| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Regular Article |
a The Molecular Reproduction Research Laboratory, Clinical Research Institute of Montreal, Montreal, Quebec, Canada H2W 1R7
b Department of Anatomy and Cell Biology, McGill University, Montreal, Quebec, Canada H3A 2B2
ABSTRACT
In the highly organized and complex process of mammalian spermatogenesis, the development of an undifferentiated diploid germ cell into a fully differentiated and mature spermatozoon is orchestrated in a time frame unique for each species including man. If the various hormonal signals including environmental cues that play a critical part in initiating these events are not properly executed, various deficiencies including delay in sexual maturity or puberty are likely. In this study we have followed testicular development and spermatogenesis in the FSH receptor knockout (FORKO) mice from Day 7 onward by using histology and quantitative DNA flow cytometry. The drastic reduction in testicular weight and shrinkage of seminiferous tubules that occurred at this early age persisted into the adult stage in the FORKOs, suggesting inhibition of the initial developmental processes. The round spermatids that were clearly abundant on Day 21 in the wild-type and heterozygous males were few and present only in some tubules of the FORKOs. There were no elongated spermatids in FORKO males on Day 35. The sperm produced by Day 49 FORKOs were already aberrant, a feature that persisted into adulthood in these animals. As all these changes occurred in a background of normal circulating testosterone levels, we may conclude that the delay in testicular development is a consequence of the loss of FSH-receptor signaling. The delay in sexual maturity of FORKOs was accompanied by reduction in fertility as evidenced by mating studies. Based on these data we suggest that the FORKO mouse might be a useful experimental model to define the molecular mechanisms that underlie the delay in puberty.
follicle-stimulating hormone receptor, male reproductive tract, male sexual function, Sertoli cells, spermatogenesis
INTRODUCTION
The term puberty in mammals, including man, may be defined as the period of time characterized by a cascade of morphological, physiological, and behavioral sequelae of increased gonadal activity [1]. This major developmental phase usually occurs in normal individuals within a specified time window. Any constitutional delay in the development of secondary sexual characteristics leads to major psychological problems in humans and statistical records show that 3% of the males suffer from this disorder [2]. Although the changes that occur during puberty in these individuals with constitutional delay are normal, they are postponed to an older age due to temporal aberrations of prolongation of some phases. Despite the large body of data available on the constitutional delay of puberty in males, it has been difficult to define the neural, anatomical, physiological, or biochemical correlates that cause the delay [3]. Gonadotropin releasing hormone or gonadotropin deficiency [4, 5], growth hormone (GH) deficiency [6], androgen deficiency [7], and chronic renal failure [8] are listed as some of the possible reasons for the constitutional delay in puberty exhibited by adolescent boys.
Although the nonhuman primate might be the closest experimental model in understanding this problem, it has not been possible to pinpoint the beginning or the ending of puberty in monkeys with any degree of accuracy [1]. In addition, a clear definition of the endocrine or other mechanisms during progression to puberty in these animals remains inadequate. With respect to other laboratory animals, one may consider the utility of the GnRH mutant male mice (hpg) that are infertile [9]. In these animals, the selective supplementation of physiological levels and/or patterns of both pituitary gonadotropins, preferably homologous, from the day of birth and continuing for several weeks poses practical problems [10]. Although delayed puberty [11] has been reported in the GH-deficient mouse, the conclusions are based solely on observations of sexual behavior. However, as no changes have been observed in the hormonal profiles or first wave of spermatogenesis of GH-deficient rats [12], the role of GH alone in sexual maturity in rodents remains questionable. Neutralizing FSH selectively by passive immunization in neonatal male rats resulted in a significant decrease in the absolute number of germ cells [13].
We have recently produced the FSH receptor knockout (FORKO) mouse to study the role of FSH receptor (FSH-R) signaling on male and female reproductive systems [14–16]. Although the FORKO females are infertile, the adult mutant males show reduced fertility that is associated with dramatic decrease in testis size. These male mutants also exhibit qualitative and quantitative decline in sperm production, indicating the role of FSH-R signaling in the maintenance of normal levels of spermatogenesis [15]. Although, the regulatory role of FSH on the initiation of spermatogenesis in the rodents has been reported [13], there are no studies that show any delay in sexual maturity of males in the complete absence of FSH-R signaling. Therefore, the primary objective of this investigation was to study systematically the pattern of the first wave of spermatogenesis as a function of sexual maturity from Day 7 to adulthood in the FORKO males and compare the results with wild-type and heterozygous males. We have found that there is a consistent delay in spermatogenesis as well as in the fertilizing ability of FORKO males as they mature. This is the first report of a gonadotropin receptor-dependent delay in sexual maturity in an animal model. We believe that these data might be of interest in pinpointing or exploring the precise involvement of genes participating in these critical developmental processes.
MATERIALS AND METHODS
Materials
The following reagents were procured from Sigma (St. Louis, MO): Nonidet-P40, pepsin, propidium iodide (PI), RNase, Dulbecco PBS (DPBS), and murine leukemia virus reverse transcriptase (MLV-RT) was from Gibco (Grand Island, NY). Testosterone antibody, kindly supplied by Dr. A.J. Rao (Indian Institute of Science, Bangalore, India), was used for the RIA. Total RNA isolation kit (RNAqueous-MiDi) was purchased from Ambion Inc. (Austin, TX). Oligonucleotides were synthesized by BioCarb Inc. (Montreal, QC, Canada). A Tissue Tearor homogenizer model 985-370 (Biospec Products Inc., Racine, WI) was used for homogenization. A Carl Zeiss microscope (Thornwood, NY) and Coulter Flow cytometer EPICS XL (Miami, FL) were used in our morphological and quantitative analyses. All other chemicals were of the highest grade available from commercial suppliers.
Animals
This study was approved by the Animal Ethics Committee of the Institute.
The generation of mice with targeted disruption of the FSH-R has been recently described [14]. This alteration results in the elimination of the entire repertoire of FSH-R forms producing a complete loss of hormone signaling. Breeding F2 heterozygous males and females produced mice of all three genotypes in the CSV129 background. The animals were maintained under well-controlled conditions of temperature (22°C), light (12L:12D), and humidity with food and water provided ad libitum. Beginning on Day 21 after birth and continuing at weekly intervals to Day 84, groups of male mice were killed. Blood was collected by cardiac puncture using a syringe, and transferred to tubes precoated with EDTA. Testes and epididymides were removed and weighed and tail snips taken for genotype determination. A dissection microscope aided the collection of the samples from 7- to 21-day-old animals. All the samples were coded and the littermates were genotyped by polymerase chain reaction (PCR) using DNA extracted from the tailpiece [16]. The primers and amplification conditions used for the multiplex PCR have been described in detail elsewhere [16]. Thus, a single PCR performed on each sample allowed unambiguous identification of +/+, +/-, and -/- mice. A minimum of six animals per genotype was used for all experiments.
Testosterone RIA
Serum testosterone was measured by RIA following solvent extraction using procedures standardized in the laboratory [17]. The sensitivity of the assay was 20 pg/tube. The inter- and intra-assay variations were found to be 6% and 10%, respectively. As sample volume was limited for some mice on Day 7 and Day 14, they were pooled in respective groups for final analysis. In these cases collection of four groups of three animals was analyzed.
Histological Examination
One testis from four to six animals per group was subjected to histological examination at selected ages from Day 7. This was performed according to procedures described recently [15], except that the fixative was not injected into the testis of these immature mice. The testis and epididymis were first fixed in the Bouin solution for 48 h at 4°C. The tissues were then gradually dehydrated and finally fixed in 70% ethanol at room temperature for 3 days and embedded in paraffin. Mounted sections (5 µm) were deparaffinized, rehydrated, and stained with periodic acid Schiff reagent. The histological evaluation of the seminiferous epithelium was performed using a Carl Zeiss microscope and computer-aided Eclipse image analyzer. The diameter of the seminiferous tubules was measured as described earlier for all age groups [15]. As Sertoli cells stop dividing around Day 14 in mouse, we counted their number in tubular cross sections of all three genotypes on Day 21.
Preparation of Testicular Cells for Flow Cytometry
The second dissected testis of each mouse was placed in a petri dish containing calcium- and magnesium-free DPBS and minced. The tissue was gently aspirated and filtered through a 100-µm nylon filter and washed in PBS. Following centrifugation and aspiration, the cells were resuspended in PBS, fixed in chilled 70% ethanol, and stored at 4°C until further analysis. Similarly, the sperm from cauda epididymis were also prepared and a drop of suspension was checked for the presence of sperm using phase-contrast microscopy.
Quantification of Testicular Cells by DNA Flow Cytometry
The procedure followed to stain DNA in testicular cells was essentially similar to that described elsewhere for mice [18]. Briefly, an aliquot of 1–2 x 106 ethanol-fixed testicular cells was washed with PBS and treated with 0.25% pepsin solution for 10 min at 37°C. Following centrifugation, the cells were stained with PI staining solution (25 µg/ml PI, 40 µg/ml RNase, and 0.3% Nonidet P-40 in PBS) at room temperature for 20 min. The PI-stained cells were analyzed on Coulter flow cytometer Epics XL equipped with a 15-mW argon-ion laser at an excitation wavelength of 488 nm. The fluorescence signals of the PI-stained germ cells were collected at 620 nm.
Elongated Spermatid Counts
After decapsulation, testicular parenchyma was homogenized using a Tissue Tearor homogenizer at maximum speed (30 000 rpm) for 1 min in 2 ml of normal saline containing 0.05% Triton X-100 and 3.8 mM sodium azide. Homogenization-resistant elongated spermatids (steps 14–16) were counted using a hemocytometer and expressed as total number of cells per testis [19]. Despite decreased nuclear condensation, the elongated spermatids of FORKO mice remain resistant to homogenization as reported earlier [15]. Therefore, this procedure does not underestimate the number of elongated spermatids in FORKO mice.
Reverse Transcriptase-PCR Analysis of Stem-Cell Factor
As the expression and splicing of stem-cell factor (SCF) is reported to be under FSH regulation, it was of interest to evaluate the developmental status of this cytokine in the testis [20]. Total RNA was isolated from the testis of 21- and 35-day-old mice as well as 12-wk-old adult males using an Ambion Total RNA isolation kit. Single-strand cDNA was synthesized by reverse transcription starting from 4 µg of total RNA. The reaction included 5 µM oligo dT primers, MLV-RT, 1x RT buffer, and a nucleotide mixture (dATP, dCTP, dTTP, and dGTP 10 mM each) in a reaction volume of 20 µl. Subsequent PCR amplification reactions were performed with reverse-transcribed cDNA product (2 µl) using 50 pmol each of the forward primer and reverse primers, TGGTGGCATCTGACACTAGTGA and CTTCCAGTATAAGGCTCCAAAAGC, respectively, in exons 5 and 7, 5 µl of nucleotide mixture (dATP, dCTP, dTTP, and dGTP at 10 mM each), 1x PCR buffer, and 5 U of DNA Taq polymerase. The reaction conditions were as described by Mauduit et al. [20]. The SCF amplification products (24 cycles) show fragments of 251 and 167 base pairs (bp) corresponding to SCFs (has exon 6) and SCFm (no exon 6), respectively (see Fig. 8). ß-Actin was amplified (514 bp) as an internal control in each PCR test using specific primers as described [21] to provide a semiquantitative assessment.
|
Mating Studies
Six-week-old wild-type and FORKO males were mated with proven fertile wild-type females. Each male was mated with a female, and the time taken for producing the first litter and size of the litter were recorded.
Data Analysis
Statistical comparisions between the three genotypes were made using one-way analysis of variance and Mann-Whitney t-test. Level of significance was set at 5%.
RESULTS
Body Weight
There was no difference in the body weights of the three genotypes studied at any of the age groups studied. However, the 6-wk-old FORKO males were lighter. Interestingly, the +/- males also showed this tendency (Fig. 1A).
|
Weight of the Testes and Epididymides
Testicular development was inhibited in FORKO mice. This was reflected by a significant reduction in the weight of testes in mutant males compared to wild-type/heterozygotes at all the age groups studied (Fig. 1B). At 4–6 wk of age, the FORKO testes weighed only about a quarter of the wild type. There was no significant reduction in the weight of epididymis of FORKO and wild-type males until Day 21. However, the weight of the epididymides of FORKO males was significantly lower from Day 28 onward (Fig. 1C). On Days 28 and 35 there was a reduction in epididymal weight of the +/- mice also.
Testosterone Levels
In each of the age groups studied there was no change in serum testosterone concentration among the three genotypes until 9 wk (Fig. 2). Although the level in +/- and -/- animals appeared to be lower on Day 56, the decrease was not statistically significant. However, there was a significant reduction in the levels of circulating testosterone concentration of FORKO males compared to both wild-type/heterozygous at 70 days. Earlier we have reported that adult (
12-wk) FORKO mice show about 66% reduction in serum testosterone levels [14, 15], an observation confirmed again in this study.
|
Histological Examination of the Seminiferous Tubules
Histological evaluation, including the identification of the most advanced stage of spermatogenesis at each age group, and the cellular associations as well as morphometric measurements of tubular diameter of the testis of all three genotypes at various intervals, was made according to the method described by Russell et al. [22]. Representative tubules showing the most advanced stage of spermatogenesis at a given age group are presented in Figure 3. No major differences were observed in the morphology or cellular associations at 7 and 14 days, except that the diameter of the seminiferous tubules was smaller in FORKO males (Fig. 3, Table 1). As expected, at 21 days of age numerous round spermatids were observed in the wild-type and heterozygous males, but few if any were present in FORKO males. Interestingly, at 28 days the FORKO males did not show any elongating spermatids (step 11–13) that were observed in the wild-type and heterozygous males (Fig. 3). Both the tubular (Table 1) and luminal diameter (data not shown) were dramatically reduced in FORKO males compared to wild-type or heterozygous animals. At 35 days all the stages of spermatogenesis were present in wild-type and heterozygous males, but the FORKO males did not show cell types beyond stage 1; the most advanced spermatids seen were step 13 elongating spermatids. Although on Day 42 all the stages of spermatogenesis were present in the three genotypes, the FORKO males showed fewer elongated spermatids. At 49 days there were no differences in the morphology or cellular associations between the three genotypes studied except for the smaller tubular diameter of FORKO males.
|
|
Quantification of Testicular Cells by DNA Flow Cytometry
The application of DNA flow cytometry in the quantitative analysis of testicular cells as a function of sexual maturity in mouse [23], rat [24], and monkey [25] has been well documented. Based on the DNA content, the normal adult mouse testis shows five quantifiable populations. These are identified as elongated spermatids (HC; H = hypostainability of elongated spermatids due to condensation of nuclear DNA during spermiogenesis), round spermatids (1C), spermatogonia and testicular somatic cells (2C), spermatogonial cells synthesizing DNA (S-phase), and primary spermatocytes and G2 spermatogonia (4C) [23]. It may be noted that the percentage of testicular somatic cells (Sertoli, Leydig, and peritubular myoid cells) is usually less than 3% of total testicular cells [26], and this falls within the 2C population.
The frequency distribution histograms of PI-stained testicular cells as determined by DNA flow cytometry are presented in Figure 4. There was no change in the percentage of 2C cells at 7 and 14 days between the three genotypes. However, beginning at Day 21 and persisting into adulthood [15], the percentage of 2C cells was higher in FORKO males (Fig. 5A). This increase persisted in adult FORKO mice. There was no change in the percentage of S-phase cells between genotypes except for a probable decrease in 14-day-old FORKO males (Fig. 5B). The increase in the relative numbers of 4C cells in FORKO males from 28–49 days may be due to fewer haploid (1C and HC) cells at these ages. The other cell types did not develop in the FORKO males (Fig. 5C). However, the ratio of 4C:2C was significantly lower in FORKO males than in +/+ or +/- animals at all the intervals studied, suggesting that there is decrease in the percentage of cells undergoing spermatogonial proliferation (Fig. 5F). While 1C cells clearly appear from Day 21 in the wild-type and heterozygous males, the percentage of these cells remains significantly lower in the FORKO males (Fig. 5D). Although HC cells appear from Day 35 in the wild type and heterozygotes these were absent in the FORKO males (Fig. 5E).
|
|
Sertoli Cell Number and Testicular Elongated Spermatid Counts
The Sertoli cell is a major structural component of the seminiferous tubule. As the division of these cells is generally complete around Postnatal Day 14 in mice, we opted to count their numbers in the cross sections of tubules on Day 21 in all three genotypes. From the data shown in Figure 6A it is evident that there were 50% fewer Sertoli cells in FORKO males. It is believed that the number of Sertoli cells determines the spermatogenic capacity of the adult testis, and furthermore each of these cells in their state of optimal function can only nurse a definite number of germ cells. In view of this we estimated the homogenization-resistant elongated spermatids (steps 14–16), as they seem to make their first appearance only by Day 42 in FORKO males. The absolute number of homogenization-resistant elongated spermatids calculated for each interval from Day 42 to 84 is presented in the Figure 6B. There were significantly fewer homogenization-resistant spermatids in the FORKO males at all the intervals studied. The differences (64%–87%) became exaggerated from Day 63 onward.
|
Histological Examination of Epididymis
The histological examination of the cauda epididymis on Days 35, 42, and 49 is presented in Figure 7. Although the morphological features of the tubules remained unchanged, the tubular diameter was reduced in the FORKO males (data not shown). The lumen of the cauda epididymal tubules did not show any sperm on Day 35 in all the genotypes. Interestingly, by Day 42 only the cauda epididymis of wild-type and heterozygous males was filled with sperm. They were absent in all the FORKO males, indicating a delay in spermiogenesis and/or epididymal transit. Their absence was further confirmed by verifying the epididymal suspension under the microscope. On Day 49, all three genotypes showed sperm in the lumen of the cauda epididymis.
|
Reverse Transcriptase-PCR Analysis of SCF Gene Expression
The SCF and its cognate receptor c-kit are produced in the testis by Sertoli cells and spermatogonia, respectively [27, 28]. The SCF exists in two forms, as a soluble component (SCFs) and membrane-bound (SCFm), which are generated by alternative splicing of exon 6 encoding sites of proteolysis [29–31]. As their expression is reported to be under developmental regulation [20], it was of interest to examine their status in our mutants. For this exercise we have focused on stages of spermatogenesis where differences became most perceptible on Day 21 as well as Day 35 and compared them with adult stage (Day 84). Thus, the expression of SCFm and SCFs analyzed by RT-PCR revealed that their ratio was significantly altered in the FORKO males (Fig. 8, A and B). This might contribute to the dramatic decline in the spermatogonial proliferation or ratio of 4C:2C cells found in FORKO testis. The increase in the intensity of the bands in FORKO males compared to wild-type or heterozygous males may be due to the higher ratio of absolute number of somatic cells to germ cells (haploid) despite a reduction in Sertoli cell numbers (Fig. 6A).
Mating Studies
In view of the differences observed in the testicular developmental patterns in FORKO males, we examined their fertility by conducting mating studies. In this preliminary experiment, certain differences were apparent. Interestingly, the decrease in fertility occurred in two ways. First, the time taken to produce the first litter by the FORKO male was significantly longer compared the wild-type males (Table 2). Secondly, the number of pups sired by the FORKO males was lower compared to those produced by the wild-type males. Taken together with the analysis performed above, these data suggest a delay in the attainment of sexual maturity in FORKO males. Based on the number of testicular sperm produced at the time of mating, we can predict that the minimum number of sperm required to successfully impregnate a female mouse is around 2.5–3.5 million per testis of the SV129 males (from Fig. 6B). The wild-type males produced this quantity by about 56 days, whereas in the FORKO males this level was attained by 77 days of age. This might account for the delay in the production of first litter in FORKO males while sperm aberrations may explain the reduction in size of the litter (Table 2).
|
DISCUSSION
Many experimental paradigms have been used in the past to characterize events that may be responsible for causing a delay in male puberty. As it is not an easy task to completely deprive the animals of gonadotropins or their signaling mechanisms from birth, genetic disruption offers a useful experimental approach. The FORKO model appears to address the question of whether or not the action of these hormones is required for the initiation of spermatogenesis and sexual maturity in the correct time frame. Remarkably, loss of FSH-R signaling begins to have a deleterious effect very early in testicular development. The small testes observed on Day 7 persist into adulthood, showing that FSH-R-mediated actions are required for testicular development. These data are in agreement with several other reports on the effect of FSH in maintaining testicular weight [32–37]. Neutralizing FSH for 4.5 wk in immature rats has also been shown to reduce testicular weight [13]. The importance of the effect of FSH in maintaining testicular volume has been deduced by a number of other approaches. For example, concomitant administration of recombinant human FSH to adult rats [32] and monkeys [33] attenuated the GnRH antagonist-induced testicular weight loss. Neonatal administration of recombinant FSH in the gonadotropin-deficient hpg mouse produces a partial (43%) restoration of testicular weight [10]. However, genetic rescue by expression of the human FSH ß gene in the FSH ß knockout mouse leads to a full restoration of testicular size and function [34]. Administration of FSH to neonatal rats increases Sertoli and germ cell numbers and testicular size [35]. Similar effects of FSH are also seen in monkey [36] and man [37]. Based on data from our flow cytometric analysis from Day 7 (Fig. 5F) of the FORKO males as well as the enumeration of Sertoli cell numbers in the tubular cross sections performed on Day 21 (Fig. 6A), we may conclude that decreases in the Sertoli and spermatogonial proliferation contribute to the overall reduction in testicular size.
The Sertoli cells provide not only the structural and functional support required for the sustenance of germ cells but also many factors necessary for intercellular communication and maintenance of testicular homeostasis. As the FSH-R is selectively expressed in the Sertoli cells [38], it is reasonable to suppose that loss of its function might compromise the cellular integrity within the testis and perturb the scaffolding relied upon by the developing germ cells for their continual progression. The maintenance of testosterone at comparable ages in the three genotypes up to Day 70 in this chronological study is interesting and important for several reasons. First, this supports the argument that hormone action via the FSH-R, but not testosterone, is the principal event that maintains testicular size in the prepubertal animal. A significant decrease in testosterone in adult FORKO males was previously reported [14, 15] and confirmed in this study, which suggests that Sertoli cell-Leydig cell communication is developmentally regulated. We may speculate that a higher rate of germ cell production, as it occurs in the adult, may require a higher threshold of testosterone that cannot be adequately met in the FORKO male.
The rodent testis from Day 1 to 14 contains actively proliferating Sertoli cells, type A, intermediate, and B spermatogonia [39–41]. In the current study, although the histological examination did not reveal any gross changes in the morphological or cellular associations in Days 7 and 14 FORKO males, a more discriminating and sensitive flow cytometric analysis clearly indicated a decrease in the ratio of 4C:2C cells. This is highly suggestive of a decrease in the spermatogonial as well as Sertoli cell proliferation. A corollary finding of increased numbers of spermatogonia and spermatocytes and Sertoli cell proliferation in FSH-treated neonatal rat [35] is in agreement with our conclusions. Taken together these data suggest that FSH-R signaling modulate spermatogonial and Sertoli cell proliferation in rodents.
In this chronological study we observe differences at several critical stages of spermatogenesis in the FORKO mouse, all occurring in a background of normal testosterone. It has been shown that round spermatids make their appearance in the tubule as a result of completion of first meiosis by Day 18 in the prepubertal mouse testis [23, 41]. In the absence of the FSH-R (see Figs. 4 and 5D), there is a complete lack of 1C cells that make up about 10%–15% of the population in the wild-type and heterozygous mice. There were only two or three round spermatids in very few tubules of FORKO males (Fig. 3 see Day 21 and arrow in Fig. 4). Others have shown a reduction of 86% in the number of round spermatids after bioneutralization of FSH in prepubertal rats [42] while an increase in the number of round spermatids occurred after administration of recombinant FSH to neonatal rats [35]. Elongating spermatids were present in wild-type and heterozygous males by Day 28 while spermatogenesis did not proceed beyond round spermatid stage in FORKO males, a finding that suggests that spermiogenesis is delayed. Similarly, all stages of spermatogeneisis were observed in wild-type and heterozygous males on Day 35 while the process in FORKO males did not pass stage 1 until Days 41–49. However, there were fewer mature cells compared to the numbers observed in the wild-type and heterozygous males. It is clear that spermiogenesis is delayed but not inhibited. Similar observations were made in neonatal rats [35, 42].
In the mouse the time required for progression of a round spermatid to an elongating spermatid and subsequently to an elongated spermatid is from 6 to 8 and 2 to 4 days, respectively [43, 44]. In the current study the wild-type and heterozygous males followed these timelines, whereas they were delayed in the knockout males for about 7 days. It is interesting to note that the elongated spermatids of the adult FORKO male [15] as well as FSH-immunized monkeys [45] exhibit improper nuclear compaction. Taken together with our current developmental study, these data clearly suggest that the complex processes of spermiogenesis require actions mediated by the FSH-R.
The epididymis is usually considered a target that is sensitive to androgens. Lowered epididymal weights and tubular diameters in prepubertal FORKO males beginning at Day 28 (Fig. 1C), when circulating testosterone levels are not different between the groups, suggests that other factors might contribute to growth and maintenance of this organ. In addition a possible decrease in testicular outflow due to reduced Sertoli cell number (Fig. 6A) at any given time in the FORKO males might also be responsible.
Comparison of testicular histology of FORKO versus normal mice at 21 days of age suggests that in the former either spermatogenesis starts at a later age or the mortality of germ cells during meiosis is greatly increased. The appearance of sperm in the cauda of FORKO males at 49 days as opposed to Day 42 in the wild-type and heterozygous males is further evidence showing that there is a delay in spermiogenesis. However, we cannot also discount a change in the rate of transit of sperm through the epididymis. The number of homogenization-resistant spermatids from 42 to 84 days in FORKO males clearly shows that FSH-R signaling is required for quantitative maintenance of spermatogenesis.
Consequent to decrease in the absolute number of homogenization-resistant spermatids, the number of pups sired by the FORKO males was lower compared to wild-type males. Interestingly, the time taken by FORKO males to produce their first litter was about 3 wk longer compared to wild-type males. This suggests that the delay in the appearance of sperm in the cauda epididymis may be responsible for the delay in sexual maturity and fertility although induction of pseudopregnancy by sterile mating cannot be ruled out. To our knowledge this is also the first report to evaluate the minimum number of sperm required by a normal male mouse to impregnate a female and reproduce successfully. Our estimate of a requirement of 2.5–3.5 million sperm per testis, derived for wild-type animals from a comparison of rates of sperm production (Fig. 6B) and fertility (Table 2), appears reasonable and includes a pool of sperm that should be considered normal.
Stem cell factor is a secretory product of Sertoli cell [46] that stimulates type A spermatogonial cells in mouse [47]. Several studies demonstrate that the survival and/or proliferation of type A1–A4 spermatogonia depend on c-kit ligand and receptor [48]. In addition, the strong evidence for FSH regulation of SCF in the testis [47] indicates how any perturbation in the balance might impair the spermatogenic process. The alternative splicing of SCF pre-mRNA in mouse testis is developmentally regulated under hormonal control [20] to produce the SCFs and SCFm. The amount of SCFs is higher in fetal and neonatal gonads, while the major form of SCF present in the prepubertal and adult mouse testis is SCFm [20, 49]. In view of these observations, our scrutiny for possible aberrations in developmental pattern of SCF gene expression in the FORKO mouse has been informative. A significant alteration (Fig. 8) in the ratio of SCFm to SCFs in FORKO males implies a strong connection between these perturbations and reduction in the spermatogonial proliferation leading to quantitative decline in the sperm output.
Based on the observations we have presented in this study, we conclude that deficiency in FSH-R signaling causes delayed puberty in the mouse. Although many facets of the relative importance of FSH in the control of spermatogenesis may differ in different species, we assume some interspecies comparisons may be informative. Whether deficiency of FSH-R function alone can indeed cause delayed puberty in boys is an interesting question that can be raised following our detailed studies in the FORKO males. In light of recent reports that describe alteration of spermatogenesis or testicular function in males with inactivating mutation of either the FSH ß subunit [50, 51] or the FSH-R [52] questions related to suboptimal function of the Sertoli cell become highly relevant for further investigation. Because ethical considerations preclude frequent sampling of testicular tissues from such patients, alternative models like the FORKO mouse might offer clues to the molecular deficits underlying these conditions. Further studies are currently underway to explore genes and mechanisms that govern key maturational steps that cause delay in spermatogenesis of FORKO males.
ACKNOWLEDGMENTS
We are grateful to Maria Gerdes, Yinzhi Yang, and Rouslan Kats for their invaluable help in managing the FORKO mice and other related studies. We thank Dr. Manimaran for his suggestions on morphometric measurements. We thank Nathalie Tessier and Eric Massicotte for their help in flow cytometry and Christian Charbonneau for his help in microscopy. The editorial assistance of Odile Royer in preparation of this manuscript is greatly appreciated.
FOOTNOTES
First decision: 15 February 2001.
1 This work was supported by a grant from the Canadian Institutes of Health Research. 
2 Correspondence: M. Ram Sairam, Clinical Research Institute of Montreal,
110 Pine Avenue West, Montreal, PQ, Canada H2W 1R7. FAX: 514 987 5585; sairamm{at}ircm.qc.ca
Accepted: April 3, 2001.
Received: January 23, 2001.
REFERENCES
This article has been cited by other articles:
|
|
 |
|
  N. O. Belo, M. R. Sairam, and A. M. dos Reis Impairment of the Natriuretic Peptide System in Follitropin Receptor Knockout Mice and Reversal by Estradiol: Implications for Obesity-Associated Hypertension in Menopause Endocrinology, March 1, 2008; 149(3): 1399 - 1406. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Guo, D. Zhao, Y. Song, Y. Meng, H. Zhao, X. Zhao, and B. Yang Reduced urea flux across the blood-testis barrier and early maturation in the male reproductive system in UT-B-null mice Am J Physiol Cell Physiol, July 1, 2007; 293(1): C305 - C312. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. L. Dahia and A. J. Rao Demonstration of Follicle-Stimulating Hormone Receptor in Cauda Epididymis of Rat Biol Reprod, July 1, 2006; 75(1): 98 - 106. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Allan, A. Garcia, J. Spaliviero, M. Jimenez, and D. J. Handelsman Maintenance of Spermatogenesis by the Activated Human (Asp567Gly) FSH Receptor During Testicular Regression Due to Hormonal Withdrawal Biol Reprod, May 1, 2006; 74(5): 938 - 944. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T R. Kumar What have we learned about gonadotropin function from gonadotropin subunit and receptor knockout mice? Reproduction, September 1, 2005; 130(3): 293 - 302. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. P. Hermann and L. L. Heckert Silencing of Fshr Occurs through a Conserved, Hypersensitive Site in the First Intron Mol. Endocrinol., August 1, 2005; 19(8): 2112 - 2131. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Muir, I. Sadler-Riggleman, and M. K. Skinner Role of the Basic Helix-Loop-Helix Transcription Factor, Scleraxis, in the Regulation of Sertoli Cell Function and Differentiation Mol. Endocrinol., August 1, 2005; 19(8): 2164 - 2174. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Brouillette, K. Rivard, E. Lizotte, and C. Fiset Sex and strain differences in adult mouse cardiac repolarization: importance of androgens Cardiovasc Res, January 1, 2005; 65(1): 148 - 157. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Suzuki, M. Yagi, K. Saito, and K. Suzuki Dysplastic Development of Seminiferous Tubules and Interstitial Tissue in Rat Hypogonadic (hgn/hgn) Testes Biol Reprod, July 1, 2004; 71(1): 104 - 116. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Grover, M. R. Sairam, C. E. Smith, and L. Hermo Structural and Functional Modifications of Sertoli Cells in the Testis of Adult Follicle-Stimulating Hormone Receptor Knockout Mice Biol Reprod, July 1, 2004; 71(1): 117 - 129. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Lukas-Croisier, C. Lasala, J. Nicaud, P. Bedecarras, T. R. Kumar, M. Dutertre, M. M. Matzuk, J.-Y. Picard, N. Josso, and R. Rey Follicle-Stimulating Hormone Increases Testicular Anti-Mullerian Hormone (AMH) Production through Sertoli Cell Proliferation and a Nonclassical Cyclic Adenosine 5'-Monophosphate-Mediated Activation of the AMH Gene Mol. Endocrinol., April 1, 2003; 17(4): 550 - 561. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. Baker, P. Pakarinen, I. T. Huhtaniemi, M. H. Abel, H. M. Charlton, T. R. Kumar, and P. J. O'Shaughnessy Failure of Normal Leydig Cell Development in Follicle-Stimulating Hormone (FSH) Receptor-Deficient Mice, But Not FSH{beta}-Deficient Mice: Role for Constitutive FSH Receptor Activity Endocrinology, January 1, 2003; 144(1): 138 - 145. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Abdennebi, E. Y. Chun, H. Jammes, D. Wei, and J. J. Remy Maintenance of Sexual Immaturity in Male Mice and Bucks by Immunization Against N-Terminal Peptides of the Follicle-Stimulating Hormone Receptor Biol Reprod, January 1, 2003; 68(1): 323 - 327. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. J. Arey, D. C. Deecher, E. S. Shen, P. E. Stevis, E. H. Meade Jr, J. Wrobel, D. E. Frail, and F. J. Lopez Identification and Characterization of a Selective, Nonpeptide Follicle-Stimulating Hormone Receptor Antagonist Endocrinology, October 1, 2002; 143(10): 3822 - 3829. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. E. Keene, M. O. Suescun, M. G. Bostwick, V. Chandrashekar, A. Bartke, and J. J. Kopchick Puberty Is Delayed in Male Growth Hormone Receptor Gene--Disrupted Mice J Androl, September 1, 2002; 23(5): 661 - 668. [Abstract] [Full Text] [PDF]
|
|
| |||||
