Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Queiróz, D. B.C.
Right arrow Articles by Avellar, M. C. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Queiróz, D. B.C.
Right arrow Articles by Avellar, M. C. W.
Agricola
Right arrow Articles by Queiróz, D. B.C.
Right arrow Articles by Avellar, M. C. W.
Biology of Reproduction 66, 508-515 (2002)
© 2002 Society for the Study of Reproduction, Inc.


Regular Article

{alpha}1-Adrenoceptor Subtypes in Rat Epididymis and the Effects of Sexual Maturation1

Daniel B.C. Queiróza, Fúlvio R. Mendesa, Catarina S. Portoa, and Maria Christina W. Avellar2,a

a Section of Experimental Endocrinology, Department of Pharmacology, Universidade Federal de São Paulo-Escola Paulista de Medicina, 04044-020 São Paulo, Brazil


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have characterized the expression of {alpha}1-adrenoceptor in epididymis from rats in different stages of sexual maturation: 40 (immature), 60 (young adult), and 120 (adult) days of age. Plasma testosterone levels were low in the immature animals but increased significantly in the 60- and 120-day-old animals. These changes were followed by a progressive increase in rat body weight and in caput and cauda epididymis relative weight. Reverse transcription polymerase chain reaction assay indicated that {alpha}1a-, {alpha}1b-, and {alpha}1d-adrenoceptor transcripts were present in both caput and cauda epididymis from adult rats. Ribonuclease protection assays further indicated that the expression of these {alpha}1-adrenoceptor transcripts differed with age and epididymal region analyzed. Prazosin (nonselective {alpha}1 antagonist), 5-methyl urapidil ({alpha}1A-selective), and BMY 7378 ({alpha}1D-selective) displaced [3H]prazosin binding curves in caput and cauda epididymis from 40- and 120-day-old rats. The potency order for these antagonists, as calculated from the negative logarithm of the inhibition constant (pKi) values for the high-affinity sites, indicated a predominant population of {alpha}1A-adrenoceptor subtype in caput and cauda epididymis from adult animals. Differences in pKi values in caput and cauda epididymis from immature and adult animals also suggested that the relative amount of {alpha}1-adrenoceptors, at the protein level, is modulated by sexual maturation. Taken together, the changes in {alpha}1-adrenoceptor expression during sexual maturation may suggest specific roles for these receptors in epididymal function.

catecholamines, developmental biology, epididymis, gene regulation, male reproductive tract


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The epididymis is an organ in which sperm undergo final maturation and storage prior to ejaculation. It receives, particularly in the cauda region, autonomic innervation [1, 2]. Numerous histochemical studies have demonstrated that adrenergic and cholinergic nerve fibers course through the epididymal interstitium and are primarily associated with vascular and muscular elements [35]. The distribution of these nerve fibers, however, varies between the distinct epididymal regions. The cauda epididymis, with its thick muscular wall, is more richly supplied with nerve fibers [3, 6] and contains greater concentrations of the adrenergic neurotransmitters adrenaline and noradrenaline compared with the caput region [7].

The primary function of the autonomic innervation within the epididymis is to mediate neuromuscular events required for the transport of spermatozoa through the duct [810]. It is well known that the contractile response of cauda epididymis to nerve stimulation is primarily mediated by noradrenaline and ATP as cotransmitters released from the sympathetic nerve endings [11]. The effects of autonomic drugs on the spontaneous activity of the epididymis in the mouse in vitro [12] and in the ram in vivo [13] have been reported. Studies using both surgical and guanetidine-induced denervation have shown a decrease in the contractility and a delay in cauda luminal transit, with a significant increase in the number of spermatozoa present in cauda epididymis [1417]. The effect of the loss of innervation on the quality of sperm is, however, contradictory. Billups et al. [14] reported changes in epididymal histology, luminal fluid protein, and sperm motion parameters after removal of rat inferior mesenteric ganglion. Ricker et al. [17] also found significant decreases in the fertility of cauda epididymis sperm at 1 and 4 wk after surgical denervation. Kempinas et al. [15, 16], however, observed that either surgical or chemical sympathectomy, induced in this case by low-level guanetidine exposure, resulted in a prolonged transit time of the sperm within epididymis, with no effects on the quality of the sperm collected from the distal cauda epididymis.

Three pharmacological {alpha}1-adrenoceptor subtypes ({alpha}1A, {alpha}1B, and {alpha}1D), corresponding to the 3 {alpha}1-adrenoceptor subtypes characterized by molecular cloning techniques ({alpha}1a, {alpha}1b, and {alpha}1d), have been identified recently [18]. All these receptor subtypes show high affinity to the nonspecific {alpha}1-adrenoceptor antagonist prazosin, and they are differentially expressed in many tissues of different species [1820]. A fourth {alpha}1-adrenoceptor subtype designated {alpha}1L, which has not been cloned yet, exhibits lower affinity to prazosin and has been reported to be involved with contraction of human, rabbit, and dog lower urinary tract tissues [2124]. Recently, isoforms of the human and rabbit {alpha}1A-adrenoceptor generated by alternative splicing have been identified; these isoforms differ in length and sequence in the carboxyl terminal region [2527]. The physiological significance of these isoforms remains to be clarified.

In the rat, the cauda epididymis contains postjunctional {alpha}1- but not {alpha}2-adrenoceptor [11, 28], whereas in the guinea pig, the cauda epididymis contains both {alpha}1- and {alpha}2-adrenoceptor, which mediate contraction [29]. Several researchers have also suggested that noradrenaline may play a role in mediating epididymal epithelial cell functions, including electrolyte transport through the stimulation of {alpha}1- and ß-adrenoceptor [30] and protein processing [17]. Studies by Bhathal et al. [31] and Ratnasooriya and Wadsworth [32, 33] have shown that the rat epididymis is significantly affected by {alpha}1-adrenoceptor blockade. In vivo treatment with different {alpha}1-adrenoceptor antagonists induces a decrease in ejaculatory capacity associated with a reduction in the fertilization ability of the sperm, suggesting a role for the sympathetic nervous system in fertility maintenance via {alpha}1-adrenoceptors [32, 33]. The purpose of the present work was to determine using molecular and pharmacological approaches which {alpha}1-adrenoceptor subtypes are expressed along rat epididymis and whether changes occur in the pattern of expression of these receptors in different stages of rat sexual maturation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals and Tissue Isolation

Male Wistar rats were housed in the Animal Facility at Instituto Nacional de Farmacologia, Universidade Federal de São Paulo (UNIFESP)-Escola Paulista de Medicina. Animals were maintained on a 12L:12D lighting schedule at 20°C, with food and water ad libitum. The animals were killed at 40 (immature rats), 60 (young rats), and 120 (adult rats) days of age using the guidelines for the care and use of laboratory animals approved by the Research Committee from UNIFESP-Escola Paulista de Medicina. The epididymides were removed, dissected, free of fat, and sectioned into 3 segments: caput, corpus, and cauda. Caput and cauda were used in the present experiments. Total epididymis was used for the determination of the wet weight.

Measurement of Testosterone Levels

Blood from the aorta artery was collected, and the plasma levels of testosterone were measured by RIA using Coat-A-Count Total Testosterone kit (Diagnostic Products Co., Los Angeles, CA) according to manufacturer's instructions. The assay detection limit was 0.04 ng/ml, and the intraassay and interassay coefficients of variation were 2.4% and 2.8%, respectively.

RNA Isolation

Caput and cauda epididymis, brain, and heart were removed from the rats, rapidly snap frozen in liquid nitrogen, and stored at -75°C until use. Total RNA was extracted as previously described by Chirgwin et al. [34]. RNA samples were then quantitated, using a spectrophotometer at 260/280 nm and stored at -75°C for later use.

Reverse Transcription Polymerase Chain Reaction Assays

Reverse transcription polymerase chain reaction (RT-PCR) amplification was performed using a SUPERScript II RT kit preamplification system for first strand cDNA synthesis according to manufacturer's instructions (Gibco-BRL, Gaithersburg, MD). Reverse transcription of total RNA (5 µg) using oligo(dT)12–18 (0.5 µg) was performed in a reaction volume of 20 µl. Reactions in the absence of reverse transcriptase were also included for each RNA tested to check for genomic contamination. The resulting cDNA (2 µl) was amplified using PCR conditions previously described [35]. Primer sequence, corresponding base sites, and sizes of the PCR products for each {alpha}1-adrenoceptor mRNA subtype were as follows: {alpha}1a sense, GTAGCCAAGAGAGAAAGCCG (628–647) and {alpha}1a antisense, CAACCCACCACGATGCCCAG (820–839) ({Delta} 212 base pairs [bp]); {alpha}1b sense, GCTCCTTCTACATCCCGCTCG (629–649) and {alpha}1b antisense, AGGGGAGCCAACATAAGATGA (908–928) ({Delta} 300 bp); {alpha}1d sense, CGTGTGCTCCTTCTACCTACC (759–779) and {alpha}1d antisense, GCACAGGAGGAAGAGACCCAC (1042–1062) ({Delta} 304 bp). Aliquots of the DNA samples (10 µl) were loaded onto agarose gels (1.8%) containing ethidium bromide (0.5 µl/ml). PCR products were visualized with fluorescent illumination and photographed. The authenticity of each target gene PCR product was confirmed by direct nucleotide sequencing performed with an ABI PRISM 377 automated sequencer (Applied Biosystems, Foster City, CA) and a BigDye Terminator sequencing kit (Applied Biosystems).

Ribonuclease Protection Assays

RNA labeling Linearized {alpha}1-adrenoceptor constructs were used to make antisense-strand RNA probes. RNA probes were radiolabeled with [{alpha}32P]UTP (800 Ci/mmol, 10 mCi/ml; New England Nuclear, Boston, MA) in the presence of T7 RNA polymerase with a MAXIscript in vitro transcription kit (Ambion, Austin, TX) and purified on an 8 M urea/5% polyacrylamide gel prior to use. DNA templates for antisense {alpha}1-adrenoceptor RNA synthesis were provided by Dr. Paul C. Simpson (University of San Francisco, San Francisco, CA) and were described previously [36]. Linearized plasmid containing a 413-bp glyceraldehyde phosphate dehydrogenase (GAPDH) gene fragment in the antisense orientation under the transcriptional control of SP6 promoter was from Ambion. Sizes of the probes and protected fragments, respectively, were as follows: {alpha}1a, 408 and 315 nucleotides; {alpha}1b, 495 and 432 nucleotides; {alpha}1d, 267 and 217 nucleotides; and GAPDH, 413 and 316 nucleotides. For each {alpha}1-adrenoceptor probe, the fraction of uridine residue available for radiolabeling was similar: {alpha}1a, 25%; {alpha}1b, 20%; {alpha}1d, 19%.

Hybridization Hybridization of RNA probes to caput and cauda epididymis total RNA was performed by using an RPA II kit (Ambion) according to the manufacturer's instructions. Total RNA from rat brain and heart were used as positive controls for {alpha}1a (brain)-, {alpha}1d (brain)-, and {alpha}1b (heart)-adrenoceptor expression. Total RNA (90 µg) and radiolabed probe (2 x 106 cpm) were coprecipitated and then resuspended in 20 µl of hybridization solution (80% deionized formamide, 100 mM sodium citrate, pH 6.4, 300 mM sodium acetate, pH 6.4, 1 mM EDTA). Probe excess was confirmed in experiments with increasing amounts of total RNA. After denaturation at 85°C for 10 min, samples were incubated at 58°C for 12–14 h. At the end of this hybridization procedure, 0.25 U/ml RNase A and 10 U/ml RNase T1 were added to digest unprotected RNA. After precipitation, pellets were resuspended in 8 µl of loading buffer (95% formamide, 0.025% xylene cyanol, 0.025% bromophenol blue, 0.5 mM EDTA, 0.025% SDS), and samples were separated by electrophoresis on a denaturing 8 M urea/5% polyacrylamide gel, followed by drying and exposure to XAR-5 film (Kodak, Rochester, NY) at -70°C. Some control reactions included labeled probes hybridized with yeast RNA (90 µg; with or without RNase digestion). The sizes of the mRNAs were determined on the gel by comparison with the 0.1- to 1.0-kilobase 32P-RNA Century Marker Template set (Ambion). The autoradiograph was scanned using a densitometer (Shimadzu Scientific Instruments, Princeton, NJ). The steady-state level of each mRNA transcript, as estimated by the area under the curve, was normalized against that of the GAPDH mRNA in each sample. Because the ratio between the levels of {alpha}1-adrenoceptor and GAPDH mRNA depended on the exposure time of the autoradiograph, the normalized data of the different groups were expressed as the percentage of this ratio obtained for 40-day-old rats in each experiment.

Tissue Membrane Preparation

Rat caput and cauda epididymis were minced in ice-cold buffer (25 mM Tris-HCl, pH 7.4, 5 mM MgCl2, 1 mM EDTA, 1 mM PMSF, 100 µg/ml bacitracin, 0.3 M sucrose) and homogenized with a homogenizer Ultra-Turrax (T25, Ika Labortechnik, Staufen, Germany). The homogenate was centrifuged (1000 x g, 10 min, 4°C). The supernatant was saved, and the pellet was resuspended in the same buffer. After centrifugation (1000 x g, 10 min, 4°C), the supernatant was collected in the same tube with the previous supernatant. Samples were then centrifuged (100 000 x g, 1 h, 2°C). The final pellet was resuspended in binding buffer (25 mM Tris-HCl, pH 7.4, 5 mM MgCl2, 1 mM EDTA, 1 mM PMSF, 100 µg/ml bacitracin) using a Dounce homogenizer. The membrane preparation was aliquoted and stored at -70°C until use. Protein concentration was estimated with a protein reagent (Bio-Rad Laboratories, Hercules, CA) according to manufacturer's protocol.

Radioligand Binding Assay

Membrane preparations (200 µg protein/ml) were incubated with binding buffer containing 1.7 nM [3H]prazosin ([7-methoxy-3H]prazosin, specific activity = 76 Ci/mmol; Amersham Life Science, Little Chalfont, Buckinghamshire, UK) for 1 h at 30°C in the absence or presence of increasing concentrations of the unlabeled {alpha}1-adrenoceptor antagonists prazosin (Sigma Chemical Co., St. Louis, MO), BMY 7378 (8-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]-8-azaspiro[4,5]decane-7,9-dionedihydrochloride; Research Biochemicals International, Natick, MA), and 5-methyl urapidil (Research Biochemicals International) in 500 µl of total volume. The binding reaction was stopped by rapid vacuum filtration through Whatmann GF/B glass fiber filters. The filters were washed 3 times with 2 ml of ice-cold binding buffer, partially dried under vacuum, and placed in scintillation vials containing Aquasol II (New England Nuclear). Radioactivity was measured in a scintillation ß-counter. Nonspecific binding was defined as binding in the presence of 10 µM of unlabeled prazosin. Competition binding data were analyzed using a weighted nonlinear least-square interactive curve-fitting program (GraphPad Prism; GraphPad Prism Software Inc., San Diego, CA). A mathematical model for 1 or 2 sites was applied. The inhibition constant (Ki) was determined from the competition curves using the Cheng and Prusoff equation [37], using 0.19 nM for the dissociation constant as obtained by Ventura and Pennefather [28]. The potency of the antagonist was expressed as the negative logarithm of the respective Ki value (pKi).

Statistical Analysis

Data are expressed as mean ± SEM. The ANOVA was followed by Bonferroni multiple range analysis, using the Instat program (GraphPad Prism Software). Differences at P < 0.05 were considered significant.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasma Testosterone Levels and Epididymis Wet Weight

Rat androgen status was monitored by measuring testosterone plasma levels. The low plasma testosterone levels observed in the immature rats (40-day-old) significantly increased with rat development (Fig. 1). The 4-fold increase in testosterone concentration observed in 60-day-old rats was maintained in the adult rats.



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 1. Plasma testosterone concentration in 40-, 60-, and 120-day-old rats. Values are expressed as mean ± SEM of 12–14 experiments. Different letters indicate significant differences (P < 0.05)

The effect of sexual maturation on rat body weight and on caput and cauda epididymis wet weight is shown on Table 1. Rat body weight significantly increased with age. Caput and cauda epididymis relative weight also increased significantly with progression of sexual maturation.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Effect of sexual maturation on body weight and caput and cauda epididymis relative weight (mg tissue wet weight/g body weight) from 40-, 60-, and 120-day-old rats. Data are expressed as mean ± SEM of the number of experiments in parentheses.*

Identification of {alpha}1-Adrenoceptor mRNA Subtypes by RT-PCR

All 3 {alpha}1-adrenoceptor subtypes were amplified by RT-PCR with total RNA from caput and cauda epididymis from 120-day-old rats (Fig. 2). The primers were able to amplify {alpha}1a, {alpha}1b, and {alpha}1d cDNAs, and each PCR product was of the predicted size and nucleotide sequence. No PCR products were detected when reverse transcriptase was omitted from the PCRs, demonstrating that the amplified products were from cDNA and not from genomic DNA (data not shown).



View larger version (95K):
[in this window]
[in a new window]
 
FIG. 2. Gel electrophoresis of {alpha}1a-, {alpha}1b-, and {alpha}1d-adrenoceptor RT-PCR products amplified from total RNA from caput and cauda epididymis from 120-day-old rats. Molecular weight (MW) is a 100-bp DNA standard ladder, and arrow indicates the 600-bp band. Specific amplified gene product sizes: {alpha}1a, 212 bp; {alpha}1b, 300 bp; {alpha}1d, 304 bp. Results are representative of 3 experiments

Quantification of {alpha}1-Adrenoceptor mRNA Subtypes by RNase Protection Assay

RNase protection assays were performed on total RNA from caput and cauda epididymis from 40-, 60-, and 120-day-old rats. A single band was detected at the predicted position for each protected mRNA species (Fig. 3A). Considering the results obtained from young and adult animals, {alpha}1a and {alpha}1d mRNA subtypes were present in cauda region, and {alpha}1a was the predominant receptor mRNA subtype in the caput region. Although {alpha}1b-adrenoceptor mRNA was abundant when total RNA from rat heart was used as a positive control (data not shown), this transcript type was present in very small amounts in both the caput and cauda regions when compared with the other 2 transcript subtypes. The expression of mRNA for GADPH did not differ between the caput and the cauda epididymis or among the different age groups in both epididymal regions. According to densitometry studies, the relative expression of {alpha}1a-adrenoceptor mRNA in the caput epididymis decreased significantly from 40 to 60 days and but not change between 60 and 120 days (Fig. 3B). In the cauda region, {alpha}1a expression decreased from 40 to 60 days and then returned in the adult animals (120-day-old) to the same levels observed in 40-day-old rats. The expression of {alpha}1d-adrenoceptor, however, increased from 40 to 60 days.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 3. Ribonuclease protection assay for {alpha}1-adrenoceptor subtype expression in caput and cauda epididymis from 40-, 60-, and 120-day-old rats. A) Protected fragments of {alpha}1a-, {alpha}1b-, and {alpha}1d-adrenoceptor and GAPDH mRNA were separated on an 8 M urea/5% polyacrylamide gel and are indicated by respective arrows. Autoradiographs were exposed for 8 h and 72 h for the detection of GAPDH and {alpha}1-adrenoceptor protected fragments, respectively. B) Quantitative results obtained by scanning of autoradiographs with a densitometer. Each bar and vertical line represent relative steady-state levels of mRNA encoding {alpha}1a- and {alpha}1d-adrenoceptor subtypes. Data are expressed as percentage (mean ± SEM) of the results obtained in tissues from 40-day-old rats (control). Results are representative of 5–7 experiments. Different letters indicate significant differences (P < 0.05)

Effect of Competitive {alpha}1-Adrenoceptor Antagonists on the Specific [3H]Prazosin Binding to Epididymal Membranes

Prazosin (nonspecific {alpha}1 antagonist), 5-methyl urapidil ({alpha}1A-selective antagonist), and BMY 7378 ({alpha}1D-selective antagonist) produced displacement curves of [3H]prazosin bound to membrane preparations from caput and cauda epididymis from 40- and 120-day-old rats (Fig. 4). Table 2 summarizes pKi values calculated for each antagonist.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 4. Displacement curves of [3H]prazosin bound to caput (A) and cauda (B) epididymis from 40- and 120-day-old rats in the presence of increasing concentrations of different unlabeled {alpha}1-adrenoceptor antagonists: prazosin ({block}), 5-methyl urapidil (), and BMY 7378 ({blacktriangleup}). Data are plotted as percentage of binding in the absence of antagonists. Each point and vertical bar represents the mean ± SEM of 5 experiments


View this table:
[in this window]
[in a new window]
 
TABLE 2. Affinities (pKi values) of {alpha}1-adrenoceptor antagonists calculated from displacement curves of [3H]prazosin bound to caput and cauda epididymis from 40- and 120-day-old rats. Data are expressed as mean ± SEM of 3 or 4 experiments performed in triplicate.*

In the caput epididymis from 40-day-old rats, the displacement curves induced by prazosin indicated a significant preference for 1-site fit (Fig. 4). In the cauda epididymis from immature rats and in the caput and cauda epididymis from adult animals (120-day-old), the displacement curves were resolved in a 2-site fit, defining 2 {alpha}1-adrenoceptor binding sites with high (pKiH) and low (pKiL) affinity (Table 2). When 5-methyl urapidil was used as an antagonist, all displacement curves were biphasic except in the cauda region from 40-day-old rats, which was resolved with a 1-site fit (Fig. 4 and Table 2). Monophasic displacement curves were obtained for BMY 7378 in the caput and cauda epididymis from immature and adult rats (Fig. 4 and Table 2).

Changes in {alpha}1-adrenoceptor affinity with sexual maturation were assessed by comparing pKiH values. The potency order calculated in caput and cauda epididymis from adult rats was prazosin = 5-methyl urapidil >> BMY 7378. In the immature rats, the rank order depended on the portion analyzed: 5-methyl urapidil > prazosin = BMY 7378 in the caput epididymis; prazosin > 5-methyl urapidil = BMY 7378 in the cauda epididymis.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In the present work, the expression and changes in {alpha}1-adrenoceptor subtypes in the epididymis with sexual maturation was characterized. RT-PCR studies indicated that all 3 {alpha}1-adrenoceptor transcript subtypes are present in both caput and cauda epididymis from adult (120-day-old) rats. Ribonuclease protection assay, a sensitive method for RNA quantification, indicated that the level of each {alpha}1-adrenoceptor mRNA was different depending on the epididymal region analyzed. In tissues from adult animals, {alpha}1a-adrenoceptor mRNA was predominant in the caput region and {alpha}1a- and {alpha}1d-adrenoceptor mRNA were abundant in the cauda. Transcripts for {alpha}1b-adrenoceptor were rare in both the caput and cauda regions compared with the other 2 transcripts. Heterogeneity of {alpha}1-adrenoceptor mRNA expression, with predominance of {alpha}1a mRNA subtype, is a common finding in tissues from the rat and human male reproductive tracts, including proximal urethra, prostate, testis, and seminal vesicle [35, 36, 3841]. In human bladder, {alpha}1a- and {alpha}1d-adrenoceptor transcripts have been detected, with predominance of the {alpha}1a subtype [42], whereas in the rat bladder all 3 transcripts were equally expressed [43]. The expression of {alpha}1d-adrenoceptor mRNA, detected in abundance in the cauda epididymis of adult rats in the present work, has been also demonstrated in human prostate [39, 44] and rat seminal vesicle [35]. Cauda epididymis is anatomically associated with the epididymal portion of the rat vas deferens, another tissue presenting an abundant expression of {alpha}1d-adrenoceptor transcripts in the male reproductive tract [36, 4547]. Consideration should be given to the fact that {alpha}1b-adrenoceptor transcript was more readily detected by RT-PCR assay than by ribonuclease protection assay when RNA from caput and cauda epididymis was tested. Similar discrepancies have been reported in other systems and could be related to the higher sensitivity of RT-PCR for transcript detection [48, 49].

Ribonuclease protection assays also revealed that the effect of sexual maturation on {alpha}1-adrenoceptor mRNA subtype levels differed depending on the epididymal region analyzed. There was a reduction in {alpha}1a-adrenoceptor mRNA expression in caput epididymis from immature (40-day-old) to young adult (60-day-old) and adult (120-day-old) rats, with no change in the low level of expression for {alpha}1b and {alpha}1d transcripts. In the cauda region, {alpha}1a-adrenoceptor transcripts decreased from 40 to 60 days, returning in the adult animals to the same levels observed in the immature rats. {alpha}1d-Adrenoceptor transcripts, however, increased with age. These changes in {alpha}1-adrenoceptor expression occurred in parallel, with no changes in the expression of the housekeeping gene GAPDH. Thus, the qualitative and quantitative changes in the expression of the different {alpha}1-adrenoceptor transcripts suggest specific roles for these receptors in epididymal function over the course of sexual maturation.

Ventura and Pennefather [28], using [3H]prazosin-binding studies, suggested that {alpha}1- but not {alpha}2-adrenoceptor subtypes are present in the rat cauda epididymis. In the present work, radioligand binding studies were used to confirm that {alpha}1-adrenoceptor at the protein level is expressed in caput and cauda epididymis during sexual maturation. The {alpha}1-adrenoceptor antagonists prazosin, 5-methyl urapidil, and BMY 7378 displaced [3H]prazosin-binding curves in both caput and cauda epididymis from 40- and 120-day-old rats, showing that {alpha}1-adrenoceptor is present at the protein level in rat epididymis.

Caput and cauda epididymis from adult animals (120-day-old) exhibited biphasic competition curves in response to [3H]prazosin binding when unlabeled prazosin and 5-methyl urapidil were used as competitors. Analysis of these curves indicated the presence of 2 {alpha}1-adrenoceptor binding sites: high affinity and low affinity. The same biphasic competition binding curves and similar high-affinity sites for prazosin and 5-methyl urapidil have been observed in membrane preparations from rabbit [50], human [21], and rat [41] prostate, where {alpha}1A-adrenoceptors are reported. Thus, the detection of high-affinity sites for prazosin and 5-methyl urapidil in the caput and cauda epididymis in the present study indicates that {alpha}1A-adrenoceptors are present along rat epididymis. The presence of a low-affinity site for prazosin and 5-methyl urapidil in both regions of the rat epididymis suggests the presence of different pharmacological profiles for {alpha}1A-adrenoceptor or heterogeneous {alpha}1-adrenoceptor subtype population ({alpha}1B- and/or {alpha}1D-adrenoceptor). Transcript levels for {alpha}1b-adrenoceptor were very low in both the caput and cauda regions. Furthermore, the characterization of {alpha}1B-adrenoceptor by radioligand binding cannot be clearly identified using available antagonists because chloroethylclonidine can alkylate all accessible {alpha}1A-adrenoceptor subtypes [51]. The use of BMY 7378, however, did not reveal the presence of {alpha}1D-adrenoceptor subtype in caput and cauda epididymis because pKi values were lower than those obtained for the same antagonist in {alpha}1D-adrenoceptor preparations [5256]. Where {alpha}1d-adrenoceptor transcripts have been detected, steep and monophasic competition curves and low affinity to BMY 7378 have also been reported in tissues, such as rat heart, prostate, vas deferens, salivary gland, and liver [54, 57]. Comparing the pKiH values obtained in the competition binding studies in caput and cauda epididymis from adult animals, the potency order of the competitive antagonists for [3H]prazosin binding was prazosin = 5-methyl urapidil >> BMY 7378, suggesting a predominant population of {alpha}1A-adrenoceptors. A predominant population of {alpha}1A-adrenoceptors has also been described in rat and human vas deferens [5862] and prostate [6365] and in rat seminal vesicle [35, 66, 67].

In immature rats (40-day-old), the potency order of the {alpha}1-adrenoceptor antagonists to displace [3H]prazosin was dependent on the epididymal region analyzed. In caput epididymis, the potency order was 5-methyl urapidil > prazosin = BMY 7378, and in the cauda epididymis the order was prazosin > 5-methyl urapidil = BMY 7378. The pKiH values, obtained in the caput region to prazosin (8.43 ± 0.16) and in the cauda region to 5-methyl urapidil (8.02 ± 0.48), were still within the pKi range described previously for these antagonists in tissues and cells expressing {alpha}1A-adrenoceptors [68, 69]. Thus, caput and cauda epididymis from immature and adult rats present a predominant population of {alpha}1A-adrenoceptors. Several studies have shown that {alpha}1A-adrenoceptors mediate contraction of the epididymal portion of the rat vas deferens [70], prostate [68], and seminal vesicle [35], although {alpha}1b- and {alpha}1d-adrenoceptor transcripts have been detected in these tissues. Differences in the nature of biphasic competition curves for prazosin and 5-methyl urapidil with sexual maturation will need to be explored further. Shen et al. [71], using Western blot analysis, reported that {alpha}1-adrenoceptor subtype proteins are expressed in most rat tissues, including vas deferens and prostate, to a varying degree and are affected differently by ontogeny. Considering the fact that different cell types are present along the epididymis, further immunological studies with selective antibodies against {alpha}1A-, {alpha}1B-, and {alpha}1D-adrenoceptor subtypes will be important for localizing and determining the relative importance of {alpha}1-adrenoceptors in rat epididymis.

Proper development of the epididymis requires molecular signaling pathways mediated by steroid hormones and various growth factors. An important question raised by the present results concerns the physiological significance of the qualitative and quantitative changes in {alpha}1-adrenoceptor expression in caput and cauda epididymis during the course of sexual maturation. Testosterone has been reported to increase {alpha}1-adrenoceptor in rat tail arteries, whereas gonadectomy attenuated the total apparent number of binding sites in spontaneously hypertensive rats [72]. Philippe et al. [73] observed a >2-fold increase in the {alpha}1-adrenoceptor in response to androgens in smooth muscle myocytes. In the male reproductive tract, the impact of androgens on {alpha}1-adrenoceptor expression is controversial. In dog urethra, both surgical castration and estrogen administration decreased {alpha}1-adrenoceptor and muscarinic receptors but increased {alpha}2-adrenoceptor density [74]. In rabbit bladder base and proximal urethra, a reduction in {alpha}1-adrenoceptor density, with no change in either ß2-adrenoceptor or muscarinic receptor density, was also demonstrated after castration [75]. No change in the absolute density of {alpha}1-adrenoceptor [76] and a downregulation of receptor reserves for the {alpha}1a-adrenoceptor population after castration has been detected in rat prostate [77]. Changes in {alpha}1-adrenoceptors with sexual maturation may be involved in regulating developmental events in rat epididymis. Thus, further studies will be necessary to understand the relative contribution in the rat epididymis of {alpha}1A-, {alpha}1B-, and {alpha}1D-adrenoceptor expression at the mRNA and protein levels.

The results of the present study indicated that different {alpha}1-adrenoceptor subtypes are present in caput and cauda epididymis. Furthermore, the impact of sexual maturation on the expression of these receptor subtypes differs depending on the region of the epididymis analyzed. Elucidation of the effect of qualitative and quantitative changes in {alpha}1-adrenoceptor expression on specific epididymal functions during the course of sexual maturation will be a major step toward understand the role of the sympathetic nervous system in male (in)fertility.


    ACKNOWLEDGMENTS
 
We thank Espedita Maria de Jesus dos Santos and Maria Damiana Silva for technical assistance.


    FOOTNOTES
 
First decision: 30 July 2001.

1 This study was supported in part by Fundação de Amparo à Pesquisa do Estado de São Paulo, Brazil (FAPESP, grant 96/1777-1) and T.W. Fogarty International, USA (subcontract UNC 5-53284); a Master fellowship supported by FAPESP (D.B.C.Q.); and a Researcher fellowship supported by Conselho Nacional do Desenvolvimento Científico e Tecnológico, Brazil (M.C.W.A. and C.S.P.). Part of this work was presented at the 24th annual meeting of the American Society of Andrology, Louisville, KY, 1999. Back

2 Correspondence: Maria Christina W. Avellar, Department of Pharmacology, Section of Experimental Endocrinology, UNIFESP-Escola Paulista de Medicina, Rua 03 de maio 100, INFAR, Vila Clementino, 04044-020 São Paulo, Brazil. FAX: 55 11 5576 4448; avellar.farm{at}infar.epm.br Back

Accepted: October 2, 2001.

Received: June 27, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Mitchel GAG. The innervation of the kidney, ureter, testicle and epididymis. J Anat 1953; 70:10-32
  2. Hodson N. The nerves of the testis, epididymis and scrotum. In: Johnson AD, Gomes WR, Vandemark NL (eds.), The Testis, vol. 1. New York: Academic Press, 1970: 47–99
  3. El-Badawi A, Schenk EA. The distribution of cholinergic an adrenergic nerves in the mammalian epididymis. A comparative histochemical study. Am J Anat 1967; 121:1-14[CrossRef][Medline]
  4. Norberg KA, Risley PL, Ungerstedt U. Adrenergic innervation of the male reproductive ducts in some mammals. I. The distribution of adrenergic nerves. Z Zellforsch Mikrosk Anat 1967; 76:278-286[CrossRef]
  5. Baumgarten HG, Falck B, Holstein AF, Owman C, Owman T. Adrenergic innervation of the human testis, epididymis, ductus deferens and prostate: a fluorescence microscopic and fluorimetric study. Z Zellforsch Mikrosk Anat 1968; 90:81-95[CrossRef][Medline]
  6. Kaleczyc J, Majewski M, Calka J, LaKomy M. Adrenergic innervation of the epididymis, vas deferens, accessory genital glands and urethra in the boar. Folia Histochem Cytobiol 1993; 31:117-123[Medline]
  7. Eliasson R, Kisley PL. Adrenergic innervation of the male reproductive ducts of some mammals. III. Distribution of noradrenaline and adrenaline. Acta Physiol Scand 1968; 73:311-319[Medline]
  8. Hib J, Ponzio RE, Vilar O. Contractile behavior of the rat epididymis after sympatectomy produced by the administration of guanethidine. Andrologia 1979; 11:461-465[Medline]
  9. Talo A, Jaakkola UM, Markkula-Viitanen M. Spontaneous electrical activity of the rat epididymis in vitro. J Reprod Fertil 1979; 57:423-429[Abstract/Free Full Text]
  10. Ricker DD. The autonomic innervation of the epididymis: its effects on epididymal function and fertility. J Androl 1998; 19:1-4[Free Full Text]
  11. Ventura S, Pennefather JN. Sympathetic co-transmission to the cauda epididymis of the rat: characterization of posjunctional adrenoceptors and purinoceptors. Br J Pharmacol 1991; 102:540-544[Medline]
  12. Hib J, Caldero-Barcia R. Neurohormonal control of epididymal contractions. In: Coutinho EM, Fuchs F (eds.), Physiology and Genetics of Reproduction, part B. New York: Plenum; 1974: 111
  13. Knight TW. A qualitative study of factors affecting the contractions of the epididymis and ductus deferens of the ram. J Reprod Fertil 1974; 40:19-29[Abstract/Free Full Text]
  14. Billups KL, Tillman SL, Chang TSK. Ablation of the inferior mesenteric plexus in the rat: alterations of sperm storage in the epididymis and vas deferens. J Urol 1990; 143:625-629[Medline]
  15. Kempinas WG, Suarez JD, Roberts NL, Strader L, Ferrell J, Goldman JM, Klinefelter G. Rat epididymal sperm quantity, quality and transit time after guanetidine-induced sympathectomy. Biol Reprod 1998; 59::890-896[Abstract/Free Full Text]
  16. Kempinas WG, Suarez JD, Roberts NL, Strader LF, Ferrell J, Goldman JM, Narotsky MG, Perreaulty SD, Everson DP, Ricker DD, Klinefelter GR. Fertility of rat epididymal sperm after chemically and surgically induced sympathectomy. Biol Reprod 1998; 59:897-904[Abstract/Free Full Text]
  17. Ricker DD, Chamness SL, Hinton BT, Chang TSK. Changes in luminal fluid protein composition in the rat cauda epididymis following partial sympathetic denervation. J Androl 1996; 17:117-126[Abstract/Free Full Text]
  18. Langer S. History and nomenclature of {alpha}1-adrenoceptors. Eur Urol 1999; 36:2-6[CrossRef][Medline]
  19. Docherty JR. Subtypes of functional alpha-1 and alpha-2 adrenoceptors. Eur J Pharmacol 1998; 361:1-15[CrossRef][Medline]
  20. Zhong H, Minneman K. {alpha}1-adrenoceptor subtypes. Eur J Pharmacol 1999; 375:261-276[CrossRef][Medline]
  21. Muramatsu I, Oshita M, Ohmura T, Kigoshi S, Akino H, Gobara M, Okada K. Pharmacological characterization of {alpha}1-adrenoceptor subtypes in the human prostate: functional and binding studies. Br J Urol 1994; 74:572-578[Medline]
  22. Ford APDW, Arredondo NF, Blue DR, Bonhaus DW, Jasper JR, Kava MS, Lesnick J, Pfister JR, Shieh IA, Vimont RL, Williams TJ, McNeal JE, Stacey TA, Clarke DE. RS 17053, a selective {alpha}1A adrenoceptor antagonist, displays low affinity for functional {alpha}1A adrenoceptors in human prostate: implications for adrenoceptor classification. Mol Pharmacol 1996; 49:209-215[Abstract]
  23. Testa R, Guarneri L, Taddei C, Poggesi E, Angelico P, Sartani A, Leonardi A, Gofrit ON, Meretyk S, Caine M. Functional antagonistic activity of Rec 15/2739, a novel alpha-1 antagonist selective for the lower urinary tract, on noradrenaline-induced contraction of human prostate and mesenteric artery. J Pharmacol Exp Ther 1996; 277::1237-1246[Abstract/Free Full Text]
  24. Fukasawa R, Taniguchi N, Moriyama N, Ukai Y, Yamazaki S, Ueki T, Kameyama S, Kimura K, Kawabe K. The alpha-1L adrenoceptor subtype in the lower urinary tract: a comparison of human urethra and prostate. Br J Urol 1998; 82:733-737[Medline]
  25. Daniels DV, Gever JR, Jasper JR, Kava MS, Lesnick JD, Meloy TD, Stepan G, Williams TJ, Clarke DE, Chang DJ, Ford APDW. Human cloned {alpha}1A-adrenoceptor isoforms display {alpha}1L-adrenoceptor pharmacology in functional studies. Eur J Pharmacol 1999; 370:337-343[CrossRef][Medline]
  26. Schwinn D, Price R. Molecular pharmacology of human {alpha}1-adrenergic receptors: unique features of the {alpha}1a-subtype. Eur Urol 1999; 36:7-10
  27. Suzuki F, Taniguchi T, Takauji R, Murata S, Muran I. Splice isoforms of {alpha}1a-adrenoceptor in rabbit. Br J Pharmacol 2000; 129:1569-1576[CrossRef][Medline]
  28. Ventura S, Pennefather JN. {alpha}2-Adrenoceptor binding sites vary along the length of the male reproductive tract: a possible basis for the regional variation in response to field stimulation. Eur J Pharmacol 1994; 254:167-173[CrossRef][Medline]
  29. Haynes JM, Hill SJ. {alpha}1-Adrenoceptor mediated responses of the cauda epididymis of guinea-pig. Br J Pharmacol 1996; 1203–1210
  30. Chan HC, Fu WO, Chung YW, Zhou TS, Wong PYD. Adrenergic receptors on cultured rat epididymal cells: regulation of Cl- conductances. Biol Reprod 1994; 51:1040-1045[Abstract]
  31. Bhathal PS, Gerkens JF, Mashford ML. Spermatic granuloma of the epididymis in rats treated with guanethidine. J Pathol 1974; 112:19-26[CrossRef][Medline]
  32. Ratnasooriya WD, Wadsworth RM. Impairment of fertility of male rats with prazosin. Contraception 1990; 41:441-447[CrossRef][Medline]
  33. Ratnasooriya WD, Wadsworth RM. Tamsulosin, a selective {alpha}1 adrenoceptor antagonist, inhibits fertility of male rats. Andrologia 1994; 26::107-110[Medline]
  34. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 1979; 24:5294-5299
  35. Silva MA, Megale A, Avellar MCW, Porto CS. Expression and pharmacological characterization of {alpha}1-adrenoceptors in rat seminal vesicle. Eur J Pharmacol 1999; 381:141-149[CrossRef][Medline]
  36. Rokosh DG, Bailey BA, Steward AFR, Karns LR, Long CS, Simpson PC. Distribution of {alpha}1C adrenergic receptor mRNA in adult rat tissues by RNase protection assay and comparison with {alpha}1B and {alpha}1D. Biochem Biophys Res Commun 1994; 200:1177-1184[CrossRef][Medline]
  37. Cheng YC, Prusoff WH. Relationship between the inhibition constant (Ki) and the concentration of inhibitor which causes 50 percent inhibition (IC50) of an enzymatic reaction. Biochem Pharmacol 1973; 22::3099-3108[CrossRef][Medline]
  38. Scofield MA, Liu F, Abel PW, Jeffries WB. Quantification of steady state expression of mRNA for alpha-1 adrenergic receptor subtypes using reverse transcription and a competitive polymerase chain reaction. J Pharmacol Exp Ther 1995; 275:1035-1042[Abstract/Free Full Text]
  39. Nasu K, Moriyama N, Fukasawa R, Tsujimoto G, Tanaka T, Yano J, Kawabe K. Quantification and distribution of alpha1-adrenoceptor subtype mRNAs in human proximal urethra. Br J Pharmacol 1998; 123:1289-1293[CrossRef][Medline]
  40. Nasu K, Moriyam N, Kawabe K, Tsujimoto G, Murai M, Tanaka T, Yano J. Quantification and distribution of {alpha}1-adrenoceptor subtype mRNAs in human prostate: comparison of benign hypertrophied tissue and non-hypertrophied tissue. Br J Pharmacol 1996; 119:797-803[Medline]
  41. Auger-Pourmarin L, Roubert P, Chabrier PE. {alpha}1-Adrenoceptors in testosterone-induced prostatic hypertrophy. Eur J Pharmacol 1998; 341::119-126[CrossRef][Medline]
  42. Malloy BJ, Price DT, Price RR, Bienstock AM, Dole MK, Funk BL, Rudner XL, Richardson CD, Donatucci CF, Schwinn DA. {alpha}1-Adrenergic receptor subtypes in human detrusor. J Urol 1998; 160:937-943[CrossRef][Medline]
  43. Andersson KE. {alpha}1-Adrenoceptors and bladder function. Eur Urol 1999; 36: (suppl 1): 96-102
  44. Moriyama N, Kurimoto S, Horie S, Nasu K, Tanaka T, Yano K, Hirano H, Tsujimoto G, Kawabe K. Detection of alpha 1-adrenoceptor subtypes in human hypertrophied prostate by in situ hybridization. Histochem J 1996; 28:283-288[CrossRef][Medline]
  45. Faure C, Pimoule C, Arbilla S, Langer SZ, Graham H. Expression of {alpha}1-adrenoceptor subtypes in rat tissues: implications for {alpha}1-adrenoceptor classification. Eur J Pharmacol 1994; 268:141-149[CrossRef][Medline]
  46. Kenny BA, Naylor AM, Greengrass PM, Russel MJ, Friend SJ, Resd AM, Wyllie MG. Pharmacological properties of the cloned {alpha}1A/D subtype are consistent with the {alpha}1A-adrenoceptor characterized in rat cerebral cortex and vas deferens. Br J Pharmacol 1994; 111:1003-1008[Medline]
  47. Moriyama N, Nasu K, Takeuchi T, Akiyama K, Murata S, Nishimatsu H, Yano J, Tsujimoto G, Kawabe K. Quantification and distribution of {alpha}1 adrenoceptor subtype mRNAs in human vas deferens: comparison with those of epididymal and pelvic portions. Br J Pharmacol 1997; 122:1009-1014[CrossRef][Medline]
  48. Borges MOR, Abreu MLC, Porto CS, Avellar MCW. Characterization of muscarinic acetylcholine receptor in rat Sertoli cells. Endocrinology 2001; 142:4701-4710[Abstract/Free Full Text]
  49. Dausse JP, Leriche A, Yablonski F. Patterns of messenger RNA expression for {alpha}1-adrenoceptor subtypes in human corpus cavernosum. J Urol 1998; 160:597-600[CrossRef][Medline]
  50. Hiraoka Y, Ohmura T, Sakamoto S, Hayashi H, Muramatsu I. Identification of alpha1-adrenoceptor subtypes in the rabbit prostate. J Auton Pharmacol 1995; 15:271-278[Medline]
  51. Hirasawa A, Sugawara T, Awaji T, Tsumaya K, Ito H, Tsujimoto G. Subtype-specific differences in subcellular localization of alpha1-adrenoceptors: chlorethylclonidine preferentially alkylates the accessible cell surface alpha1-adrenoceptors irrespective of the subtype. Mol Pharmacol 1997; 52:764-770[Abstract/Free Full Text]
  52. Goetz AS, King HK, Ward SDC, True TA, Rimele TJ, Saussy DL. BMY 7378 is an antagonist of the D subtype of {alpha}1-adrenoceptors. Eur J Pharmacol 1995; 272:r5-r6
  53. Kenny BA, Chalmers DH, Phipott PC, Naylor AM. Characterization of an {alpha}1D adrenoceptor mediating the contractile response of rat aorta to noradrenaline. Br J Pharmacol 1995; 115:981-986[Medline]
  54. Deng FD, Chemtob S, Varma DR. Characterization of {alpha}1D-adrenoceptor subtypes in rat miocardium, aorta and other tissues. Br J Pharmacol 1996; 119:269-276[Medline]
  55. Saussy DL, Goetz AS, Quenn KL, King HK, Lutz MW, Rimele TJ. Structure activity relationships of a series of buspirone analogs at alpha-1 adrenoceptors: further evidences that rat aorta alpha-1 adrenoceptors are of the alpha-1D-subtype. J Pharmacol Exp Ther 1996; 278::136-144[Abstract/Free Full Text]
  56. Yang M, Verfürth F, Büscher R, Michel M. Is {alpha}1D-adrenoceptor protein detectable in rat tissues?. Naunyn-Schmiedeberg's Arch Pharmacol 1997; 355:438-446[CrossRef][Medline]
  57. Yang HT, Endoh M. Pharmacological evidence for alpha(1D)-adrenoceptors in the rabbit ventricular myocardium: analysis with BMY 7378. Br J Pharmacol 1997; 122:1541-1550[CrossRef][Medline]
  58. Mallard NJ, Marshall RW, Sithers AJ, Spriggs TL. Separation of putative alpha 1A- and alpha 1B-adrenoceptor mediated components in the tension response of the rat vas deferens to electrical field stimulation. Br J Pharmacol 1992; 105:727-731[Medline]
  59. Aboud R, Shafii M, Docherty JR. Investigation of the subtypes of alpha 1-adrenoceptor mediating contractions of rat aorta, vas deferens and spleen. Br J Pharmacol 1993; 109:80-87[Medline]
  60. Burt RP, Chapple CR, Marshall I. Evidence for a functional {alpha}1A ({alpha}1C)-adrenoceptor-mediating contraction of the rat epididymal vas deferens and an {alpha}1B-adrenoceptor-mediating contraction of the rat spleen. Br J Pharmacol 1995; 115:467-475[Medline]
  61. Burt RP, Chapple CR, Marshall I. Alpha1A-adrenoceptor mediated contraction of rat prostatic vas deferens and the involvement of ryanodine stores and Ca2+ influx stimulated by diacylglycerol and PKC. Br J Pharmacol 1998; 123:317-325[CrossRef][Medline]
  62. Pupo AS. Functional effects of castration on {alpha}1-adrenoceptors in rat vas deferens. Eur J Pharmacol 1998; 351:217-223[CrossRef][Medline]
  63. Yazawa H, Honda K. Alpha 1-adrenoceptor subtype in the rat prostate is preferentially the alpha 1A type. Jpn J Pharmacol 1993; 62:297-304[Medline]
  64. Teng CM, Guh JH, Ko FN. Functional identification of {alpha}1-adrenoceptor subtypes in human prostate: comparison with those in rat vas deferens and spleen. Eur J Pharmacol 1994; 265:61-66[CrossRef][Medline]
  65. Schwinn D, Price R. Molecular pharmacology of human {alpha}1-adrenergic receptors: unique features of the {alpha}1a-subtype. Eur Urol 1999; 36:7-10
  66. Sharif SI, Gokhale SD, Chandranath SI. Pharmacological characterization of the postjunctional alpha-adrenoceptors of the rat isolated seminal vesicle. Naunyn-Schmiedeberg's Arch Pharmacol 1990; 341::425-431[Medline]
  67. Soares RD, Abreu ML, Porto CS. Post-natal development modulates the rat seminal vesicle sensitivity to sympathomimetic agonists. Naunyn-Schmiedeberg's Arch Pharmacol 1993; 348:53-57[CrossRef][Medline]
  68. Marshall I, Burt RP, Grenn GM, Hussain MB, Chapple CR. Different subtypes of {alpha}1A-adrenoceptor mediating contraction of rat epididymal vas deferens, rat hepatic portal vein and human prostate distinguished by the antagonist RS 17053. Br J Pharmacol 1996; 119:407-415[Medline]
  69. Eltze M. Functional evidence for an {alpha}1B-adrenoceptor mediating contraction of the mouse spleen. Eur J Pharmacol 1996; 311:187-198[CrossRef][Medline]
  70. Burt RP, Chapple CR, Marshall I. The role of diacylglycerol and activation of protein kinase C in alpha 1A-adrenoceptor-mediated contraction to noradrenaline of rat isolated epididymal vas deferens. Br J Pharmacol 1996; 117:224-230[Medline]
  71. Shen H, Peri KG, Deng XF, Chemtob S, Varma DR. Distribution of {alpha}1-adrenoceptor subtype proteins in different tissues of neonatal and adult rats. Can J Physiol Pharmacol 2000; 78:237-243[CrossRef][Medline]
  72. Salt PJ. Inhibition of noradrenaline uptake-2 in the isolated rat heart by steroids, clonidine and methosylated phenylethylamines. Eur J Pharmacol 1972; 20:329-340[CrossRef][Medline]
  73. Philippe M, Saunders T, Bangalore S. A mechanism for testosterone modulation of alpha-1 adrenergic receptor expression in the DDT1, MF-2 smooth muscle myocyte. Mol Cell Biochem 1991; 100:79-90[CrossRef][Medline]
  74. Morita T, Tsuchiya N, Tsujii T, Kondo S. Changes of autonomic receptors following castration and estrogen administration in the male rabbit urethral smooth muscle. Tohoku J Exp Med 1992; 166:403-405[Medline]
  75. Anderson GF, Navarro SP. The response of autonomic receptors to castration and testosterone in the urinary bladder of the rabbit. J Urol 1988; 140:885-889[Medline]
  76. Lacey JP, Donatucci CF, Price DT, Page SO, Bennett SAL, Tenniswood MP, Schwinn DA. Effects of androgen deprivation on prostate alpha-1 adrenergic receptors. Urology 1996; 48:335-341[CrossRef][Medline]
  77. Homma Y, Hamada K, Nakayama Y, Tsujimoto G, Kawabe K. Effects of castration on contraction and {alpha}1-adrenoceptor expression in rat prostate. Br J Pharmacol 2000; 131:1454-1460[CrossRef][Medline]



This article has been cited by other articles:


Home page
Mol Hum ReprodHome page
M. T.C.C. Patrao, D. B.C. Queiroz, G. Grossman, P. Petrusz, M. d. F. M. Lazari, and M. C. W. Avellar
Cloning, expression and immunolocalization of {alpha}1-adrenoceptor in different tissues from rhesus monkey and human male reproductive tract
Mol. Hum. Reprod., February 1, 2008; 14(2): 85 - 96.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
F. Jimenez-Trejo, M. Tapia-Rodriguez, D. B. C. Queiroz, P. Padilla, M. C. W. Avellar, P. R. Manzano, G. Manjarrez-Gutierrez, and G. Gutierrez-Ospina
Serotonin Concentration, Synthesis, Cell Origin, and Targets in the Rat Caput Epididymis During Sexual Maturation and Variations Associated With Adult Mating Status: Morphological and Biochemical Studies
J Androl, January 1, 2007; 28(1): 136 - 149.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
S. Y. Kamikihara, A. Mueller, V. Lima, A. R. T. Silva, I. B. d. Costa, J. Buratini Jr., and A. S. Pupo
Differential Distribution of Functional {alpha}1-Adrenergic Receptor Subtypes along the Rat Tail Artery
J. Pharmacol. Exp. Ther., August 1, 2005; 314(2): 753 - 761.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
A. M. Silva, D. B.C. Queiroz, E. F. Castro Neto, M. d. G. Naffah-Mazzacoratti, R. O. Godinho, C. S. Porto, G. Gutierrez-Ospina, and M. C. W. Avellar
Segment-Specific Decrease of Both Catecholamine Concentration and Acetylcholinesterase Activity Are Accompanied by Nerve Refinement in the Rat Cauda Epididymis During Sexual Maturation
J Androl, May 1, 2002; 23(3): 374 - 383.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Queiróz, D. B.C.
Right arrow Articles by Avellar, M. C. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Queiróz, D. B.C.
Right arrow Articles by Avellar, M. C. W.
Agricola
Right arrow Articles by Queiróz, D. B.C.
Right arrow Articles by Avellar, M. C. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS