okuda, A. Korzekwa, M. Shibaya, S. Murakami, R. Nishimura, M. Tsubouchi, I. Woclawek-Potocka, and D. J. Skarzynski
Progesterone Is a Suppressor of Apoptosis in Bovine Luteal Cells
Biol Reprod, December 1, 2004; 71(6): 2065 - 2071.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R. Nishimura, A. Bowolaksono, T. J. Acosta, S. Murakami, K. Piotrowska, D. J. Skarzynski, and K. Okuda
Possible Role of Interleukin-1 in the Regulation of Bovine Corpus Luteum Throughout the Luteal Phase
Biol Reprod, November 1, 2004; 71(5): 1688 - 1693.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
R. Wu, K. H. Van der Hoek, N. K. Ryan, R. J. Norman, and R. L. Robker
Macrophage contributions to ovarian function
Hum. Reprod. Update, March 1, 2004; 10(2): 119 - 133.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
T.P. Neuvians, D. Schams, B. Berisha, and M.W. Pfaffl
Involvement of Pro-Inflammatory Cytokines, Mediators of Inflammation, and Basic Fibroblast Growth Factor in Prostaglandin F2{alpha}-Induced Luteolysis in Bovine Corpus Luteum
Biol Reprod, February 1, 2004; 70(2): 473 - 480.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
D. J. Skarzynski, M. M. Bah, K. M. Deptula, I. Woclawek-Potocka, A. Korzekwa, M. Shibaya, W. Pilawski, and K. Okuda
Roles of Tumor Necrosis Factor-{alpha} of the Estrous Cycle in Cattle: An In Vivo Study
Biol Reprod, December 1, 2003; 69(6): 1907 - 1913.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
J. J. Jaroszewski, D. J. Skarzynski, and W. Hansel
Nitric Oxide as a Local Mediator of Prostaglandin F2{alpha}-Induced Regression in Bovine Corpus Luteum: An In Vivo Study
Experimental Biology and Medicine, October 1, 2003; 228(9): 1057 - 1062.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
L. T. Budnik, B. Brunswig-Spickenheier, and A. K. Mukhopadhyay
Lysophosphatidic Acid Signals through Mitogen-Activated Protein Kinase-Extracellular Signal Regulated Kinase in Ovarian Theca Cells Expressing the LPA1/edg2-Receptor: Involvement of a Nonclassical Pathway?
Mol. Endocrinol., August 1, 2003; 17(8): 1593 - 1606.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. J. Cannon, M. G. Petroff, and J. L. Pate
Effects of Prostaglandin F2{alpha} and Progesterone on the Ability of Bovine Luteal Cells to Stimulate T Lymphocyte Proliferation
Biol Reprod, August 1, 2003; 69(2): 695 - 700.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
D. J. Skarzynski, J. J. Jaroszewski, M. M. Bah, K. M. Deptula, B. Barszczewska, B. Gawronska, and W. Hansel
Administration of a Nitric Oxide Synthase Inhibitor Counteracts Prostaglandin F2-Induced Luteolysis in Cattle
Biol Reprod, May 1, 2003; 68(5): 1674 - 1681.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Abdo, S. Hisheh, and A. Dharmarajan
Role of Tumor Necrosis Factor-Alpha and the Modulating Effect of the Caspases in Rat Corpus Luteum Apoptosis
Biol Reprod, April 1, 2003; 68(4): 1241 - 1248.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. K. Pru, I. R. Hendry, J. S. Davis, and B. R. Rueda
Soluble Fas Ligand Activates the Sphingomyelin Pathway and Induces Apoptosis in Luteal Steroidogenic Cells Independently of Stress-Activated p38MAPK
Endocrinology, November 1, 2002; 143(11): 4350 - 4357.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. C. Chen, J.-H. Lin, L.-S. Wu, Y.-F. Tsai, T. H. Su, C. J. Chen, and T. J. Chen
Luteotropic Roles of Prolactin in Early Pregnant Hamsters
Biol Reprod, July 1, 2002; 67(1): 8 - 13.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. F. Carambula, T. Matikainen, M. P. Lynch, R. A. Flavell, P. B. Dias Goncalves, J. L. Tilly, and B. R. Rueda
Caspase-3 Is a Pivotal Mediator of Apoptosis during Regression of the Ovarian Corpus Luteum
Endocrinology, April 1, 2002; 143(4): 1495 - 1501.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
H. Taniguchi, Y. Yokomizo, and K. Okuda
Fas-Fas Ligand System Mediates Luteal Cell Death in Bovine Corpus Luteum
Biol Reprod, March 1, 2002; 66(3): 754 - 759.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
F. Gaytan, C. Morales, C. Bellido, and J. E. Sanchez-Criado
Selective Apoptosis of Luteal Endothelial Cells in Dexamethasone-Treated Rats Leads to Ischemic Necrosis of Luteal Tissue
Biol Reprod, January 1, 2002; 66(1): 232 - 240.
[Abstract] [Full Text]


This Article