Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Griswold, M. D.
Right arrow Articles by Kim, J.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Griswold, M. D.
Right arrow Articles by Kim, J.-S.
Agricola
Right arrow Articles by Griswold, M. D.
Right arrow Articles by Kim, J.-S.
Biology of Reproduction 64, 602-610 (2001)
© 2001 Society for the Study of Reproduction, Inc.

Regular Article

Site-Specific Methylation of the Promoter Alters Deoxyribonucleic Acid-Protein Interactions and Prevents Follicle-Stimulating Hormone Receptor Gene Transcription1

Michael D. Griswold2,a, and Jeong-Seon Kima

a School of Molecular Biosciences, Center for Reproductive Biology, Washington State University, Pullman, Washington 99164-4660

ABSTRACT

In the male gonad, the FSH receptor (FSHR) gene is expressed only in Sertoli cells. To date, the mechanism(s) responsible for Sertoli cell-specific expression of the FSHR gene are unknown. In this study, DNA methylation at specific sites in the promoter are shown to lead to changes in the DNA-protein interactions at those sites and, subsequently, to transcriptional repression of the gene. The extent of methylation of cytosine residues within the core promoter region of genomic DNA isolated from cells/tissues that expressed, or did not express, the FSHR gene was analyzed by the sodium bisulfite conversion technique. All seven cytosine residues in CpG dinucleotides within the core promoter region were found to be unmethylated in primary cultured rat Sertoli cells that were actively expressing FSHR mRNA. In contrast, in tissues not expressing FSHR the same region of the gene was methylated at each of the CpG dinucleotides examined. In addition, DNA-protein interactions in three primary regulatory regions of the promoter were examined by electrophoretic mobility shift assays (EMSA) with synthetic oligonucleotides containing selectively methylated cytosine residues. Methylation of a CpG sequence within a consensus E box element (CACGTG, -124/-119) decreased the binding affinity of USF1/2 transcription factors for this element. Methylation of the CpG sequence in the Inr region (CCGG, -85/-82) allowed the formation of an additional DNA-protein complex. Methylation at both cytosine residues in the E2F element (mCGmCG) generated a new methylcytosine-specific DNA-protein complex. The core FSHR promoter region of a mouse Sertoli cell line (MSC-1) that does not express FSHR was shown to be methylated at four CpG dinucleotides. The demethylation of these four sites by treatment of the MSC-1 cells with 5-aza-2'-deoxycytidine (5-azaCdR) activated the transcription of the FSHR gene. Taken together, these results suggest that cytosine methylation is a major factor in the repression of the expression of the FSHR gene.

FSH, gene regulation, hormone action, Sertoli cells

INTRODUCTION

The biosynthetic properties and characteristic structure of Sertoli cells define their fundamental role as nurse cells for spermatogenesis [1, 2]. Follicle-stimulating hormone stimulates the expression of genes in Sertoli cells that promote the initiation and maintenance of spermatogenesis [3, 4]. The FSH signal is mediated by the FSH receptor (FSHR) whose expression is highly restricted to Sertoli cells in the testis and granulosa cells in the ovary. Overall, in the male rodent, FSH appears to be essential for quantitatively normal reproductive function, although it is not required for fertility [5].

Cell-specific gene expression is generally considered to be regulated by the interaction of basal and cell-specific transcription factors with cis-acting promoter elements [6]. In the TATA-less rat FSHR promoter, three major regulatory regions have been identified. First, the initiation of transcription in the FSHR gene takes place within Inr elements (GCAGATC, -100/-94; ACAGTGT, -81/-75) that encompass two major transcriptional initiation sites at position -98 and -80 base pairs (bp) [7, 8]. Second, an E box sequence (CACGTG, -124/-119) within the FSHR promoter has been identified as an essential positive regulatory element that binds with the ubiquitous transcription factor USF1/2. Mutation of the E box element decreased reporter gene activity in transfected cells by more than 50% [8, 9]. Third, a consensus E2F (TTTCGCG, -45/-39) element of the FSHR promoter was reported as a possible regulatory element for transcription activity of the FSHR gene [9]. These previous studies failed to identify a cis-acting element that could account for the cell specificity of the rat FSHR gene expression, and the proximal promoter was shown to be active in initiating transcription of reporter genes when transfected into a variety of cells in vitro [7–10].

Some mammalian genes exhibit an inverse correlation between the extent of DNA methylation and gene activity [11–14]. Methylation of DNA is a heritable biological signal and occurs primarily at the fifth position of a cytosine residue within CpG dinucleotide motifs on both strands of DNA [15, 16]. Previously, using methylation-sensitive restriction endonucleases, a cytosine base at nucleotide -84 was shown to be methylated in the promoter of a mouse Sertoli cell line (MSC-1). Expression of the FSHR gene in this cell line is silenced [10]. The core rat FSHR promoter has seven potential methylation sites, including position -84, but the methylation pattern of the entire core promoter has not been examined.

In this study, the extent of and consequence of methylation of all cytosine residues in the FSHR core promoter was determined. A sodium bisulfite conversion technique was used to analyze the in vivo methylation pattern of the core promoter region in tissues where FSHR expression was silenced and in Sertoli cells that were actively transcribing the FSHR gene. The targeted methylation of cis-acting elements in the FSHR promoter region altered the interactions of the promoter with nuclear proteins from the Sertoli cells. In addition, the extent of demethylation of the promoter region in MSC-1 cells was shown to correlate directly with the level of endogenous FSHR gene transcripts. The results show that DNA methylation correlates directly with the cell-specific silencing of the FSHR gene.

MATERIALS AND METHODS

Cell Cultures of Primary Sertoli Cells and MSC-1 Cell Line

Primary Sertoli cells were cultured from 20-day-old Sprague-Dawley male rats as previously described [17]. Cells were plated in 150-mm culture dishes with Hams F-12 medium (Gibco BRL Life Technologies, Inc., Grand Island, NY) and maintained at 32°C in a humidified 5% CO2 and 95% air atmosphere. The media was changed on the third day of culture. Prior to extraction of nuclear proteins, cells were treated with 10% bovine calf serum with F-12 medium for 24 h. Cells were harvested on the fifth day for genomic DNA isolation and nuclear protein extraction. The mouse Sertoli cell line, MSC-1, was grown in Dulbeccos modified Eagles medium (DMEM) supplemented with 10% bovine calf serum at 37°C in the 5% CO2 and 95% air conditions.

Sodium Bisulfite Conversion of Genomic DNA

The genomic sequencing was based upon the bisulfite modification and subsequent polymerase chain reaction (PCR) amplification of single-stranded DNA originally described by Frommer [18]. Genomic DNA was isolated from cultured rat Sertoli cells, tissues from 20-day-old rats (brain, kidney, liver, and spleen), as well as MSC-1 cells [19]. The genomic DNA was digested with the restriction enzyme BamHI, and then 2 µg of DNA was denatured with 0.3 N NaOH in a volume of 25 µl for 20 min at 37°C. The denatured DNA was treated with sodium bisulfite by addition of 250 µl of a freshly prepared solution of 4.0 M sodium bisulfite (NaHSO3) and 10 mM hydroquinone at pH 5.0. The reaction was overlayered with mineral oil and incubated at 55°C for 8–12 h. The bisulfite-treated DNA was recovered using the DNA Clean-Up System (Promega, Madison, WI), according to the manufacturer's instructions. The DNA was desulfonated by treatment with 0.3 N NaOH for 20 min at 37°C, and the reaction was neutralized by treatment with 3 M ammonium acetate (CH3COONH4, pH 7.0). Finally, the DNA was precipitated with ethanol and resuspended in 100 µl of TE buffer (10 mM Tris-HCl, 0.5 mM EDTA, pH 7.5). The bisulfite-converted DNA (50 ng) was used for PCR amplification.

Polymerase Chain Reaction Amplification of the Promoter Region

The sense strand of the region of interest of the FSHR promoter was amplified from bisulfite-treated DNA by PCR using strand-specific external primers. This reaction product (5 µl) was used directly in a second PCR reaction with internal primers. These two external (primer set A) and internal (primer set B) primer sets were designed with regard to CpG sites because cytosine residues in any given site would be modified after bisulfite conversion reaction (indicated in underlines). Thus, the primer pairs can recognize the bisulfite-modified sense strand and cannot anneal to the nonmodified DNA strand. The following PCR primers were used for bisulfite genomic DNA sequencing of the -278- to +46-bp region of the rat FSHR core promoter: primer set A, PA1: 5'-GGAGAAGATAGTAGTGATTAGTAGGGAT-3' (-278/-250), PA2: 5'-ATACTCAAATAAAAACCACACAACTAL-3' (+171/+196); primer set B, PB1: 5'-TGGGGGTTAAGGAATAAAAAATATAGGTT-3' (-278/-250), PB2: 5'-ATCCCATACCCAAAAATACCAACAAA-3' (+21/+46).

The first round of PCR was performed in a volume of 50 µl containing 50 ng bisulfite-treated DNA, 10 µM of primer set A designed to read the upper strand of the region, 200 µM dNTPs, 3 mM MgCl2, and 0.5 units of Taq DNA polymerase (Gibco BRL Life Technologies). Amplification was performed under the following conditions: one cycle of 94°C for 2 min; five cycles of 94°C for 1 min, 48°C for 2 min, 72°C for 2 min; 30 cycles of 94°C for 0.5 min, 48°C for 2 min, 72°C for 1.5 min; one cycle of 72°C for 6 min. The first PCR product (5 µl) was used in a second round PCR reaction that contained 10 µM of primer set B. The PCR reaction was performed under the same conditions as described above except an annealing temperature of 53°C was used. Following PCR amplification with the gene-specific primer, only 5-methylcytosine residues are amplified as cytosine, whereas all uracil residues, originally cytosine in the template, are amplified as thymine. To visualize the genomic DNA sequences, at least five separate bisulfite-reacted genomic DNA preparations were used for sequencing.

Electrophoretic Mobility Shift Assay

The ability of protein to form complexes with synthetic oligonucleotides was detected by electrophoretic mobility shift assay (EMSA), according to the method of Kerr [20]. Nuclear extracts were prepared from Sertoli cells and other tissues as follows [21]: Cultured cells were washed with PBS, collected with a scraper, and precipitated by centrifugation at 1500 x g for 5 min. The cells were resuspended in 400 µl of ice-cold hypotonic buffer (10 mM Hepes, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.2 mM PMSF, 0.5 mM dithiothreitol [DTT]), allowed to swell for 15 min, and precipitated by centrifugation at 1500 x g for 5 min. The cells were then resuspended in high salt buffer (20 mM Hepes, pH 7.9, 25% glycerol, 1.5 mM MgCl2, 420 mM NaCl, 0.2 mM EDTA, 0.2 mM PMSF, 0.5 mM DTT) and incubated on ice for 20 min. After centrifugation, the supernatant was frozen in aliquots at -70°C. The protein concentration in the nuclear extracts was determined using the micro-bicinchoninic acid protein assay (Pierce Chemical Co., Rockford, IL). The probes used in the EMSA were double-stranded synthetic oligonucleotides corresponding to positions of the FSHR promoter region. Several oligonucleotides, containing an E box, an Inr, or an E2F motif were synthesized using a DNA synthesizer (PE Biosystems, Foster City, CA). For synthesis of methylated oligonucleotides, 5-methylcytidine phosphoramidite replaced cytosine phosphoramidite at the CpG site of the sequences and annealed to double strands. The following oligonucleotide sequences were used as complementary strand probes: E box (21-mer, -133/-113), E box-WT: TTGGTGGGTCACGTGATCTTG, E box-Me: TTGGTGGGTCAMGTGATCTTG; Inr (28-mer, -105/-78), Inr-WT: TCCAAGCAGATCTCTCTTATCCGGACAG, Inr-Me: TCCAAGCAGATCTCTCTTATCMGGACAG, Inr-Mut: TCCAAGCAGATCTCTCTATCtaGGCAG; E2F (23-mer, -54/-32), E2F-WT: TGTGGAAGTTTTCGCGCTGATGC, E2F-MeA: TGTGGAAGTTTTMGCGCTGATGC, E2F-MeB: TGTGGAAGTTTTCGMGCTGATGC, E2F-MeC: TGTGGAAGTTTTMGMGCTGATGC. Italicized sequences represent a consensus cis-acting element. Among sequences, M indicates 5-methylcytosine. Mutated nucleotides other than methylation are shown as lowercase letters. The WT, Me, and Mut represent wild-type, methylated, and mutated probes, respectively. Both single-stranded oligonucleotides were end-labeled using 1 unit of T4 polynucleotide kinase and 12.5 pmole of [{gamma}-32P]ATP at 37°C for 30 min, and the labeled complementary strands were then annealed. The double-stranded oligonucleotides were purified using a 20% native polyacrylamide gel.

The 32P-labeled double-stranded oligonucleotides, either methylated or unmethylated, corresponding to a specific region of FSHR gene promoter were incubated with the nuclear extracts as described below. The binding reaction was performed by incubation of 2- to 4-µg nuclear extracts with approximately 4 pmole (50 000 cpm) of end-labeled DNA at 4°C for 30 min in the presence of 2 µg of poly(dI-dC)(dI-dC) or poly(dA-dT)(dA-dT) in a final volume of 15 µl, containing 12.5 mM Hepes, pH 7.9, 5% glycerol, 25 mM KCl, 10 mM MgCl2, and 0.5 mM DTT. The DNA-protein complex was separated from the unbound probe on a 5% native polyacrylamide gel (29:1 acrylamide:bis-acrylamide) in 0.5x TBE (22.5 mM Tris-borate, pH 8.2, 0.5 mM EDTA). Gels were dried and exposed to autoradiographic x-ray film. In competition experiments, molar excesses of unlabeled oligonucleotides were incubated with binding buffer prior to addition of the labeled probe.

Treatment of MSC-1 Cell Line with 5-azaCdR

The MSC-1 cells were cultured in 100-mm plates with DMEM and 10% bovine calf serum (BCS) to 60% confluence at a density of 1 x 106 cells per plate. The MSC-1 cells were treated with 0.5 µM, 1.0 µM, or 2 µM 5-aza-2'-deoxycytidine (5-azaCdR, Sigma) for 24 h [22]. The cultured medium was changed 24 h after treatment and at intervals of 3 days. The cells were allowed to grow in DMEM with 10% BCS for 9 days. On the ninth day following treatment, the cells were treated again with 5-azaCdR using the same conditions. After incubation for 24 h, the media were replaced and the cells incubated for another 3 days. Genomic DNA and total RNA were isolated from control cells and 12-day treated cells as described [19, 23].

Analysis of DNA Demethylation by 5-azaCdR in the MSC-1 Cells

Demethylation of DNA by 5-azaCdR was correlated with FSHR expression by analysis of the methylation pattern in the core promoter with bisulfite genomic sequencing as previously described [18]. After treatment of genomic DNA with sodium bisulfite, the sense strand of the region of FSHR promoter was amplified using mouse sequence-specific primers. Both external (set A) and internal (set B) primer sets for genomic sequencing of the mouse FSHR core promoter were used. The following PCR primers were used for bisulfite sequencing of the -273- to +46-bp region of the core promoter of mouse FSHR gene: primer set A, mPA1: 5'-ATTTTGATATTATTGAGAAGAGAGTAGTG-3' (-425/-397), mPA2: 5'-ATACTCAAATAAAAAACACAAAACTA-3' (-171/-204); primer set B, mPB1: 5'-ATAGGTTTTGAAGGATAAGATAGGTGTTT-3' (-273/-245), mPB2: 5'-ATCCCAAACCCAAAAATACCAACAAA-3' (+21/+46).

The first PCR reaction was performed under following conditions: one cycle of 94°C for 2 min; five cycles of 94°C for 1 min, 57°C for 2 min, 72°C for 2 min; 30 cycles of 94°C for 0.5 min, 58°C for 2 min, 72°C for 1.5 min; one cycle of 72°C for 6 min. The second PCR reaction was performed under the same conditions as described above except at an annealing temperature of 58°C. The final amplified PCR product was 330-bp of the mouse FSHR core promoter.

Isolation of RNA and Reverse Transcription-PCR

Total RNA was isolated from 5-azaCdR-treated MSC-1 cells and nontreated total testis as described by Kingston [23]. After the 12-day treatment with 5-azaCdR, cells were lysed with 3.5 ml of 4 M guanidinium solution containing 350 µl of ß-mercaptoethanol. The cell lysate was drawn through a syringe with a 20-gauge needle to shear genomic DNA. The lysate was then layered on top of 1.5 ml of 5.7 M CsCl in 5-ml ultracentrifuge tubes. After centrifugation at 35 000 rpm for 16 h, the supernatant was decanted, and the RNA pellet was washed twice in 70% ethanol prepared with diethyl pyrocarbonate-treated water. Total RNA from the whole testes of normal adult mice was isolated for positive control of the reverse transcription (RT)-PCR reaction. The total RNA of the testis was extracted with Trizol reagent as recommended by the supplier (Gibco BRL Life Technologies). For cDNA synthesis, RT reactions were performed using total RNA (3 µg), 5 pmole of sequence-specific primer nA2, 5 pmole of dNTPs, and 1 unit of reverse transcriptase Superscript II (Gibco BRL Life Technologies) in a 20-µl reaction. The reaction mixture was incubated 1 h at 42°C, and the reaction was terminated by incubation for 15 min at 75°C. Negative control RT reactions were performed under the same conditions without total RNA. The cDNA samples were then amplified with primers (nB1 and nB2) specific for the mouse FSHR promoter. The PCR was performed in a volume of 50 µl containing 2 µl of the cDNA from the RT reaction, 10 µM of primer set nB, 200 µM dNTPs, 2 mM MgCl2, and 0.5 unit of Taq DNA polymerase (Gibco BRL Life Technologies). Amplification was performed under following conditions: one cycle of 94°C for 3 min; five cycles of 94°C for 1 min, 48°C for 2 min, 72°C for 2 min, 25 cycles of 94°C for 0.5 min, 50°C for 2 min, 72°C for 1.5 min; one cycle of 72°C for 5 min. After PCR, the amplified cDNAs were electrophoresed on 0.8% agarose gel. The RT-PCR was also done with genomic DNA before treatment of the cells as a negative control and in the total mouse testis as a positive control. Primer nPA2 was used for the RT reaction, and primer sets nB used for PCR were designed to amplify 290 bp of the mouse FSHR promoter. Primer sequences are as follows: nPA2: 5'-GACGATACTCACAGTTCAATG-3' (+143/+163); primer set nB, nPB1: 5'-TTGAAGGATAAGACAGGTGCT-3' (-266/-246), nPB2: 5'-AAGAATGCCAGCAAGGAGA-3' (+16/+32).

RESULTS

Analysis of Methylation Sites Within the Core Promoter of the FSHR Gene in Cells and Tissues

The pattern of cytosine methylation within the core promoter of the FSHR promoter region was analyzed using the differences in bisulfite reactivity for cytosine and 5-methylcytosine residues. A comparison was made between genomic DNAs from Sertoli cells that express the FSHR gene and various tissues that do not express the FSHR gene. The 320-bp region analyzed by bisulfite genomic sequencing encompassed seven CpG dinucleotides in the rat FSHR promoter that are potential methylation sites (221 bp shown in Fig. 1), and four CpG dinucleotides in the mouse promoter (230 bp shown in Fig. 1). The CpG dinucleotides in the rat FSHR promoter were found at nucleotides -155, -122, -110, -84, -42, -40, and -20. Some of the methylated cytosine bases were located within major regulatory regions of the promoter such as the E box (CACGTG, nucleotide [nt] -122), the Inr region (-CCGG-, nt -84), as well as the consensus sequence for transcription factor E2F (TTTCGCG, nt -42 and -40) (Fig. 1) [7–10]. The analysis of the sequence showed that all cytosine residues that are potential methylation sites in the region of interest were fully converted to thymine in the FSHR promoter of rat Sertoli cells. Representative sequencing results for the three major regulatory regions are shown in Figure 2. Likewise, all cytosine residues that were adjacent to adenine, thymine, and cytosine residues in the original template were converted to thymine, indicating that the bisulfite conversion reaction was complete. These data showed that every CpG dinucleotide present in the core promoter region of the FSHR gene was unmethylated in the rat Sertoli cells (Figs. 2 and 3). On the contrary, in the promoter of brain tissue in which the gene was not expressed, cytosine residues in CpG dinucelotides were not converted to thymine (Fig. 2). We extended this analysis to a variety of different rat tissues such as kidney, liver, and spleen and found identical results in that all seven CpG dinucleotides were methylated in all genomic DNAs examined (results summarized in Fig. 3).



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 1. Nucleotide sequence alignment of the FSHR core promoter region. Numbers indicate base positions with respect to the translation initiation site. Arrows indicate major transcription initiation sites of the mouse and rat core FSHR promoter, -98, and -80, identified by primer extension analysis [7]. Lines indicate the potential CpG methylation sites. The consensus sequences for major regulatory elements, E box, E2F, and the Inr regions are indicated in bold type. The translation initiation site ATG is indicated with (+1)



View larger version (50K):
[in this window]
[in a new window]
  		FIG. 2. Representative results of sodium bisulfite genomic sequencing. Sequence analysis of a rat promoter in a region encompassing the core promoter region including E box, Inr, and E2F elements following sodium bisulfite treatment. In vivo methylation of CpG dinucleotides of the FSHR promoter was determined by using the bisulfite conversion reaction, following PCR amplification on genomic DNA from Sertoli cells and brain tissue. Results shown are representative of results from three experiments with each tissue



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 3. Summary of analysis of methylation sites within the core promoter of the FSHR gene in cells and tissues. The DNA methylation status from genomic DNA from primary Sertoli cells, various tissues, and MSC-1 cells. For an analysis of the rat FSHR promoter, the region between position -278 and +46, relative to the translation start site was selected. Triangles indicate the potential methylation site. Symbol (+) indicates the sites that 5-methylcytosine residues are present at CpG dinucleotides in all of at least three experiments. Symbol (/) indicates that cytosine residues are present at CpG dinucleotides in all of at least three experiments

The same analysis was done on DNA from the mouse MSC-1 cells (summarized in Fig. 3). MSC-1 is a well-characterized Sertoli cell line that does not express the FSHR mRNA [24, 25]. The methylation pattern of the DNA from the MSC-1 cells was consistent with that found in the nonexpressing rat tissues. Four CpG methylation sites are found at nucleotides -161, -121, -84, and -43 in the mouse FSHR promoter. Three of these sites are found in the major regulatory elements of the mouse promoter including the consensus E box (CACGTG, nt -121), the Inr region (-CCGG-, nt -84), and the E2F (TTTCGCT, nt -43).

Effects of Methylation on the Regulatory Region of the FSHR Promoter

The presence of the CpG dinucleotides in the regulatory regions of the FSHR core promoter suggested a possible interaction between cytosine methylation and the binding of transcription factors. The EMSAs with synthetic oligonucleotides that contained either unmethylated or methylated cytosine base(s) in the CpG sequence were used to investigate whether site-specific DNA methylation of the cis-acting regulatory region could directly affect the binding affinity of the transcription complexes.

It was shown in previous studies that a consensus E box element in the FSHR promoter is a functional binding site for the USF1/2 heterodimers, and high affinity binding to this site is required for activation of transcription [8, 9]. The EMSA binding reactions were done with selectively methylated or unmethylated oligonucleotides containing the E box sequence and nuclear extracts from cultured rat Sertoli cells. Major retarded bands, previously shown to consist largely of complexes of DNA and USF heterodimers were formed on the gel with the unmethylated E box probe (E box-WT, 21mer) that contained a consensus -CACGTG- sequence (Fig. 4, lane 1). The EMSA results with the methylated probe E box-Me, where the CpG dinucleotide was replaced with 5-methyl CpG (-CAMGTG-), were qualitatively the same as with the unmethylated probe (E box-WT), but the bands were formed with a reduced affinity (lane 2). Furthermore, the level of binding of the protein to the methylated E box element was compared by EMSA where probe was incubated with increasing amounts of nuclear extracts (Fig. 4). The differential binding affinity in the complex was estimated by densitometric analysis to be at least 3.5-fold.



View larger version (122K):
[in this window]
[in a new window]
  		FIG. 4. Characterization and effect of DNA methylation on E box by EMSA. Nuclear extracts derived from Sertoli cells (3 µg) were incubated with labeled unmethylated or methylated E box oligonucleotides and separated on a polyacrylamide gel. As a probe, a synthetic oligonucleotide for the E box element (-133/-113) was used that contained either wild-type (-CACGTG-) or methylated cytosine (-CAMGTG-) within the core recognition site. Probe (50 000 cpm) was used with 1, 2.5, 5, 7.5, or 10 µg of proteins from Sertoli cell nuclear extracts

The region (-CCGG-, -85/-82) between the two Inr elements also contained differentially methylated cytosine residues. The Inr element is known to provide basal transcriptional initiation by binding of a minimal set of proteins when a TATA box is not present in the promoter [26–28]. Protein binding activity was determined using EMSA with an oligonucleotide probe corresponding to the region 3' of the first Inr element and including the CpG dinucleotide. Multiple DNA-protein complexes were generated by the unmethylated Inr probe (Inr-WT, -TATCCGG-) and rat Sertoli cell nuclear extracts (lane 1; Fig. 5). An EMSA with the methylated probe Inr-Me (-TATCMGG-), where the CpG dinucleotide was replaced by 5-methyl CpG, revealed an additional faster migrating complex (complex M; lane 2; Fig. 5). When a mutated probe Inr-Mut (-TATCTAG-) where CpG was replaced by TpA was used in the EMSA, all of the faster migrating bands were selectively reduced without generating a new complex (Fig. 5, lane 3).



View larger version (46K):
[in this window]
[in a new window]
  		FIG. 5. Characterization and effect of DNA methylation on the Inr region by EMSA. An EMSA with the Inr element (-105/-78), containing wild-type (-TATCCGG-), methylated sequences (-TATCMGG-), or mutated sequence (-CAAGCGG-) within the core recognition site. Specific DNA-protein complexes are indicated by multiple retarded bands within the putative transcription initiation region. Protein bound to the methylated element has similar affinity to the wild-type element with the additional binding activity (complex M)

From the results of bisulfite sequencing analysis, two cytosine residues of the E2F element were found to be methylated (see Figs. 2 and 3). Sequence analysis indicated that a putative regulatory E2F sequence (TTTCGCG), located about 40 bp upstream of the translational initiation site, was located in this transcribed region of the gene. Two distinctive DNA-protein complexes (I and II) were formed in an EMSA analysis using an unmethylated probe, indicating that putative binding proteins for the E2F element were present in nuclear extracts from Sertoli cells (Fig. 6). An E2F-1-specific antibody (Santa Cruz) was used in EMSA experiments, but no supershifted complex was detected (data not shown). When either a methylated probe E2F-MeA (-TTTMGCG-) or E2F-MeB (-TTTCGMG-) was used to examine relative effects of the methylation of each site on protein binding, it was shown that the methylation at one of the CpG sites resulted in a weaker formation of both complexes, especially complex I (not shown). A corresponding mutation of the E2F sequences E2F-MutA (-TTTATCG-) had a modest reduction in binding activity that was similar to the effect of methylation of either CpG dinucleotides within the consensus E2F sequence. When E2F-MeC that contained two methylated cytosine residues (-mCGmCG-) was used as the probe, a new complex (Fig. 6, complex III, lane 6) was formed with a similar, although not identical, mobility to that complex I (Fig. 6, lane 1).



View larger version (93K):
[in this window]
[in a new window]
  		FIG. 6. Characterization of and effect of DNA methylation on the E2F element. Binding of Sertoli cell nuclear proteins to the E2F element was examined by EMSA. The probes were E2F-WT (-TTTCGCG-) in A and E2F-MeC (-TTTMGMG-) in B. The competing oligonucleotides at 100-fold molar excess were: E2F-WT in lanes 2 and 8; E2F-MeC in lanes 3 and 7; E2F-MeA (-TTTMGCG-) in lanes 4 and 9; E2F-MeB (-TTTCGMG-) in lanes 5 and 10

Competition analysis was used to further identify the DNA-protein complexes shown with probes E2F-WT and E2F-MeC, respectively. A 100-fold molar excess of unlabeled oligonucleotide E2F-WT significantly competed with two complexes formed with the probe E2F-WT (self-competition) (Fig. 6, lane 2). The intensity of the doublet complexes generated with the E2F-WT probe was also clearly reduced by a molar excess of the unlabeled oligonucleotides containing a methylated cytosine residue in either the first or the second site (Fig. 6, lanes 4 and 5). However, an excess of the unlabeled oligonucleotide E2F-MeC containing mCGmCG sequences failed to compete with the formation of the doublet complexes at a 100-fold molar excess (Fig. 6, lane 3). Thus, it was clear that the doublet complexes were specific DNA-protein interactions with the wild-type E2F binding site. Conversely, the complex formed with the E2F-MeC probe could compete only weakly with an excess of unlabeled E2F-MeA or E2F-MeB oligonucleotides (Fig. 6, lanes 9 and 10). An excess of unlabeled oligonucleotide E2F-WT did not compete with the complex III formed by the probe containing two methylcytosine sequences (Fig. 6, lane 8), indicating that the complex III resulted from interaction of proteins specifically with the mCGmCG sequence.

Analysis of the Methylation Pattern of the FSHR Core Promoter after Treatment of the MSC-1 Cell Line with 5-azaCdR

Bisulfite-DNA sequence analysis of the MSC-1 cells allowed the correlation of cytosine methylation with the endogenous FSHR gene inactivation during the formation of a tumorigenic cell line. Treatment of the MSC-1 cells with 5-azaCdR led to demethylation of the promoter and allowed the direct correlation between demethylation and activation of transcription. The effective conditions for demethylation of genomic DNA from the MSC-1 cells was determined after a 12-day treatment with varying concentrations of 5-azaCdR. The results of the bisulfite sequencing of DNA from cells treated with the lowest concentrations of 5-azaCdR (0.5–1 µM) showed four cytosine residues at CpG dinucleotides in the core promoter region were partially converted to thymine. Representative sequencing results for the same three regions shown in Figure 2 for the rat are presented (see color plate, Fig. 7). Even in cells treated with 0.5 µM of 5-azaCdR, DNA conversion was detected most often in the E box motif, indicating that demethylation occurred more frequently at this site. When cells were cultured with 2 µM 5-azaCdR, all cytosine residues in the sequence were converted to thymine, indicating that the 5-azaCdR-treated gene changed all methylated cytosine residues into the demethylated state in these conditions (Fig. 7). Although the final sequencing products were 330 bp of the mouse FSHR core promoter, a cytosine residue at nt -161 was not clearly identifiable under our conditions.



View larger version (39K):
[in this window]
[in a new window]
  		FIG. 7. Genomic sequencing profile of bisulfite-converted DNA from MSC-1 cells treated with 5-azaCdR. Effect of 5-azaCdR on demethylation of the FSHR promoter of MSC-1 cells was examined by bisulfite genomic sequencing. The MSC-1 cells were cultured in the presence (0.5, 1.0, and 2.0 µM) or absence of 5-azaCdR for 12 days. Genomic DNA was isolated from the cells and subjected to bisulfite conversion reaction. Data are shown in the color plate, Figure 7. Note that the sequence of the mouse FSHR in these regions differs somewhat from the rat sequence. With no treatment all of the CpG sites were methylated, as the C residues in these positions remained unconverted by bisulfite (data not shown). Following treatment with 1 µM or less of 5-azaCdR, one CpG site was partially demethylated as indicated by the TpG sequence within the E box element. When the 2-µM concentration of 5-azaCdR was used, all CpG sites were completely demethylated

The expression level of the FSHR gene in the 5-azaCdR-treated cells was assayed by RT-PCR analysis before and after treatment of MSC-1 cells with 5-azaCdR for 12 days. With PCR primers specific for the mouse FSHR cDNA sequences, a 290-bp region of the mRNA was amplified and analyzed by agarose gel electrophoresis. As shown in Figure 8, the treatment of MSC-1 cells with 5-azaCdR caused the FSHR gene expression to increase in a dose-dependent manner (lanes 1–7). The FSHR mRNA was only detectable after treatment of the MSC-1 cells with 1 and 2 µM 5-azaCdR and in the whole testis control.



View larger version (44K):
[in this window]
[in a new window]
  		FIG. 8. Comparison of the FSHR gene expression of MSC-1 cells treated with 5-azaCdR. Total RNA was isolated from untreated cells or treated cells with 5-azaCdR (1.0 and 2.0 µM) for 12 days. The RNA from mouse testis was used as a positive control (lanes 8 and 9). Expression of the FSHR mRNA was detected as a 300-bp PCR product by RT-PCR (lanes 5, 7, and 9). The - and + symbols refer to the absence (-) or presence (+) of reverse transcriptase in the cDNA synthesis reaction. Relative molecular size of DNA fragments shown with a 100-bp ladder marker (Gibco BRL Life Technologies) (lane 10)

DISCUSSION

Cell-Specific Methylation in the Core FSHR Promoter

Cell-specific expression of a gene can be regulated by the cell-specific transcription factors interacting with the promoter of the gene [6, 29]. The region of the FSHR gene between -383 and +1 bp, relative to the translational initiation site, is essential for maximum promoter activity and has been considered the core promoter [8]. This region of the core promoter contains two Inr-mediated transcriptional start sites, an E box, and an E2F consensus sequence. Even though some aspects of the mechanism of regulation of the FSHR gene have been investigated, there are no reports of cell-specific DNA-protein complexes in the FSHR promoter [7–10]. In addition, reporter gene assays driven by the rat FSHR promoter have shown that this region could promote the promiscuous transcription of the gene in several cell lines in which the expression of the endogenous FSHR gene was originally repressed [10]. Lastly, a transgenic line of mice was reported to have testis-specific expression when a reporter gene was driven by 5 kb of the promoter sequence [10].

In this study, we have shown that seven specific CpG sites within the FSHR core promoter are methylated in cells that do not express the gene. In addition, the extent of demethylation of this gene correlates directly with the level of the FSHR expression in the tumor-derived Sertoli cell line MSC-1. These results indicate that DNA methylation is one of the major factors regulating Sertoli cell-specific expression of the FSHR gene.

In mammals, DNA methylation patterns appear to play a critical role in terms of gene regulation in differentiating and differentiated cells [11, 30, 31]. There is considerable evidence that a variety of cell-specific genes have distinctive DNA methylation patterns in expressing and nonexpressing cells and undergo demethylation at the stage of gene activation [11, 13, 31, 32].

DNA Methylation Can Inhibit Transcription Factor Binding

Several studies have shown that the inhibitory effects of methylation in a promoter can be the result of altered binding of transcription factor(s) to the methylated binding motif [33–35]. Recently, it has been shown that the silencing of the testis-specific Pdha-2 gene occurs via the selective methylation of a CpG dinucleotide within the ATF/CRE binding site [36]. Generally, under conditions where there are low levels of CpG dinucleotides, cytosine methylation can function as a mutation within the factor-binding site to prevent the binding of transcription factors [35, 37, 38]. Selectively methylated site-specific elements in the promoters correspond to the inactive state of transcription in a variety of genes [35, 37–40]. A possible mechanism is that a single CpG site within the cis-acting regulatory elements is sufficient to block the binding of the trans-acting factors to the DNA [33, 35, 41–43]. A single cytosine methylation could alter the local environment in the major groove of DNA that serves as the site for the binding of transcription factors [35, 44].

Within the 320-bp region of the rat FSHR core promoter, four of the seven potential 5-methylcytosine residues are located within known protein-DNA binding sites. The methyl group(s) within cis-acting regulatory elements may interrupt the binding of trans-acting factors to their target sites on the promoter. It is reasonable to consider this inhibition mechanism because the promoter region of the FSHR gene exhibits rather low G+C content (40%) and no extensive CpG-rich sequences. DNA methylation of the E box element (CACGTG, -124/-119) in the FSHR promoter region inhibited the binding of nuclear extracts from Sertoli cells by 3.5-fold. In other studies, methylation of the E box motif has been shown to significantly decrease the binding affinity of c-Myc/c-Myn [43, 45].

A methylated CpG dinucleotide within the Inr region of the FSHR gene in the nonexpressing tissues enhanced the binding affinity of additional proteins that were specific for the methylated sequence. Because the Inr element is a central site for the formation of the transcription initiation complex in the TATA-less promoter, the methylated DNA sequence might recruit binding of a methyl-CpG-specific protein and subsequently lead to the repression of the promoter activity. This additional complex clearly showed the presence of proteins within the nuclear extracts from Sertoli cells with high affinity for the methylated CpG sequence. However, detection of the known methyl-binding proteins in supershift experiments using two different polyclonal antibodies against MeCP2 provided by Dr. A. Bird was unsuccessful (data not shown). Optimal binding conditions for the detection of the MeCP2 protein complex with the linear DNA sequence requires the DNA to be in the form of nucleosomes [46, 47]. The nature of the methylation-specific complexes in the Inr region is under investigation.

The E2F consensus sequence TTTCGCG, containing two CpG dinucleotides (-45/-39) is located in the FSHR promoter. Kovesdi et al. have previously shown that the binding of transcription factors to the E2F element was sensitive to methylation at the second cytosine [48]. Previous studies have shown that the methylcytosine binding protein, MeCP2, will bind at the methylated target sequence mCGmCG in the E2F element [49]. Our results showed that methylation at either cytosine residue in this element had the same effect as a mutation, i.e., the affinity of protein binding to this site was decreased. Recently, the positive functional role of the E2F motif in the FSHR promoter has been characterized with transient transfection assays that show that the transcription factor E2F-1 binds to this consensus sequence but not to the methylated sequence [50]. When the methylated probe containing -mCGmCG- dinucleotides was used in EMSA, a new DNA-protein complex was detected.

Recent evidence suggests that cytosine methylation can also exert inhibitory effects through altering chromatin structure and not by inhibition of the transcription machinery directly [14, 30, 51]. When CpG islands are located in the promoter region, DNA methylation of this region can be accompanied by changes in the chromatin structure for inactivation of a gene [52, 53]. Distinctive chromatin structure on methylated DNA can be explained by displacement of histone H1 with MeCP2 [54]. The MeCP2 has recently been shown to exist in a multiple repression complex in the promoter region, providing strong evidence for the alternative inhibitory mechanism by DNA methylation [55–57]. The repressive chromatin structure results from the recruitment of histone deacetylases (HDACs) by MeCP2 in nucleosomal DNA [47, 55].

Demethylation of MSC-1 Cell and Expression of FSHR Gene

The mouse Sertoli cell line (MSC-1), derived from a testicular tumor, has an inactive FSHR promoter [25]. The inactive state of transcription in MSC-1 cells correlates with the cytosine methylation in the core promoter of the FSHR gene. The drug, 5-azaCdR is known to block DNA methylation in newly replicated DNA molecules. It has been used to activate silent genes in cells when the expression of that gene is controlled by DNA methylation [58–60]. Likewise, treatment of MSC-1 cells with 5-azaCdR resulted in the demethylation of the mouse FSHR promoter and reactivated the transcription of the FSHR gene.

Altogether, the data presented in this study support the notion that the transcription of the rat or mouse FSHR gene is regulated by methylation or demethylation of CpG dinucleotides in the proximal promoter. Although CpG dinucleotides are not abundant in the rat or mouse FSHR promoter, DNA methylation at very specific sites within the promoter correlated with gene inactivation. Methylation of DNA within the FSHR promoter may decrease the binding of required transcription factors and/or may recruit methyl-specific binding proteins. The methyl-specific binding proteins could also directly interfere with transcription factor binding or could recruit transcriptional silencers such as HDACs or negative cis-acting elements, [61]. Proteins that specifically recognize methylated DNA may also play independent or interrelated roles in modulating gene activity. The maintenance of tissue specificity in gene expression probably requires multiple mechanisms, and our studies support the idea that DNA methylation plays a major role in this process in the regulation of the rat or mouse FSHR gene. It is noteworthy that the proximal 231 bp of the promoter for the human FSHR gene, while 80% homologous to the promoter for the rat or mouse gene in this region lacks any of the seven specific CpG sites and must be regulated by some other mechanism [62].

FOOTNOTES

First decision: 6 September 2000.

1 Supported by NICHD grant no. HD 10808. Back

2 Correspondence: Michael D. Griswold, School of Molecular Biosciences, 630 Fulmer Hall, Washington State University, Pullman, WA 99164-4660. FAX: 509 335 9688; griswold{at}mail.wsu.edu Back

Accepted: September 22, 2000.

Received: August 7, 2000.

REFERENCES

  1. Russell LD. Form, dimensions, and cytology of mammalian Sertoli cells. In: Russell LD, Griswold MD (eds.), The Sertoli Cell. Clearwater, FL: Cache Revier Press; 1993: 1–38.
  2. Griswold MD. Protein secretions of Sertoli cells. Int Rev Cytol 1988; 110:133–156.[Medline]
  3. Zirkin BR, Awoniyi C, Griswold MD, Russell LD, Sharpe R. Is FSH required for adult spermatogenesis? J Androl 1994; 15:273–276.
  4. Griswold MD. Action of FSH on mammalian Sertoli cells. In: Russell LD, Griswold MD (eds.), The Sertoli Cell. Clearwater, FL: Cache Revier Press; 1993: 493–508.
  5. Kumar TR, Wang Y, Lu N, Matzuk MM. Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nature Genet 1997; 15:201–204.[CrossRef][Medline]
  6. Roeder RG. The role of general initiation factors in transcription by RNA polymerase II. Trends Biochem Sci 1996; 21:327–334.[CrossRef][Medline]
  7. Heckert LL, Daley IJ, Griswold MD. Structural organization of the follicle-stimulating hormone receptor gene. Mol Endocrinol 1992; 6:70–80.[Abstract/Free Full Text]
  8. Goetz TL, Lloyd TL, Griswold MD. Role of E box and initiator region in the expression of the rat follicle-stimulating hormone receptor. J Biol Chem 1996; 271:33317–33324.[Abstract/Free Full Text]
  9. Heckert LL, Daggett MA, Chen J. Multiple promoter elements contribute to activity of the follicle-stimulating hormone receptor (FSHR) gene in testicular Sertoli cells. Mol Endocrinol 1998; 12:1499–1512.[Abstract/Free Full Text]
  10. Linder CC, Heckert LL, Goetz TL, Griswold MD. Follicle-stimulating hormone receptor gene promoter activity. Endocrine 1994; 2:957–966.
  11. Eden S, Cedar H. Role of DNA methylation in the regulation of transcription. Curr Opin Genet Dev 1994; 4:255–259.[CrossRef][Medline]
  12. Bird AP. Gene number, noise reduction and biological complexity. Trends Genet 1995; 11:94–100.[CrossRef][Medline]
  13. Beard C, Li E, Jaenisch R. Loss of methylation activates Xist in somatic but not in embryonic cells. Cell 1995; 65:229–239.
  14. Siegfried Z, Cedar H. DNA methylation: molecular lock. Curr Biol 1997; 7:305–307.
  15. Gruenbaum Y, Cedar H, Razin A. Substrate and sequence specificity of a eukaryotic DNA methylase. Nature 1982; 295:620–622.[CrossRef][Medline]
  16. Kafri T, Gao X, Razin A. Mechanistic aspects of genome-wide demethylation in the preimplantation mouse embryo. Proc Natl Acad Sci U S A 1993; 90:10558–10562.[Abstract/Free Full Text]
  17. Karl AF, Griswold MD. Sertoli cells of the testis: preparation of culture and effect of retinoids. Methods Enzymol 1990; 190:71–75.[Medline]
  18. Frommer M, McDonald LE, Millar DS, Collis CM, Watt F, Grigg GW, Molly PL, Paul CL. A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc Natl Acad Sci U S A 1992; 89:1827–1831.[Abstract/Free Full Text]
  19. Blin N, Stafford DW. A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acids Res 1976; 3:2303–2308.
  20. Kerr LD. Electrophoretic mobility shift assay. Methods Enzymol 1995; 254:619–632.[Medline]
  21. Dignam JD, Lebovitz RM, Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 1983; 11:1475–1489.[Abstract/Free Full Text]
  22. Taylor SM, Jones PA. Mechanisms of action of eukaryotic DNA methyltransferase: use of 5-azacytosine containing DNA. J Mol Biol 1982; 162:679–692.[CrossRef][Medline]
  23. Kingston RE. Preparation and analysis of RNA. In: Ausubel FMEA (ed.), Current Protocols in Molecular Biology. New York: John Wiley and Sons, Inc.; 1997: 403.
  24. Perchon JJ, Behringer RR, Cate RL, Harwood KA, Idzerda RL, Brinster R, Palmiter RD. Directed expression of an oncogene to Sertoli cells in transgenic mice using inhibiting substance regulatory sequence. Mol Endocrinol 1992; 6:1403–1411.[Abstract/Free Full Text]
  25. McGuinness MP, Linder CC, Morales CR, Heckert LL, Pikus J, Griswold MD. Relationship of a mouse Sertoli cell line (MSC-1) to normal Sertoli cells. Biol Reprod 1994; 51:116–124.[Abstract]
  26. Carcamo J, Buckbinder L, Reinberg D. The initiator directs the assembly of a transcription factor IID-dependent transcription complex. Proc Natl Acad Sci U S A 1991; 88:8052–8056.[Abstract/Free Full Text]
  27. Weis L, Reinberg D. Accurate positioning of RNA polymerase II on a natural TATA-less promoter is independent of TATA-binding-protein-associated factors and initiator-binding proteins. Mol Cell Biol 1997; 17:2973–2984.[Abstract]
  28. Smale ST, Schmit MC, Berk AJ, Baltimore D. Transcriptional activation by Sp1 as directed through TATA or initiator: specific requirement for mammalian transcription factor IID. Proc Natl Acad Sci U S A 1990; 87:4509–4513.[Abstract/Free Full Text]
  29. Wasylyk B. Enhancers and transcription factors in the control of gene expression. Biochim Biophys Acta 1988; 951:17–35.[Medline]
  30. Tate PH, Bird A. Effect of DNA methylation on DNA-binding proteins and gene expression. Curr Opin Genet Dev 1993; 3:226–231.[CrossRef][Medline]
  31. El-Deiry WS, Nelkin BD, Celano P. High expression of the DNA methyltransferase gene characterizes human neoplastic cells and progression stages of colon cancer. Proc Natl Acad Sci U S A 1991; 88:3470–3474.[Abstract/Free Full Text]
  32. Nickel J, Short ML, Schmitz A, Eggert M, Renkawitz R. Methylation of the mouse M-lysozyme downstream enhancer inhibits heterotetrameric GABP binding. Nucleic Acids Res 1995; 23:4785–4792.[Abstract/Free Full Text]
  33. Comb M, Goodman HM. CpG methylation inhibits proenkephalin gene expression and binding of the transcription factor AP-2. Nucleic Acids Res 1990; 18:3975–3982.[Abstract/Free Full Text]
  34. Robertson KD, Hayward SD, Ling PD, Samid D, Ambinder RF. Transcriptional activation of the Epstein-Barr virus latency C promoter after 5-azacytidine treatment: evidence that demethylation at a single CpG site is crucial. Mol Cell Biol 1995; 15:6150–6159.[Abstract]
  35. Watt F, Molloy PL. Cytosine methylation prevents binding to DNA of a HeLa cell transcription factor required for optimal expression of the adenovirus major late promoter. Genes Dev 1988; 2:1136–1143.[Abstract/Free Full Text]
  36. Iannello RC, Gould JD, Young JC, Giudice A, Medcalf R, Kola I. Methylation-dependent silencing of the testis-specific Pdha-2 basal promoter occurs through selective targeting of an activating transcription factor/cAMP-responsive element-binding site. J Biol Chem 2000; 275:19603–19608.[Abstract/Free Full Text]
  37. Iannello RC, Young J, Sumarsono S, Tymms MJ, Dahl HM, Gould J, Hedger M, Kola I. Regulation of Pdha-2 expression is mediated by proximal promoter sequences and CpG methylation. Mol Cell Biol 1997; 17:612–619.[Abstract]
  38. Okuse K, Matsuoka I, Kurihara K. Tissue-specific methylation occurs in the essential promoter element of the tyrosine hydroxylase gene. Mol Brain Res 1997; 46:197–207.[Medline]
  39. Singal R, Ferris R, Little JA, Wang SZ, Ginder DG. Methylation of the minimal promoter of an embryonic globin gene silences transcription in primary erythroid cells. Proc Natl Acad Sci U S A 1997; 94:13724–13729.[Abstract/Free Full Text]
  40. Ngo V, Gourdji D, Laverriere J-N. Site-specific methylation of the rat prolacting and growth hormone promoters correlates with gene expression. Mol Cell Biol 1996; 16:3245–3254.[Abstract]
  41. Kovesdi I, Reichel R, Nevins JR. Identification of a cellular transcription factor involved in E1A trans-activation. Cell 1986; 45:219–228.[CrossRef][Medline]
  42. Iguchi-Ariga SM, Schaffner W. CpG methylation of the cAMP-responsive enhancer/promoter sequence TGACGTCA abolishes specific factor binding as well as transcriptional activation. Genes Dev 1989; 3:612–619.[Abstract/Free Full Text]
  43. Prendergast GC, Lawe D, Ziff EB. Association of Myn, the murine homolog of Max, with c-myc stimulates methylation-sensitive DNA binding and ras cotransformation. Cell 1991; 65:395–407.[CrossRef][Medline]
  44. Fox KK. Effect of HhaI methylation on DNA local structure. Biochem J 1986; 234:213–216.[Medline]
  45. Prendergast GC, Ziff RB. Methylation-sensitive sequence-specific DNA binding by the c-myc basic region. Science 1991; 251:186–189.[Abstract/Free Full Text]
  46. Nan X, Campoy J, Bird AP. MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin. Cell 1997; 88:471–481.[CrossRef][Medline]
  47. Nan X, Ng H-H, Jonson CA, Laherty CD, Turner BM, Eisenman RN, Bird A. Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature 1998; 393:386–389.[CrossRef][Medline]
  48. Kovesdi I, Reichel R, Nevins JR. Role of an adenovirus E2 promoter binding factor in E1A-mediated coordinate gene control. Proc Natl Acad Sci U S A 1987; 84:2180–2184.[Abstract/Free Full Text]
  49. Di Fiore B, Palena A, Felsani A, Palitti F, Caruso M, Lavia P. Cytosine methylation transforms an E2F site in the retinoblastoma gene promoter into a binding site for the general repressor methylcytosine-binding protein 2 (MeCP2). Nucleic Acids Res 1999; 27:2852–2859.[Abstract/Free Full Text]
  50. Kim J-S, Griswold MD. E2F and GATA-1 are required in the transcriptional regulation of the follicle-stimulating hormone receptor (FSHR) promoter. 2000; (in press).
  51. Richardson R, Yung R. Role of DNA methylation in the regulationof cell function. J Lab Clin Med 1999; 134:333–340.[CrossRef][Medline]
  52. Ng HH, Bird A. DNA methylation and chromatin structure. Curr Opin Genet Dev 1999; 9:158–163.[CrossRef][Medline]
  53. Pfeifer GP, Tanguay RL, Steigerwald SD, Riggs AD. In vivo footprint and methylation analysis by PCR-aided genomic sequencing: comparison of active and inactive X chromosomal DNA at the CpG island and promoter of human PGK-1. Genes Dev 1990; 4:1277–1287.[Abstract/Free Full Text]
  54. Kass SU, Pruss D, Wolffe AP. How does DNA methylation repress transcription? Trends Genet 1997; 13:444–449.[CrossRef][Medline]
  55. Jones PL, Veenstra GJ, Wade PA, Vermaak D, Kass SU, Landsberger N, Strouboulis J, Wolffe AP. Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription. Nat Genet 1998; 19:187–190.[CrossRef][Medline]
  56. Chandler SP, Guschin D, Landsberger N, Wolffe AP. The methyl-CpG binding transcriptional repressor MeCP2 stably associates with nucleosomal DNA. Biochemistry 1999; 38:7008–7018.[CrossRef][Medline]
  57. Coffee B, Zhang F, Warren ST, Reines D. Acetylated histones are associated with FMR1 in normal but not fragile X-syndrome cells. Nat Genet 1999; 22:98–101.[CrossRef][Medline]
  58. Ottavianon YL, Issa J-P, Parl FF, Smith HS, Baylin SB, Davidson NE. Methylation of the estrogen receptor gene CpG island marks loss of estrogen receptor expression in human breast cancer cells. Cancer Res 1994; 54:2552–2555.[Abstract/Free Full Text]
  59. Bovenzi V, Le NL, Cote S, Sinnett D, Momparler LF, Momparler RL. DNA methylation of retinoic acid receptor beta in breast cancer and possible therapeutic role of 5-aza-2'-deoxcytidine. Anticancer Drugs 1999; 10:471–476.[Medline]
  60. Bender CM, Pao MM, Jones PA. Inhibition of DNA methylation by 5-aza-2'-deoxycytidine suppresses the growth of human tumor cell lines. Cancer Res 1998; 58:95–101.[Abstract/Free Full Text]
  61. Mizuno K, Goto M, Masamune Y, Nakanishi Y. A silencer-like cis element for the testis-specific phosphoglycerate-kinase-2-encoding gene. Gene 1992; 119:293–297.[CrossRef][Medline]
  62. Gromoll J, Dankbar B, Gudermann T. Characterization of the 5' flanking region of the human follicle-stimulating hormone receptor gene. Mol Cell Endocrinol 1994; 102:93–102.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
B. P. Hermann, K. Hornbaker, D. A. Rice, M. Sawadogo, and L. L. Heckert
In Vivo Regulation of Follicle-Stimulating Hormone Receptor by the Transcription Factors Upstream Stimulatory Factor 1 and Upstream Stimulatory Factor 2 Is Cell Specific
Endocrinology, October 1, 2008; 149(10): 5297 - 5306.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
J.-H. Choi, A. S. T. Wong, H.-F. Huang, and P. C. K. Leung
Gonadotropins and Ovarian Cancer
Endocr. Rev., June 1, 2007; 28(4): 440 - 461.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
C.Q. Yang, K.Y.K. Chan, H.Y.S. Ngan, U.S. Khoo, P.M. Chiu, Q.K.Y. Chan, W.C. Xue, and A.N.Y. Cheung
Single nucleotide polymorphisms of follicle-stimulating hormone receptor are associated with ovarian cancer susceptibility
Carcinogenesis, July 1, 2006; 27(7): 1502 - 1506.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
J Liu, X-D Li, A Vaheri, and R Voutilainen
DNA methylation affects cell proliferation, cortisol secretion and steroidogenic gene expression in human adrenocortical NCI-H295R cells
J. Mol. Endocrinol., December 1, 2004; 33(3): 651 - 662.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
W. Xing and M. R. Sairam
Retinoic Acid Mediates Transcriptional Repression of Ovine Follicle-Stimulating Hormone Receptor Gene via a Pleiotropic Nuclear Receptor Response Element
Biol Reprod, July 1, 2002; 67(1): 204 - 211.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
W. Xing, N. Danilovich, and M. R. Sairam
Orphan Receptor Chicken Ovalbumin Upstream Promoter Transcription Factors Inhibit Steroid Factor-1, Upstream Stimulatory Factor, and Activator Protein-1 Activation of Ovine Follicle-Stimulating Hormone Receptor Expression via Composite cis-Elements
Biol Reprod, June 1, 2002; 66(6): 1656 - 1666.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
J. Chaudhary and M. K. Skinner
Identification of a Novel Gene Product, Sertoli Cell Gene with a Zinc Finger Domain, That Is Important for FSH Activation of Testicular Sertoli Cells
Endocrinology, February 1, 2002; 143(2): 426 - 435.
[Abstract] [Full Text] [PDF]

Home page
 Recent Prog Horm ResHome page
L. L. Heckert and M. D. Griswold
The Expression of the Follicle-stimulating Hormone Receptor in Spermatogenesis
Recent Prog. Horm. Res., January 1, 2002; 57(1): 129 - 148.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
T. L. Kroft, P. Jethanandani, D. J. McLean, and E. Goldberg
Methylation of CpG Dinucleotides Alters Binding and Silences Testis-Specific Transcription Directed by the Mouse Lactate Dehydrogenase C Promoter
Biol Reprod, November 1, 2001; 65(5): 1522 - 1527.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
W. Xing and M. R. Sairam
Role of CACC-Box in the Regulation of Ovine Follicle-Stimulating Hormone Receptor Expression
Biol Reprod, October 1, 2001; 65(4): 1142 - 1149.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Griswold, M. D.
Right arrow Articles by Kim, J.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Griswold, M. D.
Right arrow Articles by Kim, J.-S.
Agricola
Right arrow Articles by Griswold, M. D.
Right arrow Articles by Kim, J.-S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS