Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Keith Ho, H.-C.
Right arrow Articles by Schick, B. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Keith Ho, H.-C.
Right arrow Articles by Schick, B. P.
Agricola
Right arrow Articles by Keith Ho, H.-C.
Right arrow Articles by Schick, B. P.
Biology of Reproduction 64, 1667-1676 (2001)
© 2001 Society for the Study of Reproduction, Inc.


Regular Article

Serglycin Proteoglycan Synthesis in the Murine Uterine Decidua and Early Embryo1

Hon-Chung Keith Hoa, Kathleen E. McGrathb, Kristin C. Brodbecka, James Palisb, and Barbara P. Schick2,a

a Cardeza Foundation for Hematologic Research, Jefferson Medical College of Thomas Jefferson University, Philadelphia, Pennsylvania 19107 b Department of Pediatrics, University of Rochester Medical Center, Rochester, New York 14642

ABSTRACT

This study has explored the localization and synthesis of the serglycin proteoglycan in the murine embryo and uterine decidua during midgestation. Embryos in deciduae were subjected to in situ hybridization with cRNA probes and to immunohistochemical detection with a specific antibody against murine serglycin. Adherent decidual cell cultures were prepared from freshly isolated deciduae. Proteoglycan biosynthesis was investigated by labeling intact deciduae and decidual cultures with 35S-sulfate. Serglycin mRNA was detected by in situ hybridization throughout the mesometrial portion and at the periphery of the antimesometrial portion of the decidua at Embryonic Day (E) 8.5, and in the parietal endoderm surrounding the embryo. Serglycin mRNA was detected in fetal liver at E11.5–E14.5. Serglycin was detected by immunohistochemistry in decidua and parietal endoderm at E8.5 and in liver at E13.5. Most of the proteoglycans synthesized by cultured intact deciduae (78%) and adherent decidual cultures (91%) were secreted into the medium. Serglycin proteoglycan may play an important role in uterine decidual function during early postimplantation development.

conceptus, decidua, developmental biology, implantation/early development, pregnancy

INTRODUCTION

Decidualization of the uterine stroma is integral to embryonic implantation and development in mammals such as rodents and primates that undergo hemochorial placentation. Implantation is initiated by attachment of trophectoderm cells of the blastocyst embryo to the uterine epithelium, which is mediated in part through interactions of the trophoblast with the heparan sulfate proteoglycans of the epithelium and the embryo [1, 2]. Following attachment, the trophoblast cells produce extracellular matrix-degrading enzymes that enable penetration of the epithelial wall. Attachment also triggers decidualization of the underlying stromal cells, and embedding of the embryo follows.

The decidualization reaction is known to involve synthesis of a number of extracellular matrix proteins [310], proteoglycans [1114], and other proteins such as growth factors and metalloproteinases [1535]. It has been reported that murine uterine stromal and decidual cells synthesize both chondroitin sulfate and heparan sulfate proteoglycans [13]. However, the core proteins of these proteoglycans have not been identified.

We were interested in understanding the regulation of expression of the serglycin proteoglycan in early embryonic development. The serglycin proteoglycan was first purified [36] and its cDNA cloned [37, 38] from the rat yolk sac L2 tumor cell line that has characteristics of parietal endoderm [39]. This proteoglycan was found to be secreted copiously and was also found by immunodetection to be localized in the cytoplasm and plasma membrane of these cells [36]. The L2 cell has not been reported to differentiate into hematopoietic cells. Subsequently, mRNA for this proteoglycan was found in a number of rodent and human hematopoietic cells, and most studies thereafter concerning serglycin have focused on hematopoietic cells [40]. In order to explore a potential role for serglycin in embryonic development both in hematopoietic and nonhematopoietic tissue, we have revisited the original finding that the L2 yolk sac tumor cell line synthesizes serglycin. In the course of our in situ hybridization studies in which murine embryos were probed while embedded in the decidual tissue, we observed that, in addition to expression in the parietal endoderm and hematopoietic tissue, mRNA for serglycin was expressed copiously in the mesometrial decidual tissue of mice over several days postimplantation. We report in this paper our findings concerning localization of serglycin expression within the embryo, and the identification and characterization of this proteoglycan in uterine decidual cells.

MATERIALS AND METHODS

Animals

Timed-pregnant CD-1 (ICR) mice were obtained directly from Charles River Laboratories (Wilmington, MA), or were bred at our facilities. Vaginal plugs were checked the morning after natural overnight matings defined as Embryonic Day 0.3 (E0.3). Experiments were performed in accordance with the National Research Council publication, Guide for Care and Use of Laboratory Animals. The protocols were approved by the Institutional Animal Care and Use Committee.

Subcloning of Serglycin and Platelet Factor 4 cDNAs

Clones of serglycin and platelet factor 4 (PF4) were generated from cDNAs prepared by reverse transcription-polymerase chain reaction (RT-PCR) from mouse bone marrow RNA. The primers included appropriate restriction sites for cloning. The 750-base pair (bp) serglycin probe was generated using a forward primer 5'cgcgccgcggatccgctgcaaaccgaatggcttt and reverse primer 5'cggccggaattcaatgcgagttgggttcctga, based on the published sequence of murine serglycin [41]. The 532-bp PF4 probe was prepared using 5'cgcgccgcggatcctcgctgcggtgtttcgag for the forward and 5'cggccggaattcaggcaactcactatgttgag for the reverse primers. The unpublished sequence of the murine PF4 gene was kindly provided by Dr. Mortimer Poncz (Childrens Hospital of the University of Pennsylvania, Philadelphia, PA). The cDNAs were cloned into the EcoRI and BamHI sites of the original pcDNA3 vector (In Vitrogen, Carlsbad, CA) that contains the T7 and Sp6 RNA polymerase promoters and therefore can be used to generate both the sense and antisense RNA probes. The sequences of the serglycin and PF4 probes were verified by automated sequencing in the Nucleic Acid Facility at Thomas Jefferson University.

In Situ Hybridization of Embryos and Decidua

At the desired developmental times, mice were killed by cervical dislocation and the uteri were removed from the peritoneal cavity, and deciduae dissected free of uterine muscle. At E7.5 and E8.5, the deciduae were transected and the embryos resting in half-deciduae were fixed overnight in freshly prepared, cold 4% paraformaldehyde/PBS. At later developmental time points, embryos were isolated free of decidual tissues and similarly fixed. Tissues were dehydrated through ethanol into xylene and embedded in paraffin using a Tissue-Tek V.I.P. automatic processor (Miles, Mishawaka, IN). Five-micron sections were placed onto trimethylaminopropyl silane-coated slides.

In situ hybridization was performed as previously described [42]. Briefly, sections were dewaxed, rehydrated, and treated with proteinase K to enhance probe accessibility and with acetic anhydride to reduce nonspecific background. Single-stranded 33P-labeled antisense and sense serglycin and PF4 RNA probes were synthesized to a specific activity of 5 x 108 dpm/µg in the presence of uridine 5' [{alpha}-33P]triphosphate and the appropriate RNA polymerases, and hydrolyzed by alkaline treatment to approximately 200 bp. Sense probes served as controls for nonspecific background. Neighboring sections were hybridized at 55°C with 65 ng/ml of probe. No signal above background was seen in any of the negative controls. Images were captured on a digital microscope camera (Polaroid, Cambridge, MA) and processed using Photoshop 5.1 (Adobe Systems, San Jose, CA) with Imaging Processing Tool Kit (Reindeer Games, Asheville, NC).

Establishment of Decidual Cell Cultures

The decidual cell cultures were prepared as described [3]. The decidual capsules were minced and then dissociated with 0.5 mg/ml collagenase (type IV; Sigma Chemical Co., St. Louis, MO) containing 0.2 mg/ml DNase 1. The cells were then incubated with several changes of 0.1 mg/ml collagenase with 0.2 mg/ml DNase I and 0.2 mg/ml proteinase (type XIV) in Hepes-buffered Dulbecco minimal essential medium (DMEM) without Ca2+ and Mg2+. The cells were dissociated with a Pasteur pipette, centrifuged at 3000 rpm for 5 min, resuspended in fresh DMEM with fetal bovine serum with 1% glutamine and 1% antibiotic-antimycotic (all from Gibco/BRL, Grand Island, NY), and were plated at 3–4 x 106 cells per 100-mm tissue culture dish. Following a 24-h incubation to allow attachment, the culture medium and nonadherent cells were removed, and fresh medium was added. The adherent cells were then used for the mRNA analysis, 35S-sulfate labeling, and immunocytochemistry as described below.

Estimation of Serglycin Expression in Decidual Cellsby RT-PCR and Northern Blotting

Following removal of the uteri, decidual tissue was freed of overlying uterine muscle and the underlying conceptus by dissection with forceps. The decidual tissue was homogenized in Trizol (Gibco/BRL), and RNA was extracted according to the instructions of the supplier. RNA also was extracted from cultured decidual cells with Trizol. RT-PCR studies were carried out as follows. For the RT reaction, 4 µg RNA and 20 pmol oligo(dT) were annealed in 25 µl total volume at 65°C for 10 min. Then 10 µl of 5x RT buffer, dNTPs to give a final concentration of 0.24 mM, 1 µl reverse transcriptase (Promega, Madison, WI), and the appropriate volume of water were added for a total volume of 50 µl. PCR reactions were carried out in 100 µl total volume with 0.5 µl Taq polymerase (Gibco/BRL) and 4 µl of the RT reaction with final concentrations of 1x PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, and 0.5 pmol forward and reverse primers. The primers for serglycin were 5'-GCTGCAACCGAATGGCTTT (forward) and 5'-GTCTTCTGGTTGGTCTTGGT (reverse) to give a 340-bp product. The thermal cycler program was 1 min at 94°C, 1 min at 55°C, 2 min at 72°C for 30 cycles, followed by a 72°C extension for 10 min and storage at 4°C. The PCR product obtained was sequenced and its serglycin identity was confirmed.

Northern blots were run on 1.2% agarose gels containing formaldehyde and ethidium bromide, and electrophoresis was carried out in 0.1 M morpholinepropanesulfonic acid buffer [43].The RNA was transferred to Hybond nylon membranes (Amersham, Arlington Heights, IL) in 20x SSC (3 M NaCl, 0.3 M sodium citrate). Prehybridization and hybridization were carried out at 50°C as described, using a buffer containing 50% formamide, 5x Denhardt solution, 5x SSPE (sodium phosphate, EDTA, NaCl), 0.1% SDS, 0.1 mg/ml denatured salmon sperm DNA, and 0.3 mg/ml yeast tRNA. The probes were synthesized by RT-PCR using mouse bone marrow cell RNA as a template with the primers described above for PCR. The probes were labeled with 32P-dCTP (New England Nuclear, Boston, MA) by random hexamer priming [43].

Preparation of Antisera Against Murine Serglycin

A 15-amino acid peptide based on the N-terminal region of the serglycin core protein sequence [41] was prepared at the University of Virginia Biomolecular Research Facility (Charlottesville, VA). The sequence was YPARRARYQWVRCKP. The peptide was coupled to keyhole limpet hemocyanin (mcKLH; Pierce Chemical Company, Rockford, IL) and injected into chickens for production of antibodies (Cocalico, Reamstown, PA). The reactivity of the antibody was tested by slot blotting against the uncoupled peptide and against recombinant murine serglycin that had been prepared in pGEX-6P2 (Pharmacia) using a full-length cDNA that had been prepared by RT-PCR of murine bone marrow RNA. Crude IgY was prepared from egg yolks by Cocalico. The anti-serglycin antibody was affinity purified using a column prepared by coupling the target peptide to epoxy-activated Sepharose 6B (Pharmacia) according to the directions from the supplier. The concentration of the purified antibody was 0.35 mg/ml. For controls for Western blots to identify core proteins from the purified proteoglycans, nonimmune IgY (Cocalico), diluted 1:1000, was used. However, when the nonimmune IgY was used on cell samples sporadic unacceptable background labeling was observed. Therefore, for controls for immunohistochemistry a nonimmune IgY fraction was prepared by passing nonimmune IgY through the affinity column that was made with the peptide coupled to epoxy-activated Sepharose 6B. Nonimmune IgY (Cocalico) was applied to the column in the same amount as had been used for the immune IgY, and the final eluate was used at the same dilution as was used for the specific antibody.

Immunohistochemistry

Cultured decidual cells were grown on plastic slide units (Nalge Nunc International, Fisher Scientific, King of Prussia, PA) for 4 days and fixed in 4% paraformaldehyde in 1x Dulbecco PBS, pH 7.4 (DPBS, Gibco/BRL) at room temperature for 10 min. The cells were not grown to confluence in order to obtain optimal observation of individual cells. Paraffin sections of E6.5–E9.5 intact decidua with their embryos in place and paraffin sections of whole E13.5 embryos were prepared and paraffin removed as described above for in situ hybridization. The cells from both types of preparations were permeabilized with 0.5% Triton X-100 in DPBS for 4 min. The Vectastain Elite ABC Kit (Vector Laboratories, Burlingame, CA) was used for the staining. The slides were incubated with 0.3% hydrogen peroxide for 30 min to reduce endogenous peroxidase activity and washed with fresh changes of DPBS once a minute for 5 min. The slides were blocked with 1.5% goat serum in DPBS. The cells were incubated with the chicken anti-serglycin antibody or control antibody (1:50) in blocking buffer for 1 h. The samples were blocked again with 1.5% goat serum and washed 5x with DPBS. The secondary antibody was goat anti-chicken biotinylated secondary antibody (BA-9010) (Vector) diluted 1:200. The slides were washed, treated with the Vectastain ABC reagent, and incubated in 3,3'-diaminobenzadine for detection of serglycin. In some experiments, labeling with anti-desmin or double labeling with anti-serglycin or anti-desmin was performed to confirm the identity of the decidual cells. Rabbit anti-desmin (Sigma) was used at 1:100 dilution, and the secondary antibody was biotinylated goat anti-rabbit at 1:200 dilution (Vector).

Characterization of Proteoglycans by 35S-Sulfate Metabolic Labeling

Proteoglycan synthesis was studied by analysis of 35S-sulfate-labeled molecules from decidual cells and culture medium. All procedures were as described previously [43]. The 35S-sulfate (0.3 mCi/ml) (ICN Radiochemicals, Costa Mesa, CA) was added with the fresh medium after the 24-h attachment period, and the cells were incubated for an additional 4 days. The cells were solubilized in 8 M urea-50 mM sodium acetate-0.2% Triton X-100 with protease inhibitors. The proteoglycans were isolated from the cells and medium by DEAE-Sephacel chromatography. Aliquots were removed from the proteoglycan fractions for liquid scintillation counting to determine total incorporation of 35S-sulfate into cell-associated and secreted proteoglycans, and the samples were analyzed by SDS-PAGE and Sepharose CL-6B chromatography. DEAE-Sephacel and Sepharose CL-6B were purchased from Pharmacia (Piscataway, NJ). Chondroitinase ABC (Seikagaku, Iyamsville, MD) digestions were performed as described previously [43]. Chondroitinase or heparitinase digests of the proteoglycans were passed through Sephadex G-25 columns (PD-10, Pharmacia) to separate the 35S-sulfate-labeled dissaccharides from the undigested 35S-sulfate-labeled proteoglycans in order to calculate the percentage of chondroitin sulfate in the glycosaminoglycans (GAGs). Chondroitinase and heparitinase digests were also analyzed by SDS-PAGE to determine the size of the core proteins. Gradient gels (4%–15% acrylamide, 20 cm long) were prepared in the laboratory. The core proteins were detected by autoradiography by virtue of the single 35S-sulfated sugar remaining in the disaccharide stub that is left at each GAG attachment site after digestion with these enzymes.

Western Blotting

Proteoglycans were purified from the culture medium as described above and subjected to chondroitinase ABC digestion in the presence of protease inhibitors [43] to remove the GAG chains from the core protein. The digest was electrophoresed on SDS-PAGE gels (0.75-mm-thick minigels, 4%–20% gradient; Bio-Rad Laboratories, Richmond, CA) and electrophoretically transferred to nitrocellulose. The membrane was soaked in blocking buffer (10% nonfat dry milk-1x PBS-0.3% Tween-20) for 1 h. The membrane was then treated with anti-serglycin antibody (1:100), washed, and labeled with rabbit anti-chicken alkaline phosphatase-conjugated antibody (Sigma) at 1:1000 dilution for 1 h. The membrane was washed and then the color reaction was carried out with phosphatase substrate (BCI) (Kierkegaard and Perry Laboratories, Gaithersburg, MD). Preimmune chicken IgY (Cocalico) was the negative control. In some experiments, the proteoglycans were metabolically labeled with 35S-sulfate as described above, and the immunoblots were subjected to autoradiography for colocalization of the core protein with the radiolabel.

RESULTS

In Situ Hybridization of Mouse Embryos and Decidual Tissue for Detection of Serglycin and PF4

The expression of serglycin transcripts in early postimplantation stages of gestation is shown in Figure 1, A–C. The data shown are from E8.5 and were the same as seen at E7.5. Figure 1A is the sense control. Serglycin transcripts were not detected at E7.5–E8.5 in the embryo proper. However, significant levels of serglycin message were seen in the parietal endoderm (Fig. 1C). Interestingly, no serglycin expression was detected in the blood islands or endoderm of the visceral yolk sac. Abundant accumulation of serglycin transcripts was present in maternal decidual tissues at E7.5 (not shown) and E8.5 (Fig. 1B). Expression was very asymmetric, with serglycin transcripts detected in a very dense labeling pattern throughout the mesometrial half of the decidua but only at the periphery of the anti-mesometrial decidua (Fig. 1B, open arrowhead). To determine if serglycin expression in decidual tissues was related to the presence of platelets, adjacent sections of E7.5 and E8.5 conceptuses were probed with PF4. No expression of PF4 was noted in any tissues at E7.5 or E8.5 (data not shown).



View larger version (124K):
[in this window]
[in a new window]
 
FIG. 1. In situ hybridization of serglycin and PF4 messages in early somite and midgestation mouse embryos. Paraffin sections and cRNA probes were prepared as described in the text. Grains have been colorized red for serglycin sense or antisense probes or yellow for PF4 antisense probes. A, B) Neighboring sections of E8.5 decidua and embryos hybridized with serglycin sense probe (A) or antisense probe (B). Similar results were obtained at E7.5. Mesometrial decidual tissues (d) as well as the periphery of the antimesometrial decidua (open arrowhead) express high levels of serglycin message. No signal was detected in the embryo proper (e). However, serglycin transcripts were found in the parietal endoderm surrounding the embryo (black arrow). C) A higher magnification view of the boxed region in B demonstrating the signal seen in parietal endoderm cells (arrows). DF) Neighboring sections of an E11.5 embryo were probed with negative control serglycin sense transcripts (D), serglycin antisense transcripts (E), or PF4 antisense transcripts (F). The predominant site of expression of serglycin and PF4 is in the fetal liver (arrow). G, H) Higher magnification view of neighboring sections of an E12.5 fetal liver. Cells expressing serglycin (G) or PF4 (H) transcripts are evident in the darkly stained liver. Insert in H portrays an overlap of signals within the boxed regions in G and H. Green pixels indicate where both PF4 and serglycin signals were found. Note that there is some overlap of serglycin signal with most of the PF4 (yellow) labeled regions. Cells with expression of either transcript can also be found in the rest of the embryo (arrows indicate examples in the back of the embryo). Additionally, a more diffuse expression is seen in the fetal liver for serglycin, but not PF4. Bars = 200 µm in A, C, D, and G

The midgestation pattern of labeling of embryos with antisense RNA probes for serglycin and PF4 is shown in Figure 1, D–H. The serglycin sense control is shown in Figure 1D. From E11.5 through E14.5 of gestation, serglycin-expressing cells are detected almost exclusively in the developing liver (see E11.5 embryo in Fig. 1E). A strikingly similar expression pattern was evident for PF4 (Fig. 1F). Closer examination of neighboring liver sections of E12.5 embryos hybridized with serglycin and PF4 probes revealed considerable overlap of signal, consistent with the presence of these proteins in megakaryocytes [44, 45] (Fig. 1, G, H, and insert H). Those regions of PF4 expression not overlapping with serglycin may be due to the thickness of neighboring sections relative to the hematopoietic cells. This hypothesis is supported by a similar degree of expression discrepancy when neighboring sections were each probed with PF4 also (data not shown). Serglycin, but not PF4, had a more diffuse expression throughout the fetal liver (compare Fig. 1, G and H). The diffuse expression of serglycin in the liver is most likely associated with the presence of definitive myeloid-lineage hematopoietic cells because serglycin has been shown to be expressed in normal leukocytes and monocytes as well as erythromegakaryocytic, megakaryocytic, and myeloid leukemia cell lines [40, 43, 46], while PF4 expression is associated specifically with megakaryopoiesis [47].

Higher magnification views demonstrated single cells with a strong hybridization signal for serglycin message scattered in the embryo proper at E12.5 (arrows in Fig. 1H). A similar expression pattern was seen with PF4 in adjacent sections. These findings are consistent with the presence of circulating megakaryocytes or platelets in the embryo at this stage of development [48].

Expression of Serglycin mRNA by Intact Deciduaeand Decidual Cells in Culture

Northern blotting of RNA from intact deciduae showed the expected serglycin mRNA at about 1.0 kb [41]. The blot showed that there was considerable expression of the serglycin mRNA in isolated whole decidual tissue between E6 and E9.5 (Fig. 2). Additional experiments showed equivalent labeling of decidual mRNA at E9.5 and E10.5 (not shown). Labeling of the blot at E12.5 was confined to a faint band at a higher molecular weight than that labeled at the earlier time points. We do not know whether this band represents an alternatively spliced transcript as has been seen in human cells. To confirm the synthesis of serglycin within decidual cells themselves, rather than the hematopoietic cells in the decidua, we prepared adherent cell cultures from decidua of the E6–E11.5 pregnant mice. From E6 to E10.5, the cultures appeared morphologically to be mesometrial decidual cells, with cuboidal flattened shapes with dendritic projections, and large nuclei or double nuclei, as described previously [3]. No hematopoietic cells were seen in these cultures. We detected serglycin mRNA in the adherent cell cultures by RT-PCR (Fig. 3) and saw the appropriate size band by Northern blotting (not shown), thus showing that the expression seen in the in situ hybridization experiments is likely to be associated at least in part with the decidual cells during this time period. However, at E11.5 little decidual tissue remained, due to regression of decidua at this stage of pregnancy. The cells that were obtained in the cultures were for the most part round, and very few decidual cells were present. Northern blotting of RNA was positive for serglycin for the E10.5 cultures but negative for the E11.5 cultures (not shown).



View larger version (113K):
[in this window]
[in a new window]
 
FIG. 2. Expression of serglycin mRNA by intact decidua. Deciduae were isolated from pregnant mice at the times indicated, and expression of serglycin was determined by Northern blotting as described in the text. The faint band at E12.5 was at higher molecular weight than the bands at earlier time points. Top panel: Ethidium bromide staining of 28S and 18S RNA. Bottom panel: Autoradiogram of blot labeled with the 32P-serglycin cDNA probe



View larger version (70K):
[in this window]
[in a new window]
 
FIG. 3. Expression of serglycin mRNA in adherent decidual cell cultures. RNA was isolated from adherent cells obtained from E7.0 decidua, and RT-PCR and agarose gel electrophoresis were performed as described in the text. The same RT reaction sample was used for PCR amplification of both actin and serglycin transcripts. Identity of the serglycin band was confirmed by DNA sequencing. The PCR products were electrophoresed on 1% agarose gels and visualized with ethidium bromide

Immunostaining of Embryos and Decidua

The immunostaining of E8.5 embryos and decidua with anti-serglycin antibody is shown in Figure 4. Intense staining of the mesometrial decidua was observed as seen in Figure 4, B and C. The higher magnification (Fig. 4C) shows a granular pattern of staining superimposed on the diffuse cytoplasmic stain. These granular structures are for the most part present near the periphery of cells. Representative immunostaining of cultured decidual cells with anti-serglycin and anti-desmin is shown in Figure 4, D and E. The filamentous staining pattern with desmin confirms the identity of the cells as decidual cells. Serglycin staining, in contrast, appears in a granular pattern, consistent with the presence of serglycin in secretory granules. Labeling also occurs in the perinuclear region and is probably associated with labeling of the Golgi and/or nascent secretory vesicles. Immunostaining of parietal endoderm is shown in Figure 4, F (nonimmune control) and G (anti-serglycin). Immunostaining of E13.5 embryos was restricted primarily to the liver, but there was scattered labeling in other areas of the embryo (not shown) that was most likely associated with blood cells. Figure 4, H through I, show higher magnification images of the staining of the liver cells with the anti-serglycin antibody. The prominent black cytoplasmic/perinuclear labeling is consistent with the presence of scattered hematopoietic cells and with the diffuse pattern of labeling throughout the liver, which was shown by in situ hybridization in Figure 1. This immunolabeling pattern was not seen in the negative control (not shown).



View larger version (140K):
[in this window]
[in a new window]
 
FIG. 4. Immunostaining of embryos, decidua, and cultured decidual cells. All panels except for D show cells immunostained with 3,3'-diaminobenzadine alone. The cell in D was stained with 3,3'-diaminobenzadine in the presence of nickel ions. All size bars represent 50 µm. A) Mesometrial decidua: nonimmune control. B) Mesometrial decidua: stained with anti-serglycin. C) Mesometrial decidua: stained with anti-serglycin. Arrows in C point to several of the numerous granules. D) Cultured decidual cell stained with anti-serglycin. E) Cultured decidual cell stained with anti-desmin. Cells were at least 75 µm in diameter. F) Parietal endoderm: nonimmune control. G) Parietal endoderm: stained with anti-serglycin. Arrows indicate the parietal endoderm. H) E13.5 fetal liver, x400 magnification. I) E13.5 fetal liver, x1000 magnification

Analysis of Synthesis and Secretion of Decidual Proteoglycans by 35S-Sulfate Labelingand Western Blotting

The spectrum of proteoglycan synthesis in the decidual cells and the degree to which decidual proteoglycans were stored in the cells and/or secreted was evaluated by metabolic labeling of the proteoglycans with 35S-sulfate. The 35S-sulfate is incorporated into the GAG chains. Ninety-one percent of the 35S-proteoglycans made by intact deciduae in culture and 78% of the proteoglycans made by the adherent decidual cell cultures were secreted during the 4-day incubation, based on the proportion of total radioactivity in each compartment. Analysis of chondroitinase and heparitinase digests on PD-10 columns showed that the GAGs from the cultured adherent decidual cell and medium proteoglycans were, respectively, 65% and 61% chondroitin sulfate, and the GAGs from the intact decidual tissue-associated and medium proteoglycans were, respectively, 73% and 63% chondroitin sulfate. The proteoglycans from both types of cultures migrated similarly as a broad peak on Sepharose CL-6B. The profile of the secreted proteoglycans from the adherent-cell cultures is shown in Figure 5. The overall peak Kav was about 0.17 for the proteoglycans associated with and secreted from the intact decidual tissue and the adherent cultures. The peak, however, was asymmetric, and shoulders were present at Kav 0.08 and 0.22, suggesting the presence of several components. Both enzymes appeared to digest proteoglycans across the entire width of the elution profile. However, chondroitinase digestion preferentially reduced the amount of radioactivity in the higher-molecular weight portion (Kav 0.08) of the Sepharose CL-6B curve, and heparitinase digestion reduced the amount of radioactivity in the Kav 0.17–0.22 portion of the curve, as judged by the shapes of the resultant elution profiles.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 5. Synthesis of 35S-labeled secreted proteoglycans by adherent decidual cells. The proteoglycans were isolated by DEAE-Sephacel chromatography as described in the text. The graph shows the Sepharose CL-6B column elution profiles of intact total proteoglycans and the profiles of the chondroitinase and heparitinase digests of the total proteoglycans from the culture medium. The Kav is the location of any point on the curve as a proportion of the distance between the void volume (Vo) and the included volume (Vt) of the column, where the Vo is 0 and Vt is 1, and reflects the relative size of the proteoglycans. Peaks remaining near the Vo after chondroitinase digestion represent heparan sulfate proteoglycans and vice versa. The peaks near the Vt represent the disaccharide and polysaccharide digestion productions

Chondroitinase digestion of the culture medium proteoglycans produced prominent core proteins at 33–36 kDa that were detected by autoradiography of the long gradient gel (Fig. 6, top), and Western blotting and autoradiographic detection of samples that were electrophoresed through the minigel and transferred to nitrocellulose (Fig. 6, bottom). There were also two lower molecular weight 35S-labeled bands that are most likely degradation products of the serglycin core but do not become labeled on the Western blots probably because the epitope has been lost from the N-terminal end by proteolysis. In one experiment we confirmed this by labeling with an antibody generated against the 21 amino acids immediately N-terminal to the ser/gly repeat region. We have seen the 35S-labeled low molecular weight bands in hematopoietic tumor cell cultures [43]. A faint core protein band at about 40 kDa would be consistent with the presence of decorin [49]. Other faint bands were not identified. The smear at the top of the autoradiogram of the gel represents the undigested heparan sulfate proteoglycans. These proteoglycans have not yet been identified.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 6. Analysis of core proteins of secreted decidual cell proteoglycans from decidual cell adherent cultures by SDS-PAGE autoradiography and Western blotting. The proteoglycans were purified by DEAE-Sephacel chromatography and digested with chondroitinase ABC to obtain the core proteins. The core proteins could be visualized by autoradiography because chondroitinase digestion leaves a hexasaccharide containing a single sulfated sugar at the attachment site of each GAG chain. A) Autoradiogram of gel (4%–15% acrylamide gradient, 20 cm long, 1.5 mm thick) after chondroitinase digestion of total proteoglycans from culture medium. B) Western blot and autoradiogram of the same blot from chondroitinase-digested total secreted proteoglycans electrophoresed through a 4%–20% acrylamide minigel

DISCUSSION

Our study has shown for the first time that serglycin is a major chondroitin sulfate proteoglycan synthesized and secreted by uterine decidual cells in intact tissue and in culture. The broad expression pattern of serglycin throughout the mesometrial portion of the decidua strongly suggested that decidual cells themselves, and not only hematopoietic cells known to be associated with decidua (large granular lymphocytes, natural killer cells, or macrophages) were responsible for serglycin synthesis. This conclusion was further strengthened by experiments with cultured adherent decidual cells derived from the decidual tissue. The cultures consisted primarily of mesometrial cells by morphologic criteria. Synthesis of serglycin by adherent cultures of decidual cells devoid of hematopoietic cells confirmed that the labeling was associated with the decidual cells themselves.

We do not yet understand the functional significance of the presence of serglycin in decidual tissue and the reason for the primary localization of mRNA expression to the mesometrial portion of this tissue. The radiolabeling studies suggested that serglycin synthesized by adherent cultured decidual cells and whole decidual tissue was directed extensively to a constitutive secretory pathway. Only a few proteins are known to be expressed predominantly in the mesometrial decidua at the stages that we have studied, and these are all secretory proteins that may have functional importance for implantation and decidualization. They include insulin-like growth factor I (IGF-I) [19], matrix metalloproteinase-2 [20], a variant of {alpha}-2 macroglobulin that binds IGF-I [24], interleukin-6 [50], macrophage inflammatory protein (MIP) 1-alpha [51], and activin ß-A [31]. Serglycin could potentially interact with any of these proteins or with others that have not been identified, to generate appropriate secretory vesicles, or to modulate the effects of these proteins on the target cells after secretion, either directly or by interacting with proteins that modulate the activity of those mentioned [25, 27, 31]; for example, follistatin, that regulates activin, binds to heparan sulfate proteoglycans [52], and inhibin binds to the betaglycan proteoglycan [53]. The ability of a proteoglycan to interact with proteins is determined by a combination of the number, type, and size, of the GAG chains and their pattern of distribution along the core protein. The importance of the overall structure of the proteoglycan is borne out by several studies in which the intact serglycin proteoglycan, but not its isolated GAG chains, was able to bind to other proteins [46, 54, 55] probably as a result of the tight clustering of the GAG chains in the serine/glycine repeat region of the core protein. The importance of the intact serglycin proteoglycan was further demonstrated by the inability of mast cells to generate normal secretory granules when synthesis of heparin, the GAG chain of mast cell serglycin, but not the core protein itself, was disrupted in vivo [56, 57]. Serglycin is known to be needed for stabilization of proteases that are packaged in these granules. Furthermore, we have shown that abnormal synthesis of chondroitin sulfate GAGs on the serglycin proteoglycan is associated with structural and functional abnormalities of platelet alpha granules in Wistar Furth hereditary macrothrombocytopenic rats [58].

The serglycin proteoglycan itself could affect cell-cell or cell-matrix interactions within the decidua or nearby placental tissues, because it is known to bind to matrix molecules such as fibronectin and collagens [46, 58, 59]. Serglycin also could affect cytokine or chemokine transport within the decidua or from the decidua to placental tissues by virtue of its ability to bind to such molecules, e.g., PF4 and MIP 1-{alpha} [60]. MIP-1 alpha has been found in mesometrial decidual cells [51].

It is interesting to compare the secretory behavior of decidual cell serglycin with that of blood cells. The trafficking of serglycin varies among the different blood cells. In mast cells, platelets, and neutrophils the proteoglycan is localized within storage granules, the protein contents of which are different for each cell type, and is released along with the granule proteins upon activation of the cells. Hematopoietic tumor cell lines appear to both store and constitutively secrete serglycin [40, 43, 46, 61]. In contrast, lymphocytes do not have regulated secretory granules but actively synthesize and constitutively secrete serglycin [40]. The presence of prominent serglycin-containing granules within decidual cells and the abundant constitutive secretion of serglycin suggest that decidua contain both regulated and constitutive secretory compartments.

In our experiments the decidua did not appear to synthesize significant amounts of the high molecular weight heparan sulfate proteoglycans such as perlecan that are necessary for the structure and function of extracellular matrix or basement membranes in a number of tissues, including the uterine epithelium during blastocyst attachment [2]. These proteoglycans would have eluted from the Sepharose CL-6B columns in the void volume. A minor peak near the void volume remained after chondroitinase digestion, suggesting that the cells could synthesize a large heparan sulfate proteoglycan, but this proteoglycan represented only a few percent of the total proteoglycan synthesis. It is interesting that most of the heparan sulfate proteoglycans were found in the culture medium, because they were of a size range that is usually associated with membrane heparan sulfate proteoglycans. However, these proteoglycans, such as syndecans, can be released from the cells by proteolytic cleavage. Identification of these proteoglycans will be the subject of future studies.

We have localized the serglycin proteoglycan to the parietal endoderm in E7–E9 embryos. The presence of serglycin in the parietal endoderm is consistent with the finding of Iozzo and Clark [62] that this membrane contains chondroitin sulfate proteoglycans. This finding is consistent with the high expression of serglycin mRNA in F9 teratocarcinoma cells that are differentiated to the parietal endoderm lineage in the presence of dibutyryl cAMP and retinoic acid [63]; we have confirmed the synthesis of serglycin in F9 cells under these conditions by immunostaining (unpublished results).

The extensive presence of serglycin in adult hematopoietic myeloid lineages [40] led us to explore at what stage of fetal hematopoiesis this proteoglycan is expressed. Serglycin transcripts were indeed detected throughout the E11.5–E14.5 liver, the site of definitive hematopoiesis in the fetus. Immunostaining of the E13.5 liver showed evidence for the presence of serglycin-containing hematopoietic cells scattered throughout this tissue. The partial colocalization of serglycin mRNA with PF4 mRNA suggests that serglycin is expressed by fetal megakaryocytes; both are expressed in adult megakaryocytes [44, 45]. No anti-mouse PF4 antibody was available for double-label immunostaining, so we could not confirm the colocalization of these two proteins in megakaryocytes. The diffuse serglycin expression throughout the fetal liver and the presence of serglycin in mature blood cells of all myeloid lineages suggests, but does not prove, that serglycin may be synthesized by multiple definitive hematopoietic lineages. In contrast, serglycin expression was not evident in the visceral yolk sac, the site of primitive hematopoiesis. Embryonic hematopoiesis in yolk sac blood islands is unique, consisting almost exclusively of nucleated primitive erythroblasts. The lack of detection of serglycin expression in the developing yolk sac blood islands and its presence in fetal liver is consistent with serglycin serving roles in definitive, but not primitive, hematopoiesis.

In conclusion, our data suggest that the serglycin proteoglycan may have critical importance for uterine decidual function, early fetal development, and fetal definitive hematopoiesis.

ACKNOWLEDGMENTS

We acknowledge Andrew Likens for preparation of the figures. We acknowledge the helpful advice of Dr. Bruce Babiarz (Rutgers University, Piscataway, NJ) in establishing the methodology for generation of the decidual cell cultures.

FOOTNOTES

First decision: 17 October 2000.

1 Grant support: USPHS grant HL29282 (B.P.S.) and USPHS grant HL 59484 (J.P.). Back

2 Correspondence: Barbara P. Schick, Thomas Jefferson University, Cardeza Foundation for Hematologic Research, Room 709, Curtis Building, 1015 Walnut Street, Philadelphia, PA 19107. FAX: 215 955 2366; barbara.schick{at}mail.tju.edu Back

Accepted: January 16, 2001.

Received: August 30, 2000.

REFERENCES

  1. Carson DD, Tang JP, Julian J. Heparan sulfate proteoglycan (perlecan) expression by mouse embryos during acquisition of attachment competence. Dev Biol 1993; 155:97–106[CrossRef][Medline]
  2. Tang J-P, Julian J, Glasser SR, Carson DD. Heparan sulfate proteoglycan synthesis and metabolism by mouse uterine epithelial cells cultured in vitro. J Biol Chem 1987; 262:12832–12842[Abstract/Free Full Text]
  3. Babiarz B, Romagnano L, Afonso S, Kurilla G. Localization and expression of fibronectin during mouse decidualization in vitro: mechanisms of cell-matrix interactions. Dev Dyn 1996; 206:330–342[CrossRef][Medline]
  4. Dziadek M, Darling P, Zhang RZ, Pan TC, Tillet E, Timple R, Chu ML. Expression of collagen alpha1(VI), alpha 2(VI), and alpha 3(VI) chains in the pregnant mouse uterus. Biol Reprod 1995; 52:885–894[Abstract]
  5. Dziadek M, Darling P, Bakker M, Overall M, Zhang RZ, Pan TC, Tillet E, Timple R, Chu ML. Deposition of collagen VI in the extracellular matrix during mouse embryogenesis correlates with expression of the alpha 3(VI) subunit gene. Exp Cell Res 1996; 226:302–315[CrossRef][Medline]
  6. Farrar JD, Carson DD. Differential temporal and spatial expression of mRNA encoding extracellular matrix components in decidua during the peri-implantation period. Biol Reprod 1992; 46:1095–1108[Abstract]
  7. Glasser SR, Lampelo S, Munir MI, Julian J. Expression of desmin, laminin, and fibronectin during in situ differentiation (decidualization) of rat uterine stromal cells. Differentiation 1987; 35:132–142[CrossRef][Medline]
  8. Michie HJ. Tenascin in pregnant and non-pregnant rat uterus: unique spatio-temporal expression during decidualization. Biol Reprod 1994; 50:1277–1286[Abstract]
  9. Wewer UM, Faber M, Liotta LA, Albrechtsen R. Immunochemical and ultrastructural assessment of the nature of the pericellular basement membrane of human decidual cells. Lab Invest 1985; 53:624–633[Medline]
  10. Wewer UM, Damjanov A, Weiss J, Liotta LA, Damjanov I. Mouse endometrial stromal cells produce basement membrane components. Differentiation 1986; 32:49–58[CrossRef][Medline]
  11. Carson DD, Julian J, Jacobs AL. Uterine stromal cell chondroitin sulfate proteoglycans bind to collagen type I and inhibit embryo outgrowth in vitro. Dev Biol 1992; 149:307–316[CrossRef][Medline]
  12. Greca CPS, Abrahamsohn PA, Zorn TMT. Ultrastructural cytochemical study of proteoglycans in the endometrium of mice using cationic dyes. Tissue Cell 1998; 30:3304–3311
  13. Jacobs AL, Carson DD. Proteoglycan synthesis and metabolism by mouse uterine stroma cultured in vitro. J Biol Chem 1991; 266:15464–15473[Abstract/Free Full Text]
  14. Slater M, Murphy CR. Chondroitin sulfate and heparan sulfate proteoglycan are sequentially expressed in the uterine extracellular matrix during early pregnancy in the rat. Matrix Biol 1999; 18:125–131[CrossRef][Medline]
  15. Afonso S, Romagnano L, Babiarz B. The expression and function of cystatin C and cathepsin L during mouse embryo implantation and placentation. Development 1997; 124:3415–3425[Abstract]
  16. Alexander CM, Hansell EJ, Behrendtsen O, Flannery ML, Kishnani NS, Hawkes SP, Werb Z. Expression and function of matrix metalloproteinases and their inhibitors at the maternal-embryonic boundary during mouse embryo implantation. Development 1996; 122:1723–1736[Abstract]
  17. Bischof P, Meisser A, Campana A, Tseng L. Effects of decidua-conditioned medium and insulin-like growth factor binding protein 1 on trophoblastic matrix metalloproteinases and their inhibitors. Placenta 1998; 19:457–464[CrossRef][Medline]
  18. Chakraborty I, Das SK, Dey SK. Differential expression of vascular endothelial growth factor and its receptor mRNAs in the mouse uterus around the time of implantation. J Endocrinol 1995; 147:339–352[Abstract/Free Full Text]
  19. Correia-da-Silva G, Bell SC, Pringle JH, Teixeira N. Expression of mRNA encoding insulin-like growth factors I and II by uterine tissues and placenta during pregnancy in the rat. Mol Reprod Dev 1999; 53:294–305[CrossRef][Medline]
  20. Das SK, Yano S, Wang J, Edwards DR, Nagase H, Dey SK. Expression of matrix metalloproteinases and tissue inhibitors of metalloproteinases in the mouse uterus during the peri-implantation period. Dev Genet 1997; 21:44–54[CrossRef][Medline]
  21. Dong YL, Fang L, Gangula PRR, Yallampalli C. Regulation of inducible nitric oxide synthase messenger ribonucleic acid expression in pregnant rat uterus. Biol Reprod 1998; 59:933–940[Abstract/Free Full Text]
  22. Giudice LC. Growth factors and growth modulators in human uterine endometrium: their potential relevance to reproductive medicine. Fertil Steril 1994; 61:1–17[Medline]
  23. Giudice LC, Mark SP, Irwin JC. Paracrine actions of insulin-like growth factors and IGF binding protein-1 in non-pregnant human endometrium and at the decidual-trophoblast interface. J Reprod Immunol 1998; 39:133–148[CrossRef][Medline]
  24. Gu Y, Jayatilak PG, Parmer TG, Gauldie J, Fey GH, Gibori G. Alpha 2-macroglobulin expression in the mesometrial decidua and its regulation by decidual luteotropin and prolactin. Endocrinology 1992; 131:1321–1328[Abstract/Free Full Text]
  25. Gu Y, Gibori G. Isolation, culture, and characterization of the two cell subpopulations forming the rat decidua: differential gene expression for activin, follistatin, and decidual prolactin-related protein. Endocrinology 1995; 136:2451–2458[Abstract]
  26. Gu Y, Srivastava RK, Clarke DL, Linzer DI, Gibori G. The decidual prolactin receptor and its regulation by decidua-derived factors. Endocrinology 1996; 137:4878–4885[Abstract]
  27. Gu Y, Srivastava RK, Ou J, Krett NL, Mayo KE, Gibori G. Cell-specific expression of activin and its two binding proteins in the rat decidua: role of alpha 2-macroglobulin and follistatin. Endocrinology 1995; 136:3815–3822[Abstract]
  28. Han VK, Hunter ES, Pratt RM, Zendegui JG, Lee DC. Expression of rat transforming growth factor alpha mRNA during development occurs predominantly in the maternal decidua. Mol Cell Biol 1987; 7:2335–2343[Abstract/Free Full Text]
  29. Kingsley PD, Whitin JC, Cohen HJ, Palis J. Developmental expression of extracellular glutathione peroxidase suggests antioxidant roles in deciduum, visceral yolk sac, and skin. Mol Reprod Dev 1998; 49:343–355[CrossRef][Medline]
  30. Leco KJ, Edwards DR, Schultz GA. Tissue inhibitor of metalloproteinases-3 is the major metalloproteinase inhibitor in the decidualizing murine uterus. Mol Reprod Dev 1996; 45:458–465[CrossRef][Medline]
  31. Manova K, Paynton BV, Bachvarova RF. Expression of activins and TGF-beta 1 and beta 2 RNAs in early postimplantation mouse embryos and uterine decidua. Mech Dev 1992; 36:141–152[CrossRef][Medline]
  32. Rasmussen CA, Hashizume K, Orwig KE, Xu L, Soares MJ. Decidual prolactin-related protein: heterologous expression and characterization. Endocrinology 1996; 137:5558–5566[Abstract]
  33. Romagnano L, Afonso S, Babiarz B. An in vitro system for the study of matrix metalloproteases during decidualization in the mouse. Biochem Cell Biol Biochim Biol Cell 1996; 74:911–919[Medline]
  34. Sharkey ME, Adler RR, Brenner CA, Nieder GL. Matrix metalloproteinase expression during mouse peri-implantation development. Am J Reprod Immunol 1996; 36:72–80
  35. Srivastava RK, Gu Y, Ayloo S, Zilberstein M, Gibori G. Developmental expression and regulation of basic fibroblast growth factor and vascular endothelial growth factor in rat decidua and in a decidual cell line. J Mol Endocrinol 1998; 21:355–362[Abstract]
  36. Oldberg A, Hayman EG, Ruoslahti E. Isolation of a chondroitin sulfate proteoglycan from a rat yolk sac tumor and immunochemical demonstration of its cell surface localization. J Biol Chem 1981; 256:10847–10852[Abstract/Free Full Text]
  37. Bourdon MA, Oldberg A, Pierschbacher M, Ruoslahti E. Molecular cloning and sequence analysis of a chondroitin sulfate proteoglycan cDNA. Proc Natl Acad Sci U S A 1985; 82:1321–1325[Abstract/Free Full Text]
  38. Bourdon MA, Shiga M, Ruoslahti E. Identification from cDNA of the precursor form of a chondroitin sulfate proteoglycan core protein. J Biol Chem 1986; 261:12534–12537[Abstract/Free Full Text]
  39. Wewer U. Characterization of a rat yolk sac carcinoma cell line. Dev Biol 1982; 93:416–421[CrossRef][Medline]
  40. Kolset SO, Gallagher JT. Proteoglycans in hematopoietic cells. Biochim Biophys Acta 1990; 1032:191–211[Medline]
  41. Avraham S, Stevens RL, Nicodemus CF, Gartner MC, Austen KF, Weis JH. Molecular cloning of a cDNA that encodes the peptide core of a mouse mast cell secretory granule proteoglycan and comparison with the analogous rat and human cDNA. Proc Natl Acad Sci U S A 1989; 86:3763–3767[Abstract/Free Full Text]
  42. Palis J, Kingsley PD. Differential gene expression during early murine yolk sac development. Mol Reprod Dev 1995; 42:19–27[CrossRef][Medline]
  43. Schick BP, Senkowski-Richardson S. Proteoglycan synthesis in human erythroleukaemia (HEL) cells. Biochem J 1992; 282:651–658
  44. Holt JC, Rabellino EM, Gewirtz AM, Gunkel LM, Rucinski B, Niewiarowski S. Occurrence of platelet basic protein, a precursor of low affinity platelet factor 4 and beta-thromboglobulin, in human platelets and megakaryocytes. Exp Hematol 1988; 16:302–306[Medline]
  45. Schick PK, Schick BP, Williams-Gartner K. Characterization of guinea pig megakaryocyte subpopulations at different phases of megakaryocyte maturation prepared with a Celsep separation system. Blood 1989; 73:1801–1808[Abstract/Free Full Text]
  46. Schick BP, Jacoby JA. Serglycin and betaglycan proteoglycans are expressed in the megakaryocytic cell line CHRF 288-11 and normal human megakaryocytes. J Cell Physiol 1995; 165:96–106[CrossRef][Medline]
  47. Ravid K, Beeler DL, Rabin MS, Ruley HE, Rosenberg RD. Selective targeting of gene products with the megakaryocyte platelet factor 4 promoter. Proc Natl Acad Sci U S A 1991; 88:1521–1525[Abstract/Free Full Text]
  48. Matsamura G, Sasaki K. The ultrastructure of megakaryopoietic cells of the yolk sac and liver in the mouse embryo. Anat Rec 1988; 222:164–169[CrossRef][Medline]
  49. Krusius T, Ruoslahti E. Primary structure of an extracellular matrix proteoglycan core protein deduced from cloned cDNA. Proc Natl Acad Sci U S A 1986; 83:7683–7687[Abstract/Free Full Text]
  50. Liang L, Kover K, Dey SK, Andrews GK. Regulation of interleukin-6 and interleukin-1 beta gene expression in the mouse deciduum. J Reprod Immunol 1996; 30:29–52[CrossRef][Medline]
  51. Dudley DJ, Spencer S, Edwin S, Mitchell MD. Regulation of human decidual cell macrophage inflammatory protein-1 alpha (MIP-1 alpha) production by inflammatory cytokines. Am J Reprod Immunol 1995; 34:231–235
  52. Hashimoto O, Nakamura T, Shoji H, Shimasaki S, Hayashi Y, Sugino H. A novel role of follistatin, an activin-binding protein, in the inhibition of activin action in rat pituitary cells. Endocytotic degradation of activin and its acceleration by follistatin associated with cell-surface heparan sulfate. J Biol Chem 1997; 272:13835–13842[Abstract/Free Full Text]
  53. Lewis KA, Gray PC, Blount AL, MacConell LA, Wiater E, Bilezikjian LM, Vale W. Betaglycan binds inhibin and can mediate functional antagonism of activin signaling. Nature 2000; 404:411–414[CrossRef][Medline]
  54. Verrechio A, Germann MW, Schick BP, Kung B, Twardowski T, San Antonio JD. Design of peptides with high affinities for heparin and endothelial cell proteoglycans. J Biol Chem 2000; 275:7701–7707[Abstract/Free Full Text]
  55. Toyama-Surimachi N, Sorimachi H, Tobita Y, Kitamura F, Yagita H, Suzuki K, Miyasaka M. A novel ligand for CD44 is serglycin, a hematopoietic cell lineage-specific proteoglycan. Possible involvement in lymphoid cell adherence and activation. J Biol Chem 1995; 270:7437–7444[Abstract/Free Full Text]
  56. Forsberg E, Pejler G, Ringvall M, Lunderius C, Tomasini-Johansson B, Kusche-Gullberg M, Eriksson I, Ledin J, Hellman L, Kjellen L. Abnormal mast cells in mice deficient in a heparin-synthesizing enzyme. Nature 1999; 400:773–776[CrossRef][Medline]
  57. Humphries DE, Wong GW, Friend DS, Gurish MF, Qiu W-T, Huang C, Sharpe AH, Stevens RL. Heparin is essential for the storage of specific granule proteases in mast cells. Nature 1999; 400:769–772[CrossRef][Medline]
  58. Schick BP, Pestina TI, San Antonio JD, Stenberg PE, Jackson CW. Decreased serglycin proteoglycan size is associated with the platelet alpha granule storage defect in Wistar Furth hereditary macrothrombocytopenic rats. Serglycin binding affinity to type I collagen is unaltered. J Cell Physiol 1997; 172:87–93[CrossRef][Medline]
  59. Brennan MJ, Oldberg A, Hayman EG, Ruoslahti E. Effect of a proteoglycan produced by rat tumor cells on their adhesion to fibronectin-collagen substrata. Cancer Res 1983; 43:4302–4307[Abstract/Free Full Text]
  60. Kolset SO, Mann DM, Uhlin-Hansen L, Winberg JO, Ruoslahti E. Serglycin-binding proteins in activated macrophages and platelets. J Leukocyte Biol 1996; 59:545–554[Abstract]
  61. Schick BP, Eras JL, Mintz PS. Phosphorothioate oligonucleotides cause degradation of secretory but not intracellular serglycin proteoglycan core protein in a sequence-independent manner in human megakaryocytic tumor cells. Antisense Res Dev 1995; 5:59–65[Medline]
  62. Iozzo RV, Clark CC. Chondroitin sulfate proteoglycan is a constituent of the basement membrane in the rat embryo parietal yolk sac. Histochemistry 1987; 88:23–29[CrossRef][Medline]
  63. Grover A, Edwards SA, Bourdon M, Adamson ED. Proteoglycan-19, laminin and collagen type IV production is correlated with the levels of mRNA in F9 cell aggregates differentiating in the presence or absence of cyclic AMP. Differentation 1987; 36:138–144[CrossRef][Medline]



This article has been cited by other articles:


Home page
BloodHome page
D. S. Woulfe, J. K. Lilliendahl, S. August, L. Rauova, M. A. Kowalska, M. Abrink, G. Pejler, J. G. White, and B. P. Schick
Serglycin proteoglycan deletion induces defects in platelet aggregation and thrombus formation in mice
Blood, April 1, 2008; 111(7): 3458 - 3467.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. D. Theocharis, C. Seidel, M. Borset, K. Dobra, V. Baykov, V. Labropoulou, I. Kanakis, E. Dalas, N. K. Karamanos, A. Sundan, et al.
Serglycin Constitutively Secreted by Myeloma Plasma Cells Is a Potent Inhibitor of Bone Mineralization in Vitro
J. Biol. Chem., November 17, 2006; 281(46): 35116 - 35128.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Futaki, Y. Hayashi, M. Yamashita, K. Yagi, H. Bono, Y. Hayashizaki, Y. Okazaki, and K. Sekiguchi
Molecular Basis of Constitutive Production of Basement Membrane Components: GENE EXPRESSION PROFILES OF ENGELBRETH-HOLM-SWARM TUMOR AND F9 EMBRYONAL CARCINOMA CELLS
J. Biol. Chem., December 12, 2003; 278(50): 50691 - 50701.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Castronuevo, M. A. Thornton, L. E. McCarthy, J. Klimas, and B. P. Schick
DNase I Hypersensitivity Patterns of the Serglycin Proteoglycan Gene in Resting and Phorbol 12-Myristate 13-Acetate-stimulated Human Erythroleukemia (HEL), CHRF 288-11, and HL-60 Cells Compared with Neutrophils and Human Umbilical Vein Endothelial Cells
J. Biol. Chem., December 5, 2003; 278(49): 48704 - 48712.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. P. Schick, I. Petrushina, K. C. Brodbeck, and P. Castronuevo
Promoter Regulatory Elements and DNase I-hypersensitive Sites Involved in Serglycin Proteoglycan Gene Expression in Human Erythroleukemia, CHRF 288-11, and HL-60 Cells
J. Biol. Chem., June 29, 2001; 276(27): 24726 - 24735.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Keith Ho, H.-C.
Right arrow Articles by Schick, B. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Keith Ho, H.-C.
Right arrow Articles by Schick, B. P.
Agricola
Right arrow Articles by Keith Ho, H.-C.
Right arrow Articles by Schick, B. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS