Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aït-Azzouzene, D.
Right arrow Articles by Kanellopoulos-Langevin, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aït-Azzouzene, D.
Right arrow Articles by Kanellopoulos-Langevin, C.
Agricola
Right arrow Articles by Aït-Azzouzene, D.
Right arrow Articles by Kanellopoulos-Langevin, C.
Biology of Reproduction 65, 337-344 (2001)
© 2001 Society for the Study of Reproduction, Inc.


Regular Article

Transgenic Major Histocompatibility Complex Class I Antigen Expressed in Mouse Trophoblast Affects Maternal Immature B Cells1

Djemel Aït-Azzouzenea, Stéphane Caucheteuxa, Françoise Tchanga, Josiane Wantyghema, René Moutiera, Anja Langkopfa, Marie-Claude Gendronb, and Colette Kanellopoulos-Langevina

a Laboratory of Immune Regulations and Development, b Department of Developmental Biology, and Flow Cytometry Unit, J. Monod Institute, UMR 7592 (CNRS and Universities Paris 6 and 7), 75251 Paris cedex 05, France

ABSTRACT

We have produced transgenic mice using the mouse placental lactogen type II promoter to force and restrict the expression of the mouse major histocompatibility complex (MHC) class I molecule, H-2Kb, to the placenta. We show that the transgenic MHC antigen H-2Kb is expressed exclusively in trophoblast giant cells from Day 10.5 until the end of gestation. This expression affects neither the fetal development nor the maternal tolerance to the fetus in histoincompatible mothers. We have used the 3.83 B cell receptor (BcR) transgenic mouse line to follow the fate of H-2Kb-specific maternal B cells in mothers bearing H-2Kb-positive placentas. Our results suggest that transgenic H-2Kb molecules on trophoblast giant cells are recognized by 3.83 BcR-transgenic B cells in the bone marrow of pregnant females. This antigen recognition triggers the deletion of a bone marrow B cell subpopulation, including immature and transitional B cells. Their percentage decreases during the second half of gestation and is down to 8% on Day 17.5, compared to 22% in the (3.83 Tg female x Fvb) control group. This deletion might contribute to the process of maternal tolerance of the conceptus.

developmental biology, embryo, gene regulation, immunology, placenta, pregnancy, trophoblast

INTRODUCTION

The paradox, first described by P. Medawar [1], of the survival and development of the fetus in its mother's genetically different body remains to be fully elucidated. The precise cellular and molecular mechanisms involved in the phenomenon are still largely unknown. Recent hypotheses favor the role of fetal-maternal interactions establishing a state of maternal nonaggression, although fetal antigens are recognized by the mother. Local phenomena at the placental level have been uncovered and range from the local production of potent immunoregulatory factors [26], immune response shifts from inflammatory/cytotoxic Th1 cells to Th2-type cells [710], to the negative regulation of expression of major histocompatibility complex (MHC) genes [1114], the establishment of an immune privilege [1517], and more recently, the upregulation of tryptophan catabolism [18] and the inhibition of complement activation [19]. Systemic events in the mother's organism include the hormonal down-regulation of T [20] and B lymphopoiesis [21, 22] in thymus and bone marrow, respectively. More recently, the modulation of fetus-specific T- or B-cell reactivity in maternal lymphoid organs has been described in T cell receptor (TcR) [23, 24] or B cell receptor (BcR)-transgenic (Tg) [25] mouse models. Thus, accumulating evidence in the literature suggests that the success of mammalian viviparity relies on the dual capacity of the fetus to escape a potentially damaging maternal immune reaction as well as to induce a state of functional tolerance in the mother's body.

While the maternal immune system must not react aggressively against the fetus as a foreign tissue, it must remain competent for defense against microbial infections. We have addressed the important question of the regulation of expression of polymorphic MHC gene products within the placenta. The MHC class Ia and II genes are defined as polymorphic because of the great number of alleles at each locus and their high frequency in a given species. The MHC class I molecules are present on the vast majority of adult tissues, and they bind peptides derived from intracellular degradation of viral, bacterial, or endogenous proteins [26]. They present these endogenous peptides on the cell surface to CD8+ T cells. The MHC class II molecules are present on monocytic/macrophage cells, dendritic cells, and B lymphocytes and bind mostly peptides derived from proteins coming from the endocytic pathway [27]. They present them to CD4+ T cells. Hence, the main function of MHC molecules is to participate in immune responses against pathogens. They also are the targets of allogeneic graft rejection, as host T cells react against allogeneic donor MHC molecules that they recognize either directly or through the presentation of allogeneic peptides by the host self-MHC molecules [28]. MHC nonclassical or class Ib molecules are less polymorphic, expressed at lower levels, and have a more restricted tissue distribution than class Ia molecules. Their high degree of homology has led to uncertainties in the distinction between MHC class Ia and class Ib molecules in particular because of antibody cross-reactivities both in murine [29] and human [30] systems.

Despite earlier controversies in the mouse and human systems, the weight of evidence in the literature appears now in favor of a lack of polymorphic MHC class Ia antigens on the surface of trophoblast cells lying in close contact with maternal blood cells [11, 12, 14, 3136]. In the mouse, some polymorphic fetal MHC class I antigens have been reported on interstitial trophoblast, mostly in the maternal decidua basalis but not on endovascular trophoblast [3739]. In the human placenta, MHC class Ia human leukocyte antigen (HLA)-A and -B appear to be absent throughout pregnancy while MHC class Ib molecules HLA-G are expressed on extravillous cytotrophoblast tissue, along with low amounts of HLA-C molecules according to some reports [4042]. HLA-G molecules have been shown to protect cells from natural killer cell-mediated lysis in vitro [43].

Previous work from our laboratory has shown that the expression of a Tg H-2Kb molecule early in development under the control of a housekeeping gene promoter leads to the loss of Tg embryos due to developmental lethality [44]. To assess directly the contribution of the negative regulation of MHC antigens in the placenta to the survival of the fetus, we have produced Tg mice expressing the mouse MHC class I molecule, H-2Kb exclusively in the placenta, on a pure Fvb (H-2q) background. For this purpose, we have placed the H-2Kb gene under the control of the mouse placental lactogen type II minimal promoter described by Shida et al. [45]. The activity of this minimal promoter is restricted, in Tg mice, to the trophoblast giant cells during the second half of gestation. Our results indicate that the forced expression of the H-2Kb molecule restricted to trophoblast giant cells does not induce a rejection or developmental failure of the fetus but may contribute to the acquisition of maternal tolerance via the antigen-specific deletion of bone marrow B cells.

MATERIALS AND METHODS

Mice

Fvb (H-2q), C57Bl/6(H-2b), (Fvb x C57Bl/6)F1 (H-2q/b), and C57Bl/10.D2, lpr/lpr (B10.D2, H-2d) mice have been bred and kept at the J. Monod Institute's facilities, according to institutional guidelines. The 3.83 BcR anti-H-2Kk,b Tg mice (on B10.D2 background) have been described previously [46] and originated from animals kindly provided by Dr. David Nemazee (Scripps Research Institute, La Jolla, CA). Animals were used between 6 and 12 wk of age.

Gene Construct

A 5.7-kilobase (kb) NruI/EcoRI genomic fragment containing the H-2Kb gene [47] without its promoter sequence was cloned into the pO1mpLII plasmid containing the mouse placental lactogen II gene minimal promoter [45] (Fig. 1). The new construct was named pmpLII-H-2Kb.



View larger version (12K):
[in this window]
[in a new window]
 
FIG. 1. Structure of the pmpLII-H-2Kb transgene construct. Cross-hatched regions represent exons; Bg, BglII restriction site; arrows, primers used in PCR (a, b) and RT-PCR (c). Probes 1 and 2 were used in Southern blot assays

Production of Tg Mice

The transgene construct was separated from bacterial vector sequences by digestion with MluI and agarose gel electrophoresis. The fragment was isolated and purified on Elutip-columns (Schleicher and Schuell, Cera-Labo, Ecquevilly, France) according to the manufacturer's recommendations.

Transgenic mice were produced by classic microinjection techniques [48]. Zygotes were obtained from superovulated Fvb female mice mated with Fvb males the night before. About 500 copies of the construct were microinjected into the male pronucleus, and eggs at the 1-cell stage were reimplanted into the infundibulum of pseudopregnant (Fvb x C57Bl/6)F1 foster mothers.

Genomic Southern Blots

DNA was isolated from tail samples taken from 2- to 3-wk-old pups. Twenty micrograms of DNA from putative Tg mice founders and non-Tg Fvb mice was digested with BglII. For the determination of the transgene copy number in each strain, 1, 5, or 10 copies of the transgene insert digested by BglII were added to 20 µg of Fvb genomic DNA. Fragments were separated by 0.8% agarose gel electrophoresis, transferred onto nylon membrane (Qiabrane, Qiagen, France), and hybridized with an {alpha}-32P-labeled probe (Fig. 1). The bands were detected and quantified on a phosphoimager.

Polymerase Chain Reaction (PCR) Assays

PCR assays were performed in a final volume of 25 µl containing 100 ng of purified genomic DNA or 10 ng of pmpLII-H-2Kb transgene DNA (as a positive control) in PCR buffer (10 mM Tris-HCl, 50 mM KCl, 1 mM MgCl2, 0.1% Triton X-100, 10% dimethylsulfoxide), 0.2 mM of dNTPs, 1 mM of each oligonucleotide primer, and 1 U of Taq DNA polymerase (Promega, Charbonnieres, France). The pmpLII-H-2Kb-specific DNA was amplified using the following primers (Fig. 1): pmpLII-specific sense primer (a), GGGGATCATCGCGAATCGCCG, located 3' of the transcription start site just before the ATG of exon I, and H-2Kb-specific anti-sense primer (b), CCCCTCCTGCTCCATCCACCG, under the following conditions: a 2-min denaturing step at 94°C followed by 30 amplification cycles of 1 min at 94°C, 1.5 min at 60°C, 1 min at 72°C, and a final elongation step at 72°C for 10 min. The expected size of the amplification product was 454 base pairs (bp). PCR products were analyzed on 2% agarose gels containing ethidium bromide (0.05 µg/ml). The actin-specific sense and anti-sense primers were GGTTCCGATGCCCTGAGGCTC and ACTTGCGGTGCACGATGGAGG, respectively. The 4311 gene is a specific marker of spongiotrophoblast [49], the primers were: sense, GCAAGAGCAGAAGGATAAAG and anti-sense, AACTTCATACTGCTGTCCA.

RNA Preparation and Reverse PCR

Nontransgenic and pmpLII-H-2Kb-Tg Fvb placentas were removed from Fvb pregnant females on Days 9.5–16.5 postcoitum (pc). Total RNA was isolated as described previously by Chomczynski et al. [50] and treated with DNAse to prevent genomic DNA contamination. Two micrograms of placental RNA were incubated for 30 sec at 90°C with a specific primer (c) ATAGTGTGAGAGCCGCC localized in the second and the third exons of H-2Kb RNA (Fig. 1). Complementary DNA was synthesized for 60 min at 42°C in a 10-µl reaction volume containing 50 mM Tris-HCl buffer (pH 8.3), 50 mM KCl, 10 mM MgCl2, 0.5 mM spermidin, 10 mM dithiothreitol, 0.5 mM dNTPs, 3 U RNAsin, and 1 U of reverse transcriptase (Promega). The pmpLII-H-2Kb transgene cDNA has been detected by PCR reaction as described above. The expected size of the amplified product was 267 bp. PCR products were analyzed on 2% agarose gels containing ethidium bromide (0.05 µg/ml). For actin, the reverse transcription (RT) primer was identical to the PCR antisense, ACTTGCGGTGCACGATGGAGG; and for 4311, the RT primer was GCTGTTTCGCTCGTTGCCTA.

Immunocytochemistry

Nontransgenic and pmpLII-H-2Kb-Tg Fvb placentas were removed from Fvb pregnant females at Days 10.5–18.5 pc and bathed in 1x PBS (pH 7.4). The placentas were fixed for 1 h at 4°C with 4% paraformaldehyde in PBS. For the detection of MHC antigens, this fixation step was omitted. Tissues were incubated sequentially in 1x PBS solutions containing 5%, 10%, and 25% sucrose, at 4°C. Placentas were covered with Cryo-M-Bed (Bright Instruments, Huntingdon, UK) and frozen in liquid nitrogen. Five-micron placenta cryosections (Bright Instruments) were placed on superfrost-plus slides and stored at -80°C. Air-dried placenta cryosections were fixed for 10 min with acetone at 4°C. Each sample was treated at room temperature for 30 min first with 1% H2O2 to block endogenous peroxidase activities, then with 1% BSA in PBS-Tween 20 (0.1%). Sections were incubated for 60 min at room temperature with the following antibodies (1x PBS, 0.1% BSA): biotin-coupled anti-H-2Kb (AF6-88.5), or anti-H-2Kq (KH114), or anti-H-2Kk (36-7-5) monoclonal antibodies (BD-Pharmingen, Le Pont de Claix, France), rabbit immune sera specific either for the mouse placental lactogen type II provided by Pr. F. Talamantes [51] or for the H-2Kb peptide encoded by exon 8 provided by Dr. B. Barber [52], followed by peroxidase-coupled goat anti-rabbit antibodies (Sigma-Aldrich St Quentin Fallavier, France). Placenta sections were then washed with PBS-BSA. Biotin-coupled antibodies were revealed by a peroxidase-coupled streptavidin (Vector, Abcys, Paris, France). Peroxidase activity was detected with 3-amino-9-ethyl-carbamazole into acetate buffer (pH 5) (AEC staining kit from Sigma). After counterstaining for 20 sec with Mayer hematoxylin solution and washes, the slides were mounted with coverslips and examined under a light microscope, equipped with a Coolsnap color charge-coupled device camera (Princeton Instruments, Evry, France) connected to a G4 MacIntosh computer (Apple, Paris, France).

Flow Cytometry Analyses

The detailed procedure has been previously described [25]. Cells were isolated from the bone marrow and spleen of individual mice and they were resuspended in staining buffer (Hanks balanced salt solution with 4% heat-inactivated fetal calf serum and 0.1% NaN3). Bone marrow cells were flushed from the long bones of hind legs of pregnant (Day 12.5–18.5 pc) 3.83 Tg mice, and spleen was gently teased on a metal sieve. Cell suspensions were submitted to red blood cell lysis, washed, and stained with the following antibodies: monoclonal antibody anti-B220 (RA3-6B2) coupled to biotin (Pharmingen), polyclonal goat anti-mouse IgM antibodies coupled to fluorescein isothiocyanate (Southern Biotechnology Associates, Birmingham, AL). Phycoerythrin-coupled streptavidin (Southern Biotechnology Associates) was used to reveal biotinylated antibodies. At least 10 000 B220-positive cells were gated from each sample and analyzed for other cell markers. All analyses were performed on an Elite-ESP from Beckman-Coulter (Roissy, France).

Statistical Analyses

Comparisons of mean values from each animal group were performed using ANOVA tests followed by posthoc comparisons of the means by Bonferonni-Dunn method, when appropriate. Alpha levels were set at 0.05 for each analysis. All analyses were performed using Statview 5.0.1 software (Abacus Concepts, Berkeley, CA) for the Macintosh.

RESULTS

Detection of pmpLII-H-2Kb-Tg Founder Mice

Three Tg founder mice were detected out of a progeny of 21 newborn animals (14%). The genomic Southern blot (Fig. 2A) revealed one extra band of 6 kb in each founder mouse. We determined that founder mouse 5001 has integrated seven copies of the transgene, founders 4001 and 3001 have integrated four and five copies, respectively (2.5 kb band in Fig. 2B). Each founder mouse was able to produce a fertile Tg progeny, thus starting three Tg mouse lines nos. 30, 40, and 50.



View larger version (69K):
[in this window]
[in a new window]
 
FIG. 2. Detection of Tg founder mice. A) Genomic Southern blot. Genomic DNA samples were digested by BglII and the blot was hybridized with probe 1, corresponding to a 686-bp fragment obtained by PCR amplification using specific primers. Fvb genomic DNA, (-); Tg pmpLII-H-2Kb plasmid insert mixed with 20 µg of non-Tg Fvb genomic DNA, (+). B) Determination of the copy number of the pmpLII-H-2Kb transgene in founder mice. The Southern blot was hybridized with probe 2 (950 bp, [64]). In lanes 1, 5, 10, 1, 5, 10 copies of the pmpLII-H-2Kb plasmid insert were mixed with 20 µg of non-Tg Fvb genomic DNA

Expression of pmpLII-H-2Kb mRNA Is Restricted to the Placenta During Embryonic Development

The expression of the pmpLII-H-2Kb mRNA was first analyzed by RT-PCR using total RNA from Tg placentas harvested at various stages of pregnancy, from crosses between Tg males and non-Tg females. Figure 3 shows a typical experiment performed on placentas from Tg line no. 40. A 267-bp fragment is specifically detected from Tg placentas from Day 10.5 to 16.5 pc. The pmpLII-H-2Kb mRNA is neither detected in Tg placentas at Day 9.5 of development nor in the fetal liver of Tg embryos of the same developmental stage (between Days 10.5 and 16.5) or in non-Tg placentas (Fig. 3). RNA extracted from 18.5-day fetal tissues such as spleen, thymus, kidney, heart, or body half gave no signal in RT-PCR assays (data not shown). The actin control indicates the quality of the various RNA preparations, while the 4311 molecule, a marker of early placental spongiotrophoblast, is detectable by RT-PCR from Day 9.5 pc. Transgenic lines 30 and 50 display the same pattern of expression (data not shown). Taken altogether our results indicate that in Tg placentas, the H-2Kb mRNA is specifically expressed during the second half of gestation.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 3. Expression of pmpLII-H-2Kb mRNA in placentas during embryonic development. The pmpLII-H-2Kb mRNA expression was analyzed by RT-PCR. Messenger RNA was isolated from placentas on Days 9.5–16.5 pc from Tg and non-Tg sibling embryos and from fetal liver (L). Actin and 4311 mRNA expressions were used as control; plasmid DNA control (C). The primers used are described in Materials and Methods. Left lane: ladder {Phi}X174 phage DNA digested by HaeIII (Roche). Amplification products have been visualized by ethidium bromide staining of the agarose gel

H-2Kb Molecule Is Expressed on Trophoblast Giant Cells

In order to determine whether the Tg H-2Kb mRNA was expressed as a protein, placenta cryosections were prepared at various stages of gestation following the mating of non-Tg Fvb females with Tg males. The results of immunochemical staining of sections from Day 18.5 pc are presented in Figure 4. Trophoblast giant cells (g) are easily detected by their typical morphology and localization, at the interface between the maternal decidua basalis (d) and the spongiotrophoblast (s). We confirmed their identification by their specific staining with a polyclonal rabbit serum raised against mouse placental lactogen type II, both in Tg (Fvb x pmpLII-Kb) and non-Tg (Fvb x Fvb) F1 placentas (Fig. 4, A and D). Monoclonal antibodies specific for conformational epitopes of the H-2Kb molecule specifically label clusters of trophoblast giant cells (Fig. 4E) but not in non-Tg placentas (Fig. 4B). Moreover, we have used polyclonal antibodies raised against a portion of the cytoplasmic tail of the H-2Kb molecule encoded in the exon 8 [52]. This reagent is not haplotype specific and can recognize unfolded H-2 molecules. Such antibodies label a wider part of the placenta, corresponding to the decidua and the giant cell layers in Tg placentas (Fig. 4F) but only the decidua in non-Tg counterpart (Fig. 4C). As expected, irrelevant control antibodies do not show any reactivity, while antibodies specific for the maternal MHC antigens stain the decidua only. Paternal or maternal MHC antigens are not detected in the trophoblast (data not shown).



View larger version (58K):
[in this window]
[in a new window]
 
FIG. 4. Expression of the H-2Kb protein on trophoblast giant cells during the second half of gestation. Placentas (Day 18.5 pc) from (Fvb x Fvb) (AC) and (Fvb x pmpLII-Kb Tg) (DF) crosses have been analyzed and compared for their reactivity with antibodies against mouse placental lactogen type II (A, D), H-2Kb (B, E), peptide encoded in exon 8 of H-2 (C, F). d, Maternal decidua basalis; g, giant cells of the trophoblast; s, spongiotrophoblast; la, labyrinthine trophoblast. Bar = 20 µm

It should be noted that this overall staining pattern for H-2Kb is detectable only in Tg line 40. The trophoblast giant cells of Tg lines 30 and 50 are not stained by anti-conformational antibodies but only by antibodies anti-exon 8-encoded peptide that recognize the unfolded H-2Kb molecules (data not shown). Subsequent experiments were carried out on Tg mouse line 40.

Expression of the Tg H-2Kb Molecule in the Placenta Does Not Interfere with Fetal Development or Survival

To determine whether the expression of the H-2Kb molecule in giant cells could induce a maternal immune rejection of Tg embryos, we have first compared the litter size and health, as well as the yield of Tg pups in the progeny of histoincompatible Fvb versus histocompatible (Fvb x C57BL/6)F1 foster mothers. The pmpLII-H-2Kb Tg founder male produced a comparably abundant progeny both from Fvb and (Fvb x C57BL/6)F1 females. The frequency of Tg newborns was similar between the two groups of females. Moreover, no augmentation in embryonic lethality, resorption number, and developmental defects or anomalies could be detected in histoincompatible gestations (data not shown). The same experiment was repeated with the following females crossed with Tg males: 1) multiparous Fvb females; 2) Fvb females hyperimmunized with C57BL/6 spleen cells prior to mating; 3) Fas-deficient (lpr/lpr) multiparous B10.D2 females. As shown in (Table 1), in every case, the litter size and the frequency of Tg newborns was not lower than control primiparous Fvb gestations that present the expected frequency of about 50%. These results demonstrate that the expression of the Tg H-2Kb molecule in the giant cells of the placenta during the second half of gestation does not induce a maternal rejection of Tg fetuses, even in a hyperimmunized mother or after several gestations. The same observations can be made when it is combined with a maternal Fas deficiency, although the mutation in the Fas death receptor should protect maternal activated cells from destruction via Fas-ligand-bearing cells in the placenta.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Expression of the H-2Kb molecule in placental giant cells does not induce a maternal immune rejection of Tg embryos

Placental Expression of the Tg H-2Kb Molecule Leads to Maternal Bone Marrow B Cell Deletion in 3.83 BcR-Tg Mothers

Previous results from our laboratory [25], using the 3.83 anti-H-2Kk,b BcR-Tg mouse model, have shown that maternal B cells specific for paternally inherited H-2Kk fetal MHC antigens are deleted from the spleen, blood, and bone marrow during the second half of gestation. This deletion significantly affects from 40% to 80% of the B220+ Tg B cells in these organs [25]. The main, but not only, target of the deletion is immature IgMhi, B220 low to intermediate (B220lo to int.) B lymphocytes, also called transitional B cells [5355].

We have used the same BcR-Tg mouse model to determine whether the H-2Kb molecules borne by Tg trophoblast giant cells could be detected by BcR-Tg maternal B cells and whether this interaction had any effect on their fate. As shown in a typical experiment presented in Figure 5A, transitional B220lo to int, IgM+ bone marrow B cells in control crosses (BcR-Tg females crossed with non-Tg Fvb males) represent 46% on Day 13.5 and 22% on Day 17.5 of gestation. This percentage is down to 15% (Day 13.5) and 5% (Day 17.5), when the BcR-Tg females have been crossed with C57/Bl6 males and bear H-2Kb-positive fetuses. This difference is statistically significant (P < 0.05). Interestingly, when BcR-Tg females were crossed with pmpLII-H-2Kb Tg males, the percentages of transitional B cells (14% and 8%) are comparable to that of the C57Bl/6 mating (no statistically significant difference between these two groups), even though the H-2Kb antigen is restricted to the giant cells of the placenta. Moreover, the amplitude of the deletions is increasing with time between Days 13.5 and 17.5 pc, comparably in both experimental crosses. Again, the differences between the pmpLII-H-2Kb Tg group and the Fvb control are highly significant (P < 0.01).



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 5. The placental expression of the Tg H-2Kb molecule leads to maternal bone marrow B cell deletion in 3.83 BcR-Tg mothers. The 3.83 Tg (H-2d) females were crossed with Fvb (H-2q), C57Bl/6 (H-2b) as controls, or pmpLII-Kb Tg (H-2q) males in the experimental group. A) Bone marrow cells from individual pregnant mice were analyzed by flow cytometry on Day 13.5 or 17.5 of gestation (upper panels). Spleen cells from the same mice have been analyzed in the same experiment on Day 17.5 of gestation (lower panels). Double-staining profiles obtained with anti-B220 and anti-surface IgM antibodies are presented in a typical staining pattern. Percentages indicated in each box have been calculated on 10 000 B220+ B cells. Profiles are representative of a typical result reproducibly obtained from individual mice from each group on a given day of pregnancy. The same experiment has been reproduced at least five times. B) The histogram bars indicate the mean percentages (±SEM) of immature B cells (in boxes) observed between Days 16.5 and 18.5 of gestation in the bone marrow or spleen from individual pregnant females. Bone marrow cells: 20 ± 4.4 in the Fvb group (blacks bars, 7 mice), 8.5 ± 1.9 in the C57Bl/6 group (white bars, 5 mice), and 9 ± 1.2 in the pmpLII-Kb Tg group (hatched bars, 11 mice). In the bone marrow, mean values are significantly different between the mpLII-Kb, the C57Bl/6, and the FvB control group, as supported by the ANOVA test performed on the three groups (groups are not comparable, P < 0.05). Post hoc comparisons (Bonferroni/Dunn) show that the differences between the C57Bl/6, and the FvB group (P < 0.05) or between mpLII-Kb Tg and FvB (P < 0.01) are significant, while the C57Bl/6 and the mpLII-Kb Tg groups do not differ significantly. Spleen cells: 15.9 ± 1.1 in the FvB group (n = 7), 14.2 ± 1 in the C57Bl/6 group (n = 5), and 15.8 ± 0.9 in the mpLII-Kb Tg group (n = 11). In the spleen analyses, mean values are not significantly different, according to the statistical tests performed (ANOVA and post hoc comparisons)

In the spleen, no significant difference is observed between the three groups, even at the level of immature IgMhi B cells (see boxes in Fig. 5A). The percentages of immature B cells in maternal bone marrow and spleen from the three different crosses, in five separate experiments, have been compiled in Figure 5B.

These results strongly suggest that the Tg H-2Kb molecules borne by trophoblast giant cells during the second half of gestation are detected by the 3.83 BcR-Tg B cells. The recognition of these antigens results in the deletion of tolerance-sensitive transitional B cells in the bone marrow. No B cell deletion is observed in 3.83 Tg females crossed with pmpLII-H-2Kb Tg males from lines 30 or 50 that do not express detectable levels of native H-2Kb molecules.

DISCUSSION

Evolution probably selected a large number of mechanisms contributing to successful viviparity and therefore to the survival of mammalian species. The identification of these mechanisms is made difficult by the large number and pleiotropic activities of the contributing agents. The present work addressed the longstanding question of the role of the negative regulation of polymorphic MHC molecules in the mouse placenta. We have produced Tg mice for an MHC class I molecule, H-2Kb, placed under the control of the minimal promoter of the mouse placental lactogen type II. We have shown that, at the mRNA level, the transgene is expressed only in the placenta, from Day 10.5 pc till the end of gestation. Several reports in the literature have indicated that giant cells, sitting close to maternal decidual cells, do not express polymorphic MHC class I or II antigens at any time during pregnancy. Our results are in complete agreement, as we have observed no specific staining on trophoblast cells with antibodies against paternal or maternal MHC antigens, while maternal MHC antigens could be easily revealed on decidual cells. One group has proposed that the lack of MHC expression on giant cells is due to the absence of ß2-microglobulin [33, 34]. Our data indicate that giant cells can express MHC class I molecules when provided with the Tg mRNA for the MHC class I {alpha} chain. Giant cells could be stained by polyclonal rabbit antibodies specific for the peptide encoded in exon 8 of H-2 molecules. This reagent binds the cytoplasmic tail of H-2 molecules, even when not properly folded. The amount of available ß2-microglobulin and/or stabilizing peptide could be a limiting parameter for the expression of properly folded H-2Kb molecules. We do not know at present whether the ß2-microglobulin comes from the giant cells themselves, other neighboring cells, or maternal or fetal blood. Likewise, the origin of the stabilizing peptide(s) is not known, as little if any information is available on the antigen presentation capacity of giant cells.

In spite of this expression of MHC molecules on the placenta, no perturbation could be detected in fetal development or survival, even in multiparous females. Similarly, no counterselection of Tg embryos was observed after hyperimmunization of histoincompatible mothers with H-2Kb-bearing cells. Previous reports in the literature [15, 5658] have shown that the placenta can be an immune-privileged site like the eye or testis, as Fas-ligand-bearing placental cells are able to trigger apoptosis of maternally activated cells expressing elevated levels of the Fas death receptor. We have analyzed the reaction of female mice that lacked a functional Fas receptor and found no difference in the average litter size or frequency of Tg pups.

Our results are in agreement with the study by Rogers et al. [59] who have produced Tg mice expressing the H-2Ld molecule in giant cells of the trophoblast under the control of the same promoter as in the present work. They did not observe any adverse effect on pregnancy outcome. However, the Ld-Tg mouse line has been backcrossed to Balb/c (H-2d) animals so that all experimental gestations involve paternal H-2Ld-expressing fetuses as well as Tg H-2Ld-expressing placentas. Three other reports in the literature have described different Tg mouse models where Tg MHC class I molecules have been expressed in the placenta, with conflicting results. Only one of them [60] describes a counterselection of Tg embryos, expressing the H-2Dd molecule under the control of the c-fos promoter, but both in MHC-compatible and -incompatible pregnancies. The two other works report no effect of the transgene expression on pregnancy outcome [61, 62].

In our system, no H-2Kb is present in Tg fetuses and the female/male combination can be made completely syngeneic (Fvb x Fvb) so that the only antigenic difference comes from the placenta. Under this strictly controlled experimental setup, we show that the maintenance of maternal tolerance is not due to a lack of alloantigen recognition or ignorance, as flow cytometry analyses in the 3.83 BcR-Tg model bring the definite proof that maternal bone marrow B cells are specifically affected by the H-2Kb placental antigens.

Two groups have studied the influence of Tg placental alloantigens on TcR-Tg maternal T cells, with different outcomes. Rather surprisingly, in the system described by Zhou et al. [62], the H-2Kb molecule under the control of the HLA-G promoter leads to an expanded cohort of BM3 TcR-Tg anti-H-2Kb CD8+ T cells in the spleen and draining lymph nodes of the mother. In contrast, Rogers et al. [59] did not see any consequence of the Ld transgene expression on 2C TcR-Tg anti-Ld maternal T cells in lymph nodes. We present evidence for a specific signalling to maternal bone marrow B lymphocytes. Our results show that the amount of specific bone marrow B cell deletion caused by placental antigens is comparable to what is observed in a (3.83 BcR-Tg female x C57Bl/6 male) cross where H-2Kb antigens come from F1 fetuses. The kinetics of these phenomena appear remarkably parallel. Whether the same route and mechanisms take place in both cases remains to be determined. It should be noted that such a deletion does not occur in crosses of 3.83 BcR-Tg females with Tg males from pmpLII-Kb Tg lines 30 or 50 that do not express properly folded H-2Kb molecules in the placenta.

In keeping with our previous observations on (3.83 BcR-Tg female x B10.BR [H-2k] male) crosses [25], this antigen-specific deletion is superimposed with the downregulation of B lymphopoiesis due to gestational estrogens, previously reported by Medina et al. [21]. The main target of the antigen-specific deletion appears to be a transitional B220lo to int, IgMhi bone marrow B cell. This particular population of immature B cells has been shown to be a major target for negative selection and tolerance acquisition events during normal B cell development, eliminating self-reactive lymphocytes in this particular developmental phase when they are highly sensitive to tolerance acquisition signals. The physiological role of such a deletion during pregnancy would be to deplete the pool of newly made maternal bone-marrow B cells from potentially harmful ones toward the fetus. In 3.83 Tg nonpregnant female mice, these immature B cells are abundant in bone marrow (about two thirds of B220+ cells) and represent a minor subpopulation in the spleen (less than 5%, our unpublished results).

Our previous results [25] on B10.BR (H-2k) crosses showed that more mature peripheral splenic BcR-Tg B cells could also be a target for the H-2Kk antigen-specific deletion, while our present data show that they are not significantly affected by the placental or fetal H-2Kb antigens. This difference is likely to result from the much lower affinity of the 3.83 Tg BcR for H-2Kb than for H-2Kk antigens, leading to different signalling capacities to Tg B cells. As previously reported in the same Tg model, altering the frequency of antigen-bearing cells within the same mouse has different consequences on the B cell fate [63]. The weaker, lower-affinity interactions of the H-2Kb antigens with the Tg BcR affect the most tolerance acquisition-sensitive B cell populations, i.e., the transitional B lymphocytes that are numerous in the bone marrow. The amplitude of the bone marrow deletion increases with time during the second half of gestation. Most probably, this is the result of an increase in antigen source as the number of trophoblast giant cells increases as well as the activity of the mpLII promoter. The migration of some giant cell clusters to the labyrinthine zone of the trophoblast around Day 15 pc could also facilitate the recognition of the Tg MHC antigens by maternal cells in blood lacunae that are abundant in this area of the placenta.

In conclusion, this is the first report of the consequences, on maternal B lymphocytes, of Tg MHC antigens expressed in placental giant cells only. Although the pregnancy outcome is not compromised, our data provide evidence of signalling to maternal-specific B cell precursors in the bone marrow, thus possibly contributing to fetal development in the absence of maternal aggression.

ACKNOWLEDGMENTS

The authors are indebted to Drs. David Nemazee, Brian Barber, and Pr. Frank Talamantes for the supply of mice or antibodies. They also thank Drs. Pierre Bobé, Gilles Bénichou, and Pr. Pierre Sanchez for critically reading the manuscript and Myriam Barre for her help with figures. They gratefully acknowledge the collaboration of Sébastien Paturance and his staff for excellent animal care and technical support from Gérard Lefèvre and Michel Thomas.

FOOTNOTES

First decision: 16 February 2001.

1 This work has been supported in part by INSERM, the Association pour la Recherche contre le Cancer (ARC) and the Fondation pour la Recherche Médicale. D.A.-A. received a fellowship from the Fondation pour la Recherche Médicale and A.L. was supported by the European Community. Back

2 Correspondence: Colette Kanellopoulos-Langevin, Laboratory of Immune Regulations and Development, J. Monod Institute, Tour 43, 2 place Jussieu, 75251 Paris cedex 05, France. FAX: 331 44275265; kanellopoulos{at}ijm.jussieu.fr Back

3 Current address: Scripps Research Institute, La Jolla, CA 92037. Back

4 Current address: Applied Biosystems, Grundstrasse 10, CH-6343 Rotkreuz, Switzerland. Back

Accepted: March 8, 2001.

Received: January 17, 2001.

REFERENCES

  1. Medawar PB. Some immunological and endocrinological problems raised by the evolution of viviparity in vertebrates. Symp Soc Exp Biol 1953; 44:320-338
  2. Bobe P, Kanellopoulos-Langevin C, Bleux C, Voisin GA. Modulation of mouse anti-SRBC antibody responses by placental extracts. II. Antigen specificity and regulatory role of B and T cell populations affected by two distinct placental fractions. J Immunol 1986; 136:574-581[Abstract]
  3. Altman DJ, Schneider SL, Thompson DA, Cheng HL, Tomasi TB. A transforming growth factor beta 2 (TGF-beta 2)-like immunosuppressive factor in amniotic fluid and localization of TGF-beta 2 mRNA in the pregnant uterus. J Exp Med 1990; 172:1391-1401[Abstract/Free Full Text]
  4. Clark DA, Flanders KC, Banwatt D, Millar-Book W, Manuel J, Stedronska-Clark J, Rowley B. Murine pregnancy decidua produces a unique immunosuppressive molecule related to transforming growth factor beta-2. J Immunol 1990; 144:3008-3014[Abstract]
  5. Howard M, O'Garra A, Ishida H, de Waal Malefyt R, de Vries J. Biological properties of interleukin 10. J Clin Immunol 1992; 12:239-247[CrossRef][Medline]
  6. Bleux C, Bobe P, Kanellopoulos-Langevin C. A mouse placental immunoregulatory factor different from transforming growth factor beta. J Interferon Cytokine Res 1995; 15:351-357[Medline]
  7. Lin H, Mosmann TR, Guilbert L, Tuntipopipat S, Wegmann TG. Synthesis of T helper 2-type cytokines at the maternal-fetal interface. J Immunol 1993; 151:4562-4573[Abstract]
  8. Wegmann TG, Lin H, Guilbert L, Mosmann TR. Bidirectional cytokine interactions in the maternal-fetal relationship: is successful pregnancy a TH2 phenomenon?. Immunol Today 1993; 14:353-356[CrossRef][Medline]
  9. Krishnan L, Guilbert LJ, Wegmann TG, Belosevic M, Mosmann TR. T helper 1 response against Leishmania major in pregnant C57BL/6 mice increases implantation failure and fetal resorptions. Correlation with increased IFN-gamma and TNF and reduced IL-10 production by placental cells. J Immunol 1996; 156:653-662[Abstract]
  10. Krishnan L, Guilbert LJ, Russell AS, Wegmann TG, Mosmann TR, Belosevic M. Pregnancy impairs resistance of C57BL/6 mice to Leishmania major infection and causes decreased antigen-specific IFN-gamma response and increased production of T helper 2 cytokines. J Immunol 1996; 156:644-652[Abstract]
  11. Hunt JS, Andrews GK, Wood GW. Normal trophoblasts resist induction of class I HLA. J Immunol 1987; 138:2481-2487[Abstract]
  12. Oudejans CB, Krimpenfort P, Ploegh HL, Meijer CJ. Lack of expression of HLA-B27 gene in transgenic mouse trophoblast. Conserved genetic pressures underlying extra-embryonic development. J Exp Med 1989; 169:447-456[Abstract/Free Full Text]
  13. David-Watine B, Israel A, Kourilsky P. The regulation and expression of MHC class I genes. Immunol Today 1990; 11:286-292[CrossRef][Medline]
  14. Hunt JS, Orr HT. HLA and maternal-fetal recognition. FASEB J 1992; 6:2344-2348[Abstract]
  15. Hunt JS, Vassmer D, Ferguson TA, Miller L. Fas ligand is positioned in mouse uterus and placenta to prevent trafficking of activated leukocytes between the mother and the conceptus. J Immunol 1997; 158:4122-4128[Abstract]
  16. Mor G, Gutierrez LS, Eliza M, Kahyaoglu F, Arici A. Fas-fas ligand system-induced apoptosis in human placenta and gestational trophoblastic disease. Am J Reprod Immunol 1998; 40:89-94
  17. Phillips TA, Ni J, Pan G, Ruben SM, Wei YF, Pace JL, Hunt JS. TRAIL (Apo-2L) and TRAIL receptors in human placentas: implications for immune privilege. J Immunol 1999; 162:6053-6059[Abstract/Free Full Text]
  18. Munn DH, Zhou M, Attwood JT, Bondarev I, Conway SJ, Marshall B, Brown C, Mellor AL. Prevention of allogeneic fetal rejection by tryptophan catabolism. Science 1998; 281:1191-1193[Abstract/Free Full Text]
  19. Xu C, Mao D, Holers VM, Palanca B, Cheng AM, Molina H. A critical role for murine complement regulator crry in fetomaternal tolerance. Science 2000; 287:498-501[Abstract/Free Full Text]
  20. Clarke AG, Kendall MD. The thymus in pregnancy: the interplay of neural, endocrine and immune influences. Immunol Today 1994; 15:545-551[CrossRef][Medline]
  21. Medina KL, Smithson G, Kincade PW. Suppression of B lymphopoiesis during normal pregnancy. J Exp Med 1993; 178:1507-1515[Abstract/Free Full Text]
  22. Medina KL, Strasser A, Kincade PW. Estrogen influences the differentiation, proliferation, and survival of early B-lineage precursors. Blood 2000; 95:2059-2067[Abstract/Free Full Text]
  23. Tafuri A, Alferink J, Moller P, Hammerling GJ, Arnold B. T cell awareness of paternal alloantigens during pregnancy. Science 1995; 270:630-633[Abstract/Free Full Text]
  24. Jiang SP, Vacchio MS. Multiple mechanisms of peripheral T cell tolerance to the fetal "allograft". J Immunol 1998; 160:3086-3090[Abstract/Free Full Text]
  25. Ait-Azzouzene D, Gendron MC, Houdayer M, Langkopf A, Burki K, Nemazee D, Kanellopoulos-Langevin C. Maternal B lymphocytes specific for paternal histocompatibility antigens are partially deleted during pregnancy. J Immunol 1998; 161:2677-2683[Abstract/Free Full Text]
  26. Pamer E, Cresswell P. Mechanisms of MHC class I-restricted antigen processing. Annu Rev Immunol 1998; 16:323-358[CrossRef][Medline]
  27. Cresswell P. Assembly, transport, and function of MHC class II molecules. Annu Rev Immunol 1994; 12:259-293[CrossRef][Medline]
  28. Benichou G, Takizawa PA, Olson CA, McMillan M, Sercarz EE. Donor major histocompatibility complex (MHC) peptides are presented by recipient MHC molecules during graft rejection. J Exp Med 1992; 175:305-308[Abstract/Free Full Text]
  29. Sharrow SO, Flaherty L, Sachs DH. Serologic cross-reactivity between Class I MHC molecules and an H-2- linked differentiation antigen as detected by monoclonal antibodies. J Exp Med 1984; 159:21-40[Abstract/Free Full Text]
  30. Sernee MF, Ploegh HL, Schust DJ. Why certain antibodies cross-react with HLA-A and HLA-G: epitope mapping of two common MHC class I reagents. Mol Immunol 1998; 35:177-188[CrossRef][Medline]
  31. Morello D, Duprey P, Israel A, Babinet C. Asynchronous regulation of mouse H-2D and beta-2 microglobulin RNA transcripts. Immunogenetics 1985; 22:441-452[CrossRef][Medline]
  32. David-Watine B , Expression of major histocompatibility antigens on fetal and placental cells. In: Raton B (ed.), The Immunology of the Fetus. Boca Raton, FL: CRC Press; 1990: 53–74
  33. Jaffe L, Jeannotte L, Bikoff EK, Robertson EJ. Analysis of beta 2-microglobulin gene expression in the developing mouse embryo and placenta. J Immunol 1990; 145:3474-3482[Abstract]
  34. Jaffe L, Robertson EJ, Bikoff EK. Distinct patterns of expression of MHC class I and beta 2-microglobulin transcripts at early stages of mouse development. J Immunol 1991; 147:2740-2749[Abstract/Free Full Text]
  35. Drezen JM, Nouvel P, Babinet C, Morello D. Different regulation of class I gene expression in the adult mouse and during development. J Immunol 1992; 149:429-437[Abstract]
  36. Coady MA, Mandapati D, Arunachalam B, Jensen K, Maher SE, Bothwell AL, Hammond GL. Dominant negative suppression of major histocompatibility complex genes occurs in trophoblasts. Transplantation 1999; 67:1461-1467[CrossRef][Medline]
  37. Billington WD, Bell SC. Fetal histocompatibility antigens and maternal immune responses. Ciba Found Symp 1983; 96:69-88[Medline]
  38. Bell SC, Billington WD. Humoral immune responses in murine pregnancy. V. Relationship to the differential immunogenicity of placental and fetal tissues. J Reprod Immunol 1986; 9:289-302[CrossRef][Medline]
  39. Redline RW, Lu CY. Localization of fetal major histocompatibility complex antigens and maternal leukocytes in murine placenta. Implications for maternal-fetal immunological relationship. Lab Invest 1989; 61:27-36[Medline]
  40. Bulmer JN, Johnson PM. Antigen expression by trophoblast populations in the human placenta and their possible immunobiological relevance. Placenta 1985; 6:127-140[CrossRef][Medline]
  41. Shorter SC, Starkey PM, Ferry BL, Clover LM, Sargent IL, Redman CW. Antigenic heterogeneity of human cytotrophoblast and evidence for the transient expression of MHC class I antigens distinct from HLA-G. Placenta 1993; 14:571-582[CrossRef][Medline]
  42. Proll J, Blaschitz A, Hutter H, Dohr G. First trimester human endovascular trophoblast cells express both HLA-C and HLA-G. Am J Reprod Immunol 1999; 42:30-36
  43. Le Bouteiller P, Solier C, Proll J, Aguerre-Girr M, Fournel S, Lenfant F. Placental HLA-G protein expression in vivo: where and what for?. Hum Reprod Update 1999; 5:223-233[Abstract/Free Full Text]
  44. Ait-Azzouzene D, Langkopf A, Cohen J, Bleux C, Gendron MC, Kanellopoulos-Langevin C. Selective loss of mouse embryos due to the expression of transgenic major histocompatibility class I molecules early in embryogenesis. Mol Reprod Dev 1998; 50:35-44[CrossRef][Medline]
  45. Shida MM, Jackson-Grusby LL, Ross SR, Linzer DI. Placental-specific expression from the mouse placental lactogen II gene promoter. Proc Natl Acad Sci U S A 1992; 89:3864-3868[Abstract/Free Full Text]
  46. Russell DM, Dembic Z, Morahan G, Miller JF, Burki K, Nemazee D. Peripheral deletion of self-reactive B cells. Nature 1991; 354:308-311[CrossRef][Medline]
  47. Weiss E, Golden L, Zakut R, Mellor A, Fahrner K, Kvist S, Flavell RA. The DNA sequence of the H-2Kb gene: evidence for gene conversion as a mechanism for the generation of polymorphism in histocompatibility antigens. EMBO J 1983; 2:453-462[Medline]
  48. Hogan B, Beddington R, Costantini F, Lacy E. Manipulating the Mouse Embryo, a Laboratory Manual. New York: Cold Spring Harbor Laboratory Press; 1994
  49. Calzonetti T, Stevenson L, Rossant J. A novel regulatory region is required for trophoblast-specific transcription in transgenic mice. Dev Biol 1995; 171:615-626[CrossRef][Medline]
  50. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162:156-159[Medline]
  51. Hall J, Talamantes F. Immunocytochemical localization of mouse placental lactogen in the mouse placenta. J Histochem Cytochem 1984; 32:379-382[Abstract]
  52. Smith MH, Barber BH. The conformational flexibility of class I H-2 molecules as revealed by anti-peptide antibodies specific for intracytoplasmic determinants: differential reactivity of beta 2-microglobulin "bound" and "free" H-2Kb heavy chains. Mol Immunol 1990; 27:169-180[CrossRef][Medline]
  53. Allman DM, Ferguson SE, Cancro MP. Peripheral B cell maturation. I. Immature peripheral B cells in adults are heat-stable antigenhi and exhibit unique signaling characteristics. J Immunol 1992; 149:2533-2540[Abstract]
  54. Allman DM, Ferguson SE, Lentz VM, Cancro MP. Peripheral B cell maturation. II. Heat-stable antigen(hi) splenic B cells are an immature developmental intermediate in the production of long-lived marrow-derived B cells. J Immunol 1993; 151:4431-4444[Abstract]
  55. Rolink AG, Andersson J, Melchers F. Characterization of immature B cells by a novel monoclonal antibody, by turnover and by mitogen reactivity. Eur J Immunol 1998; 28:3738-3748[CrossRef][Medline]
  56. Hammer A, Blaschitz A, Daxbock C, Walcher W, Dohr G. Fas and Fas-ligand are expressed in the uteroplacental unit of first-trimester pregnancy. Am J Reprod Immunol 1999; 41:41-51
  57. Guller S, LaChapelle L. The role of placental Fas ligand in maintaining immune privilege at maternal-fetal interfaces. Semin Reprod Endocrinol 1999; 17:39-44[Medline]
  58. Kauma SW, Huff TF, Hayes N, Nilkaeo A. Placental Fas ligand expression is a mechanism for maternal immune tolerance to the fetus. J Clin Endocrinol Metab 1999; 84:2188-2194[Abstract/Free Full Text]
  59. Rogers AM, Boime I, Connolly J, Cook JR, Russell JH. Maternal-fetal tolerance is maintained despite transgene-driven trophoblast expression of MHC class I, and defects in Fas and its ligand. Eur J Immunol 1998; 28:3479-3487[CrossRef][Medline]
  60. Voland JR, Becker C, Hooshmand F. Overexpression of class I MHC in murine trophoblast and increased rates of spontaneous abortion. In: Hunt JS (ed.), Immunobiology of Reproduction, 2nd ed. New York: Springer-Verlag; 1994: 214–260
  61. Shomer B, Toder V, Egorov I, Ehrlich R. Expression of allogeneic MHC class I antigens by transgenic mouse trophoblast does not interfere with the normal course of pregnancy. Transgenic Res 1998; 7:343-355[CrossRef][Medline]
  62. Zhou M, Mellor AL. Expanded cohorts of maternal CD8+ T-cells specific for paternal MHC class I accumulate during pregnancy. J Reprod Immunol 1998; 40:47-62[CrossRef][Medline]
  63. Lang J, Nemazee D. B cell clonal elimination induced by membrane-bound self-antigen may require repeated antigen encounter or cell competition. Eur J Immunol 2000; 30:689-696[CrossRef][Medline]
  64. Delarbre C, Morita T, Kourilsky P, Gachelin G. Evolution within the multigene family coding for the class I histocompatibility antigens: the case of the mouse t-haplotypes. Ann Inst Pasteur Immunol 1985; 136C:51-70



This article has been cited by other articles:


Home page
Int ImmunolHome page
S. M. Caucheteux, C. Vernochet, J. Wantyghem, M.-C. Gendron, and C. Kanellopoulos-Langevin
Tolerance induction to self-MHC antigens in fetal and neonatal mouse B cells
Int. Immunol., January 1, 2008; 20(1): 11 - 20.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. Li, L. Ma, J. Shen, and A. S. Chong
Peripheral deletion of mature alloreactive B cells induced by costimulation blockade
PNAS, July 17, 2007; 104(29): 12093 - 12098.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. Guleria and M. H. Sayegh
Maternal Acceptance of the Fetus: True Human Tolerance
J. Immunol., March 15, 2007; 178(6): 3345 - 3351.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S. M. Caucheteux, M.-C. Gendron, and C. Kanellopoulos-Langevin
Pregnancy-induced alterations of B cell maturation and survival are differentially affected by Fas and Bcl-2, independently of BcR expression
Int. Immunol., January 1, 2005; 17(1): 55 - 63.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aït-Azzouzene, D.
Right arrow Articles by Kanellopoulos-Langevin, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aït-Azzouzene, D.
Right arrow Articles by Kanellopoulos-Langevin, C.
Agricola
Right arrow Articles by Aït-Azzouzene, D.
Right arrow Articles by Kanellopoulos-Langevin, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS