| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Regular Article |
a Department of Animal Science, Louisiana State University Agricultural Center, Baton Rouge, Louisiana 70803
b Genzyme Transgenics Corporation, Framingham, Massachusetts 01701
ABSTRACT
The use of nuclear transfer (NT) techniques to create transgenic offspring capable of producing valuable proteins may have a major impact on the pharmaceutical market. Our objective was to compare the in vivo developmental potential of NT embryos produced from the fusion of transgenic donor cells with cytoplasts prepared from either FSH-stimulated ovaries or nonstimulated abattoir-derived ovaries. Donor cells were prepared from a transgenic fetus carrying the gene for human antithrombin III as a marker and used within four to eight subpassages. Cells were serum deprived for 4 days prior to cytoplast transfer. Oocytes were enucleated by removing the metaphase plate using a DNA stain and epifluorescent illumination. Donor cells were fused to enucleated oocytes by electric pulse and then chemically activated. There was no difference in the number of transferable embryos produced from cytoplasts of FSH-stimulated ovaries or from the fusion of cytoplasts from abattoir ovaries, nor was there a difference in the number of pregnancies established per recipient with either treatment. All pregnancies from both groups culminated in the births of healthy female kids (five total). To our knowledge, this is the first report of cloned goats produced from NT using cytoplasts derived from abattoir ovaries.
developmental biology, embryo, reproductive technology
INTRODUCTION
A relatively short time has elapsed since cloned sheep were produced by transferring nuclei from an established cell line isolated from the embryonic discs of 9-day-old embryos into enucleated metaphase II oocytes [1]. Since that time, the use of donor nuclei from fetal and adult cells has resulted in the births of sheep [2], cattle [3–5], mice [6], goats [7, 8], and pigs [9–11]. The use of these nuclear transfer (NT) techniques in farm animals to efficiently generate cloned transgenic offspring capable of producing valuable proteins could have a marked impact on the pharmaceutical industry [12].
The mammary gland is well suited for the production and expression of human recombinant proteins [13] (e.g., alpha-1-antitrypsin [14], fibrinogen [15], human clotting factor IX [16], and antithrombin III [7]) and antibodies [17]. Obvious benefits of utilizing transgenic animals to provide such human pharmaceuticals include 1) high product yield, 2) low capital investment compared with cell culture techniques, 3) the ability to perform complex posttranslational modifications (e.g., glycosylation and gamma-carboxylation), and 4) elimination of reliance on products derived from human blood, which may contain pathogens (e.g., human immunodeficiency virus and hepatitis viruses). Dairy goats are ideal for the transgenic production of therapeutic recombinant proteins because of their high yield of purified product, relatively short generation interval, and low incidence of the disease scrapie [18].
One of the limitations of somatic cell NT in sheep and cattle is the very low success rate, with a high proportion of fetal loss [1, 2, 16, 19–21] and an increase in perinatal morbidity/mortality [3, 4, 22–25]. Reported causes of fetal wastage include abnormal liver development [2], insufficient placentation leading to spontaneous abortions or prolonged gestations [3, 5, 24], and oversized fetuses [22]. Reported causes of perinatal death include metabolic and cardiopulmonary abnormalities [3, 5, 21, 24, 26] and lymphoid hypoplasia [27].
Calves and lambs resulting from embryos cultured in vitro may be heavier at birth [28–32], present with an increased incidence of neonatal mortality [33, 34], and are associated with longer gestation lengths [31] than offspring resulting from in vivo-produced embryos. Moreover, placental development is also affected, resulting in fewer placentomes [35] and increased incidences of hydrallantois [36]. In addition, blastomere NT in the sheep and the cow results in increased fetal wastage and perinatal mortality [30, 33, 34, 37, 38], which may be attributable to the culture conditions (serum in the medium), coculture systems, or the manipulation procedure itself [34, 37].
Conversely, the incidence of perinatal loss associated with somatic cell NT has not been reported in the goat [7, 39], although this lack of information may be due to 1) the relatively low number of goat clones produced to date or 2) a minimal in vitro culture period in which reconstructed embryos were transferred at the two- to four-cell stage in both previous studies. However, Yong and Yuqiang [40] produced an amazing 45 cloned goats from the transfer of 141 serially reconstructed embryos into 29 recipients in a cloning study using blastomere donor nuclei, in which embryos were cultured up to the morula stage prior to transfer. Thus, manipulated goat embryos may not be as sensitive as cow and sheep embryos to micromanipulation procedures and in vitro culture conditions.
Although cloned transgenic goats have been produced using oocytes collected from stimulated donor animals [7, 8], abattoir-derived ovaries could also be a source of oocytes for the production of transgenic goats and may improve the cost effectiveness of generating pharmaceutically important proteins. Large numbers of goat oocytes can be harvested from abattoir-derived ovaries and matured in vitro [41] to provide an inexpensive supply of cytoplasts suitable for NT procedures, apparently without the risk of generating oversize or moribund offspring, as reported in the sheep [42, 43] and cow [30, 32–34]. The expense and difficulty of obtaining caprine oocytes from a donor herd can thus be eliminated. Although the use of abattoir-derived oocytes for the production of human pharmaceuticals is restricted by federal Food and Drug Administration regulations, the economic benefit of their use in a research setting becomes obvious. Our objective in this study was to compare the fusion rates of couplets and then the in vivo development of NT embryos produced from the fusion of transgenic fetal fibroblast cells with that of cytoplasts prepared from oocytes aspirated from either FSH-stimulated or abattoir-derived caprine ovaries.
MATERIALS AND METHODS
Isolation of Caprine Transgenic Fetal Fibroblast Cell Line
The primary caprine fetal fibroblast cells used as karyoplast donors were derived as previously described [7]. Fetal tissues from a Day 40 transgenic female fetus (Toggenberg) were minced, washed, and transferred into 25-cm2 tissue culture flasks. Cells were cultured in fetal cell medium (FCM) consisting of tissue culture medium-199 (TCM-199; Gibco Laboratories, Grand Island, NY) supplemented with 10% fetal bovine serum (FBS; Hyclone, Logan, UT), nucleosides, 2 mM L-glutamine, 0.1 mM ß-mercaptoethanol (Sigma Chemical Co., St. Louis, MO), and 50 µg/ml gentamicin sulfate (Gibco). After three subpassages, cell stocks were frozen and stored in liquid nitrogen. This transgenic female line was designated CFF-6 and was used for all NT procedures within four to eight subpassages. Each passage required 6.2 ± 0.43 days in culture.
Oocyte Collection
FSH-stimulated ovaries Prior to oocyte retrieval, mixed-breed Spanish-type goats were implanted (Day 1) on the dorsal side of the ear (s.c.) with a 3-mg norgestomet implant (Synchro-Mate-B, Rhone Merieux, Athens, GA) and then subjected (Day 4) to ovarian superstimulation by twice daily administration (i.m.) of FSH (Sioux Biochemical, Sioux Center, IA) in a decreasing dose schedule (10 and 10, 7.5 and 7.5, 5 and 5, and 2.5 and 2.5 units) totaling 50 units/doe [44]. All goats (both donor and recipient females) used in this study were handled and maintained in accordance with the Institutional Animal Care and Use Committee Guidelines at Louisiana State University.
Implants were removed on treatment Day 8 and oocytes were then aspirated 24 h after the final FSH injection. Following general anesthesia (Halothane; Fort Dodge Animal Health, Fort Dodge, IA), does were placed in dorsal recumbency on a hydraulic operating table for a midventral laporatomy procedure. Oocytes were harvested using techniques previously described [45] with slight modifications. Ovaries were exteriorized, and all visible follicles were aspirated with a 20-gauge needle attached via polyethylene tubing (20-gauge) to an electric vacuum pump (Cook Veterinary Products, Eight Mile Plains, Australia). The pump was set to aspirate 
18 ml of fluid/min. Oocytes were collected in 50-ml centrifuge tubes containing warmed PBS supplemented with 1% FBS, 50 µg/ml gentamicin, and 0.4 units/ml sodium heparin (Elkins-Sinn, Cherry Hill, NJ). All oocytes with a compact investment of cumulus cells were washed eight times in maturation medium (TCM-199 supplemented with 10% normal goat serum [Sigma], 10 µg/ml LH, 5 µg/ml FSH, and 1 µg/ml estradiol-17ß) and allowed to mature for 18–22 h (38°C and 5% CO2) in groups of 10–20 in 35-µl microdrops of maturation medium overlaid with warmed embryo-tested mineral oil (Sigma).
Abattoir ovaries Ovaries harvested from nonstimulated does at an abattoir located in San Angelo, TX, were placed in insulated thermos bottles containing PBS at ambient temperature and transported by air courier within 12 h of collection. Upon arrival at the laboratory, oocytes from these ovaries were similarly aspirated, selected, washed, and matured as described for oocytes from stimulated ovaries.
Nuclear Transfer
Enucleation Cumulus-oocyte complexes were vortexed at 18–22 h postmaturation for 2.25 min in TL-Hepes (BioWhittaker, Walkersville, MD) containing 0.6 mg/ml hyaluronidase (Sigma) to aid in the final removal of the cumulus cells. Oocytes were washed in modified TL-Hepes (mTLH; TL-Hepes supplemented with 10% FBS), selected based on the presence of a polar body (MII), and labeled with 3 µg/ml Hoechst 33342 stain (Sigma) for 1 min. Mature oocytes were enucleated in a 200-µl elongated droplet of micromanipulation medium (mTLH with 7.5 µg/ml cytochalasin B) overlaid with warmed mineral oil on the stage of an inverted microscope (Nikon Diaphot) equipped with Hoffman Modulation Contrast objectives, Narishige micromanipulators, and epifluorescent illumination.
Oocytes were held at the 9 o'clock position by negative pressure applied to a holding pipette (75-µm outside diameter). After a brief exposure (<10 sec) to ultraviolet light to visualize nuclear DNA, the oocytes were rotated against the holding pipette to bring the metaphase plate into focus at the 3 o'clock position. Using a soft glass enucleation pipette (20- to 25-µm outside diameter) with a 35° bevel and a spike, the metaphase plate and first polar body were removed under short-term exposure to UV light (<5 sec). This procedure was generally effective in removing both the polar body and the metaphase plate. The resulting cytoplasts were allowed to recover at 38°C in modified TCM (mTCM; TCM supplemented with 10% FBS) for at least 30 min prior to reconstruction with donor cells.
Donor cell preparation Actively dividing fibroblast cells from the transgenic female line (CFF-6) were maintained in FCM with 10% FBS for 3–4 days and then synchronized by an additional 4 days of culture in reduced-serum (0.5%) FCM. Donor cells were trypsinized, washed, and held (<1.5 h) in mTLH immediately before transfer into the recently prepared cytoplasts.
Reconstruction and fusion A single fibroblast cell (15- to 20-µm diameter) was injected into the perivitelline space of each enucleated oocyte in a droplet (200 µl) of micromanipulation medium using the same enucleation pipette. Close contact of the donor cell membrane with the vitelline membrane of the cytoplast was visually confirmed prior to fusion. Karyoplast-cytoplast couplets were manually aligned between two stainless steel electrodes (1-mm gap) in a microslide fusion chamber filled with fusion buffer (0.3 M mannitol, 0.1 mM MgSO4·7H2O, 0.05 mM CaCl2, 0.5 mM Hepes, and 4 mg/ml BSA) and fused by a single DC pulse (1.30 kV/cm for 25 µsec) delivered by a BTX Electrocell Manipulator 200 (Gentronics, San Diego, CA). Couplets were evaluated for fusion after a 1-h incubation period in mTCM and then activated.
Fused couplets were activated by a 5-min exposure to 5 µM ionomycin (Sigma), washed extensively in mTLH, and then incubated for 3 h in 2 mM 6-dimethylaminopurine prepared in G1.2 medium (Zander IVF, Vero Beach, FL). Following activation, the reconstructed embryos were washed and cultured under oil in 35-µl droplets of G1.2 medium for 33–36 h (two- to four-cell stages) prior to transfer to recipient females.
Embryo Transfer
Spanish-type crossbred recipient does were selected from those exhibiting a natural estrus 2 days prior to the scheduled embryo transfer. NT embryos, produced from either FSH-stimulated ovaries or nonstimulated abattoir-derived ovaries, were transferred into recipients 54–60 h after donor oocytes were aspirated.
The same general anesthesia protocol used for the oocyte aspiration was followed for the embryo transfer procedure. Does were placed in dorsal recumbency, and a midventral laporatomy procedure was performed. After the ovaries were examined for evidence of ovulation, the uterus was exteriorized and embryos were transferred to the oviduct ipsilateral to the ovary with the most ovulation points. Embryos (1–15/female) were transferred via a small plastic catheter (Embryon Catheter; Rolon Medical, Watford, UK) through the ostium of the infundibulum, gently advancing the catheter as far as possible distally into the oviduct. Recipients were returned to the herd to await subsequent examinations of pregnancy status.
Pregnancy Status and Parturition
Beginning on Day 30 of gestation, recipients were subjected to a transvaginal ultrasonographic evaluation (Aloka 500-V; Aloka, Tokyo, Japan), followed 7 and 10 days later by additional ultrasonographic assessments. The presence of a fetal heartbeat was used to diagnose pregnancy. Pregnant recipients were subsequently monitored at 14-day intervals and then separated from the herd on Day 90 of gestation and placed in groups of two or three females per pen. Monitoring of pregnant recipients past Day 90 was performed via abdominal ultrasonography.
Parturition was induced in recipient females if they had not given birth by Day 152 of gestation. Induced females received 15 mg of prostaglandin F2
(Lutalyse; Upjohn, Kalamazoo, MI) and 12 mg of dexamethasone (i.m.) and were monitored closely until parturition. The kids were allowed to remain with the dams and nurse freely until weaning.
Characterization of Cloned Animals
Skin biopsies (6-mm diameter) were obtained from each offspring (1.5–3 mo of age) from the caudal lateral aspect of the thigh directly over the semitendinosis muscle and then subjected to genomic DNA isolation [46] using the Genomic Prep Kit (Amersham Pharmacia Biotech, Piscataway, NJ). Each sample and an internal control for goat genomic DNA (goat exon 7) were analyzed by polymerase chain reaction using human antithrombin (hAT)-specific primers. The hAT sequence was detected by amplification of a 367-base pair (bp) sequence with oligonucleotides GTC11 (CTCCATCAGTTGCTGGAGGGTGTCATTA) and GTC12 (GAAGGTTTATCTTTTGTCCTTGCTGCTCA). Two positive control samples, from an antithrombin III (ATIII) transgenic adult female (B521) and from the transgenic fetal fibroblast CFF-6 cell line, and one negative control blood sample from a nontransgenic female goat were analyzed to verify the presence of the human ATIII (hATIII) transgene.
At 150 days of age, the cloned offspring were subjected to a hormonal lactation induction protocol developed for prepubertal goats [47] and were then hand-milked once daily to collect samples to assay for hATIII expression. Western blots were performed as previously described [48].
Statistical Analysis
Data for maturation rate, number of couplets produced, rate of fusion, in vitro embryo development, and subsequent production of offspring were all analyzed by a general linear model of regression using a SAS analysis of variance procedure [49].
RESULTS
Oocyte Recovery and Embryo Reconstruction
The rate of oocyte recovery and maturation from stimulated ovaries and nonstimulated abattoir-derived ovaries is shown in Table 1. A total of 833 oocytes were recovered from a series of aspirations (12 replicates) from 34 FSH-stimulated donor animals (68 ovaries). An average of 12.2 oocytes were recovered per stimulated ovary (from 7 to 33 oocytes/ovary). Eight replicates of follicular aspiration from 944 nonstimulated abattoir-derived ovaries produced a total of 769 oocytes (0.81 oocytes/ovary).
|
Following a maturation interval of 18–22 h, 50% of the oocytes from the FSH-stimulated ovaries and 68% of the oocytes from the abattoir-derived ovaries reached the MII stage, as evidenced by extrusion of the first polar body. Of the matured oocytes used for NT, 91% and 85% resulted in successful couplets derived from oocytes from FSH-stimulated and abattoir-derived ovaries, respectively. The rate of fusion of NT embryos reconstructed from oocytes from either FSH-stimulated or abattoir-derived ovaries was 63% (range, 22%–79%) and 57% (range, 45%–81%), respectively. There was no significant difference between the two treatment groups for maturation rate, couplet production rate, or fusion rate.
Embryo Development and Cloned Transgenic Offspring
There was no effect of oocyte source on the number of fused couplets that developed to the two- to four-cell stages (57% vs. 56%; Table 2). Only high-quality reconstructed embryos (those with equal size blastomeres and no fragmentation) at the two- to four-cell stages were transferred into recipient females. Moreover, 92% of the two- to four-cell embryos resulting from oocytes derived from FSH-stimulated ovaries were classified as high quality, but the rate was not different when compared with those reconstructed embryos produced from oocytes from abattoir-derived ovaries (70%).
|
A total of 23 similar recipient does received an average of 8 embryos/female (range, 1–15 embryos/female). Five of the recipients maintained conceptuses throughout gestation, and each gave birth to a single offspring. The three recipients that maintained pregnancies from the FSH-stimulated group each received an average of 7.6 embryos (range, 7–8 embryos). The two recipients that maintained pregnancies in the abattoir ovary group each received nine reconstructed embryos. The pregnancy rate (defined as the number of pregnant recipients per total number of recipients) at 30 days of gestation was 21% (3/14) and 22% (2/9) for the FSH-stimulated group and the abattoir-derived group, respectively. The overall pregnancy rate was 21.7% (5 of 23 recipients). Based on the number of offspring produced per number of embryos transferred, the cloning efficiency was 2.7% for both the FSH-stimulated and abattoir-derived groups (3/112 and 2/72, respectively). All pregnancies were produced from donor cells that originated from the fifth or sixth passage of the transgenic fetal fibroblast cell line.
In this study, 100% of the Day 30 pregnancies culminated in the births of live, healthy offspring, with no fetal loss and no postpartum morbidity. Two of the recipients gave birth at 149 and 151 days of gestation. Parturition was induced in the other three recipient females at Day 152 of gestation, and they gave birth between 24 and 36 h postinduction. All kids were vigorous and healthy at birth and weighed an average of 3.8 kg (SEM = 0.18 kg; range, 3.4–4.3 kg). Phenotypically, all five offspring had a similar coat color pattern and physical stature (Fig. 1). At this writing, all cloned animals have been weaned (Day 90) and are past 12 months of age. Mean weaning weight was 20.9 kg (SEM = 0.98 kg), with a range of 19.1–24.5 kg (Table 3). Each cloned animal has exhibited estrus and has been bred by an intact buck.
|
|
To verify that the cloned offspring were derived from the CFF-6 cell line, skin biopsies were screened for the presence of the hATIII transgene (Fig. 2). Induced milk samples also were positive for the presence of recombinant hATIII by Western blotting (data not shown).
|
DISCUSSION
Five cloned transgenic goats were produced through NT using a cell line derived from a transgenic fetus and oocytes obtained from either FSH-stimulated or abattoir-derived ovaries. At birth, all five kids were healthy and weighed between 3.4 and 4.3 kg, which is within the normal range for the breed. At weaning (90 days), body weights ranged from 19.1 to 24.5 kg, and all kids are continuing to grow as expected.
There was no significant difference in the percentage of matured oocytes successfully enucleated and reconstructed from the two oocyte sources (FSH-stimulated ovaries vs. abattoir-derived ovaries). There was also no difference in the fusion rate for oocytes derived from FSH-stimulated ovaries (63%) and those derived from abattoir ovaries (57%). Similar fusion rates (59%) of fetal fibroblasts with cytoplasts from abattoir ovaries in the cow have also been reported [21, 22, 26], and fusion rates (85%) of fetal fibroblasts with cytoplasts from FSH-stimulated sheep tend to be higher [2]. Oocyte source also had no effect on embryo development and overall pregnancy rate in the two treatment groups.
Recipient synchronization with NT embryo age likely affects pregnancy rates. In our study, all two- to four-cell stage NT embryos were transferred into recipients that were in estrus 36–48 h previously. Because mixed-breed goats usually ovulate 24–36 h after the onset of estrus, we calculated that at the time of embryo transfer the recipients would be 12–24 h postovulation. This would then be the time of first embryonic division, and the asynchrony between recipient and NT embryo stage was used in an effort to compensate for slowly developing NT embryos. Following in vitro maturation, the time for NT embryos to reach the two- to four-cell stage (36–40 h) appears to be slightly longer than required for embryos produced by in vitro fertilization (30–36 h) [41].
An interesting aspect of this study was the fact that all detected pregnancies resulted in the births of healthy kids, with no fetal loss occurring from Day 30 to parturition and no postnatal morbidity. However, we cannot speculate on the number of pregnancies that were initiated and lost before the first ultrasound evaluations on Day 30 nor can we rule out the possibility of undetected twins before Day 30 that resorbed. Although it is possible to detect fetal heartbeats in the sheep (and possibly the goat) as early as Day 25 [50], this method places considerable stress on the animal because it must be restrained and placed in dorsal recumbency. To minimize this stress to our potentially pregnant recipients, this method was not used. Other groups developing NT procedures in the goat have recently reported similar perinatal viability in NT offspring [8, 39]. In contrast, nearly 50% of the pregnancies resulting from cattle NT embryos are lost during the first trimester of gestation; most of these losses are thought to be caused by poor placentae and placentome development [24]. In addition, lethal postnatal complications (pneumonia, cardiac abnormalities) arising in cloned newborn calves have been a major problem [24]. These variations between the cow and and the goat could be due to inherent differences between the two species or differences in the NT procedure. In our study, reconstructed caprine embryos were transferred into the oviduct at the two- to four-cell stages. Therefore, the reconstructed embryos underwent a relatively short in vitro culture period.
In this study, a total of 184 embryos were transferred into 23 recipient females. Five of the 23 recipients (21%) maintained pregnancies and subsequently gave birth to healthy offspring. This pregnancy rate, based on the number of pregnant recipients per total number of recipients, is greater than the 5.3% pregnancy rate previously reported by Baguisi et al. [7] in the goat but lower than the 38%–44% pregnancy rate reported by Keefer et al. [8, 39]. Although 100% of the recipients that were determined pregnant by ultrasonography on Day 30 in this study delivered normal kids, the efficiency of the cloning procedure (based on the number of offspring per number of embryos transferred) was 2.7%, similar to that reported by Baguisi et al. [7]. The cloning efficiency reported by Keefer et al. [8, 39] ranged from 6.2% to 7.3%. In the sheep, overall cloning efficiency ranges from 4.8% to 20%, depending on the cell type used [2, 16].
Another important outcome of this study was the production of cloned offspring using abattoir-derived oocytes as a source of recipient cytoplasts. Until now, cloned goats have only been produced using cytoplasts obtained from oocytes aspirated from FSH-stimulated live donor animals [7, 8, 39]. Abattoir oocytes would likely be easier to obtain and more cost effective than maintaining and stimulating a herd of donor goats.
There was no difference in the number of cloned goat offspring produced from oocytes harvested from FSH-stimulated donor animals and from oocytes aspirated from abattoir ovaries. All of the conceptuses were maintained throughout gestation, with no fetal wastage or abortions, and all transgenic kids have remained healthy after parturition.
FOOTNOTES
1 This manuscript was submitted with the approval of the Director of the Louisiana Agricultural Experiment Station as Manuscript 01-11-0277. This study was part of the W-171 Federal Regional Project. This research was supported in part by funds from the Louisiana Agricultural Experiment Station and by a research grant from Genzyme Transgenics, Framingham, MA. 
2 Correspondence: Robert Godke, Department of Animal Science, Louisiana State University, 105 Francioni Hall, Baton Rouge, LA 70803. FAX: 225 642 0048; rgodke{at}agctr.lsu.edu
Accepted: June 20, 2001.
Received: April 16, 2001.
REFERENCES
This article has been cited by other articles:
|
|
 |
|
  V. Bordignon, R. Keyston, A. Lazaris, A. S. Bilodeau, J. H.F. Pontes, D. Arnold, G. Fecteau, C. Keefer, and L. C. Smith Transgene Expression of Green Fluorescent Protein and Germ Line Transmission in Cloned Calves Derived from In Vitro-Transfected Somatic Cells Biol Reprod, June 1, 2003; 68(6): 2013 - 2023. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Hill, D. H. Schlafer, P. J. Fisher, and C. J. Davies Abnormal Expression of Trophoblast Major Histocompatibility Complex Class I Antigens in Cloned Bovine Pregnancies Is Associated with a Pronounced Endometrial Lymphocytic Response Biol Reprod, July 1, 2002; 67(1): 55 - 63. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
