Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hao, Z.
Right arrow Articles by Herr, J. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hao, Z.
Right arrow Articles by Herr, J. C.
Agricola
Right arrow Articles by Hao, Z.
Right arrow Articles by Herr, J. C.
Biology of Reproduction 66, 735-744 (2002)
© 2002 Society for the Study of Reproduction, Inc.


Regular Article

SAMP32, a Testis-Specific, Isoantigenic Sperm Acrosomal Membrane-Associated Protein1

Zhonglin Haoa, Michael J. Wolkowicza, Jagathpala Shettya, Kenneth Klotza, Laura Bollinga, Buer Sena, V. Anne Westbrooka, Scott Coonroda, Charles J. Flickingera, and John C. Herr2,a

a Department of Cell Biology, Center for Research in Contraceptive and Reproductive Health, University of Virginia, Charlottesville, Virginia 22908


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To identify novel human sperm membrane antigens, we analyzed two-dimensional gels of sperm extracts containing hydrophobic proteins that partitioned into Triton X-114. Four protein spots with isoelectric points (pIs) ranging from 4.5 to 5.5 and apparent molecular weights from 32 to 34 kDa were sequenced by mass spectrometry and found to contain common peptide sequences. Cloning the corresponding cDNA revealed that these protein spots were products of a single gene (SAMP32), encoding a protein of 32 kDa with a predicted pI of 4.57. SAMP32 has a potential transmembrane domain in the carboxyl terminus and is phosphorylated in vivo on serine 256. Northern blotting of eight human tissues and RNA dot blotting of 76 human tissues showed that SAMP32 expression was testis specific. SAMP32 contained an amino terminal domain homologous to the major malarial circumsporozoite surface protein and a domain similar to that of Krp1 from Schizosaccharomyces pombe in its carboxyl terminus. The SAMP32 locus consists of seven exons on chromosome 6q15-16.2. Antiserum against recombinant SAMP32 recognized protein spots originally cored from a two-dimensional gel. This antiserum strongly stained the equatorial segment and faintly stained the acrosome cap of ejaculated human spermatozoa by immunofluorescence. Immunoelectron microscopy showed that SAMP32 was associated with the inner acrosomal membrane in the principal and the equatorial segments of the sperm acrosome. By immunostaining enzyme-dissociated testicular cells, SAMP32 was localized to Golgi phase round spermatids and subsequent stages of acrosome biogenesis. Recombinant SAMP32 reacted with serum from an infertile man, suggesting that it is isoantigenic. Antibodies against recombinant SAMP32 inhibited both the binding and the fusion of human sperm to zona-free hamster eggs.

gamete biology, gametogenesis, sperm, spermatogenesis, testis


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Biogenesis of the acrosome of spermatozoa can be divided into three phases based on morphologic changes [13]. First, during the Golgi phase, numerous proacrosomal vesicles, formed from the trans-Golgi network, fuse with one another to form a single large acrosomal vacuole that contains the acrosomal granule and is in contact with the nuclear envelope. Second, during the cap phase, the acrosomal granule and vacuole enlarge with the addition of new proteins from the Golgi apparatus, grow, and flatten on the surface of the nucleus, while the acrosomal matrix condenses further. Finally, during the acrosomal phase, the dense material of the acrosomal granule spreads over the entire inner acrosomal membrane and assumes a hemispherical, caplike shape. This structure maintains its shape thereafter until the acrosomal reaction has been completed.

The acrosome contains many enzymes including proteases (such as acrosin [4]), esterases, acid phosphatases, glycohydrolases, and aryl sulfatases, as well as antigens such as acrogranin [5], SP-10 [6], Sp56/AM67 [7, 8], and PH-20 [9]. The outer acrosomal membrane fuses with the overlying sperm plasma membrane and begins the acrosomal reaction after primary binding of the sperm to the zona pellucida. Enzymes released from the acrosome are believed to play an important role in digesting the zona and paving the way for penetration of the egg investment by the sperm [10]. In the mouse, a molecule responsible for the secondary binding of sperm to the zona pellucida resides on the inner acrosomal membranes [7, 11].

Of those molecules localized to the acrosome, acrogranin has been shown to be the precursor of granulin, a growth modulation peptide expressed abundantly in many other tissues and a modulator of mouse preimplantation embryo development [12]. SP-10 and acrosin were found associated with the acrosomal matrix and were released in large part after the acrosomal reaction [6, 13]. SP56, shown to have specific affinity for mouse ZP3 [14], was localized to the acrosomal matrix [7, 8]. The only true acrosomal membrane protein described to date is PH-20. PH-20 is a glycosylphosphatidylinositol (GPI)-anchored protein [1520] found in guinea pigs, mice, cynomolgus monkeys, and humans. Expressed in testis and epididymis and localized on both the plasma membrane and the inner acrosomal membrane of the sperm head [1521], PH-20 has hyaluronidase activity [22, 23] and is implicated in penetration of the cumulus oophorus. In addition, PH-20 is considered to have a function in sperm-egg interactions unrelated to its enzyme activity [15, 24]. Immunization of female guinea pigs with purified PH-20 induced 100% infertility, highlighting the importance of this membrane protein in fertilization [25]. Clinically, abnormalities in the acrosomal reaction have also been linked to infertility [26]. Definition of the molecular constituents of the acrosomal matrix and acrosomal membrane is clearly of vital importance to understand infertility due to acrosomal defects as well as molecular mechanisms mediating sperm-egg interactions.

To identify and clone novel human sperm membrane antigens that might be involved in the acrosomal reaction and/or binding of sperm to the oocyte complex, we analyzed a two-dimensional gel sperm proteome containing molecules that partitioned into a Triton X-114 detergent phase during extraction. We discovered a novel membrane-associated protein localized to the acrosome of human spermatozoa, which is named SAMP32 (sperm acrosomal membrane-associated protein 32). This protein is a sperm isoantigen, and antibodies to SAMP32 inhibited sperm function in the hamster egg penetration assay.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Vectorial Labeling, Phase Partitioning, and Two-Dimensional Gel Electrophoresis

Human semen samples were obtained from healthy donors as described [27]. Percoll-purified spermatozoa (90% motile) were suspended in Dulbecco PBS containing 3 mg/ml of sulfo-NHS-LC-biotin (Pierce, Rockford, IL) to a final concentration of 50 x 106/ml. Biotinylation of the sperm surface was performed by incubating the sample for 10 min at 37°C [28]. After a second Percoll purification, the sperm were washed with Ham F10 medium. Triton X-114 phase-partitioning [29] was employed to enrich potential membrane proteins from human spermatozoa [30]. The sperm pellet was resuspended in an appropriate volume of 1.7% Triton X-114 in Tris-buffered saline (TBS) (10 mM Tris, 150 mM NaCl, pH 7.4). After extraction for 1 h at 4°C on a rotational platform, the sample was centrifuged at 15 000 x g to remove debris. TBS was then added to adjust Triton X-114 to 1% at 4°C, and the sample was heated to 30°C to allow the phases to separate. After centrifugation at 300 x g for 3 min, the upper aqueous phase was removed to a clean tube. Ice-cold water and one tenth the original volume of 10x TBS were added to the detergent phase to restore the original volume. Ice-cold water and one-tenth the original volume of 10% Triton X-114 were added to the aqueous phase to repeat the first of five consecutive rounds of phase partitioning. Pooled proteins that partitioned into the Triton X-114 detergent phase were resolved by isoelectric focusing in the first dimension and by SDS-PAGE in the second dimension. The gels were either stained with Coomassie blue (Sigma, St. Louis, MO) or transferred to nitrocellulose membrane for Western blot analysis with avidin-horseradish peroxidase (HRP). Protein spots from Coomassie-stained gels were then cored for sequencing by mass spectrometry [28].

One-Dimensional SDS-PAGE and Western Blots

Protein electrophoresis was performed [27] on discontinuous polyacrylamide gels (4% stacking and 10% or 15% separating gel) at constant voltage (100 V) on a Bio-Rad minigel apparatus (Bio-Rad, Hercules, CA). Gels were stained with Coomassie blue or blotted. For Western blots, proteins were transferred to a nitrocellulose membrane (0.2 µm) at 100 V for 1 h with cooling. The membranes were blocked in PBS with 0.1% Tween-20 (PBST) containing 5% nonfat milk and 1% normal goat serum for 1 h at 22°C on a rocking platform. The membranes were then incubated for 1 h in PBST containing 5% nonfat milk and 1% normal goat serum and primary rat antibody to recombinant (r) SAMP32 diluted 1:2000 to 1:4000. After three washes with PBST, each for 10 min, the membranes were incubated further with PBST containing 5% nonfat milk, 1% normal goat serum, and a 1:4000 dilution of the secondary goat anti-rat antibody conjugated to HRP (Jackson ImmunoResearch, West Grove, PA). After three washes with PBST, TMB Membrane Peroxidase Substrate (KPL, Gaithersburg, MD) was added at 22°C to develop a blue reaction product.

Screening of Lambda Testis cDNA Library

A lambda DR2 cDNA library from human testis was purchased from Clontech Inc. (Palo Alto, CA) and screened according to the user manual. Briefly, a total of 2.5 x 105 clones were plated on a bacterial lawn on six 150-mm agar plates. After replica plating onto a nylon membrane, phage particles were denatured in 0.5 M NaOH, 1.5 M NaCl, and neutralized in 0.5 M Tris, pH 7.5, 1.5 M NaCl. After UV cross-linking, the filters were washed in 2x saline-sodium citrate (SSC), 0.2% SDS, for 20 min at 22°C. The filters were prehybridized for 4 h at 42°C in hybridization solution without the probe and were hybridized at 42°C overnight in the presence of 50% formamide. A 420-base pair (bp) cDNA fragment was amplified by polymerase chain reaction (PCR) from the human testicular cDNA library using two primers based on GenBank sequence AI419884, and the fragment was used to probe filters. The cDNA fragment was subcloned into pTOPO (Invitrogen, Carlsbad, CA) and sequenced for fidelity. Probes were labeled with [32P]dCTP by the random primer method using the Rediprime II labeling kit (Amersham, Piscataway, NJ). Filters were washed once in 2x SSC, 0.2% SDS, at 22°C; once in 0.2x SSC, 0.2% SDS, at 42°C; and once in 0.2x SSC, 0.2% SDS, at 50°C, each for 20 min. After washing, filters were exposed to x-ray film at -80°C for 24–48 h. Secondary screening was repeated as described to isolate single, pure phage plaques. Finally, the cDNA inserts were recovered from the phage particles as plasmids in the pDR2 vector by transforming the Escherichia coli AM1 strain expressing Cre recombinase. This process was made possible by the presence of two phage P1-derived lox-P recombination sites at both ends of the cDNA insert.

PCR and Rapid Amplification of cDNA Ends

The PCR conditions have been described previously [31]. Hot start PCRs were performed using the Amp-Taq DNA polymerase from Perkin-Elmer (Norwalk, CT) when library DNAs were used as templates. The cycling parameters employed were 94°C, 10 min; 94°C, 30 sec; 55°C, 30 sec; and 72°C, 2–4 min, for 35–40 cycles. PCRs using plasmid templates were performed using cloned pfu (Pyrococcus furiosus unit) DNA polymerase (Stratagene, La Jolla, CA) (cycling parameters were the same as above except that the denaturation was 5 min before cycling and there were 30 cycles). The primers used to amplify a 400-bp probe for plaque and Northern blot hybridization were Hao1 (AGTCACCCCTTGGCTTTCGAGT) and Hao2 (AATATTCTGTAATATCCTTTGGTT). The primers for SAMP32 3' amplification were Hao39 (CTTTGTATGTCACATTCCCTGAAG) and Hao41 (GAGGTACAATCCGAGCAGAGTTCT) or Hao41 and AP1 primer supplied in the Marathon ready cDNA kit (Clontech, Palo Alto, CA).

Northern and Dot Blots

Human multiple tissue Northern membranes containing eight tissues and multitissue array RNA dots containing 76 tissues were purchased from Clontech. The same 3' 420-bp cDNA described previously was used as a probe for Northern analysis. Hybridization was performed in ExpressHyb solution (Clontech) at 68°C for 1 h followed by two successive washes in 2x SSC, 0.1% SDS, for 20 min each at 22°C and three washes in 0.1x SSC, 0.1% SDS for 20 min each at 65°C. Films were exposed for 24–72 h at -80°C. After the test probe was stripped, the same membrane was probed with the ß-actin probe supplied in the kit.

To probe the multitissue array RNA dots, the same 420-bp of DNA was labeled, and hybridization was performed at 68°C overnight in ExpressHyb solution containing salmon sperm single-stranded DNA and Cot-1 DNA, according to the manufacturer's instructions. The array contained 76 human tissues including whole brain, cerebral cortex, frontal lobe, parietal lobe, occipital lobe, temporal lobe, paracentral gyrus of cerebral cortex, pons, left cerebellum, right cerebellum, corpus callosum, amygdala, caudate nucleus, hippocampus, medulla oblongata, putamen, substantia nigra, accumbens nucleus, thalamus, pituitary gland, spinal cord, heart, aorta, left atrium, right atrium, left ventricle, right ventricle, interventricular septum, apex of the heart, esophagus, stomach, duodenum, jejunum, ileum, iliocecum, appendix, ascending colon, transverse colon, descending colon, rectum, kidney, skeletal muscle, spleen, thymus, peripheral blood lymphocytes, lymph node, bone marrow, trachea, lung, placenta, bladder, uterus, prostate, testis, ovary, liver, pancreas, adrenal gland, thyroid gland, salivary gland, mammary gland, leukemia HL-60, Hela S3, leukemia K-562, leukemia MOLT-4, Burkitt lymphoma Raji, Burkitt lymphoma Daudi, colorectal adenocarcinoma SW480, lung carcinoma A549, fetal brain, fetal heart, fetal kidney, fetal liver, fetal spleen, fetal thymus, and fetal lung. The film was exposed for 96 h at -80°C.

Expression of Recombinant Protein and Production of Antiserum

To express SAMP32 in E. coli, a DNA fragment encoding amino acids 30–221 of the open reading frame was amplified by PCR. The amplified fragment was fused in frame with His tags at both ends of pET28b using the NheI and XhoI sites, and the resulting construct was verified by DNA sequencing. To enhance expression of human codons, Epicurian Coli BL21 DE3 CodonPlus cells were used as the host strain (Stratagene) in place of conventional BL21 DE3. The plasmid was transformed into the host strain, and a large culture from a single colony was grown to optical density at 600 nm = 1.0 at 37°C in Luria broth (LB) in the presence of 50 µg/ml of kanamycin. Isopropyl-1-thio-ß-D-glactopyranoside (IPTG) was then added to a final concentration of 1 mM to induce expression. After a further 3–4 h of growth, the bacteria were collected by centrifugation. The recombinant protein was affinity purified with an Ni-nitrilotriacetic acid (NTA) column under denaturing condition [27]. Preparative gel electrophoresis followed by electroelution using Elutrip (Schleicher & Schuell, Keene, NH) or Prepcell (Model 491; Bio-Rad) was employed to remove minor contaminating proteins of E. coli origin. The purified protein, which appeared as a single band on SDS-PAGE, was used for injection.

Female virgin Lewis rats weighing 160–200 g were used for antiserum production. Purified recombinant protein in PBS was emulsified with equal amount(s) of Freund complete adjuvant, and each rat was injected s.c. initially with 100 µg of protein in 0.3 ml. An additional 0.3 ml containing 100 µg of protein emulsified with an equal volume of Freund incomplete adjuvant was administered by the same route in subsequent booster injections 3–6 wk later. Antibody titers were checked by Western blot analysis 10 days after each booster injection. The animals were killed 10 days after the last boost, and titers above 1:2000 were observed in all animals by Western analysis of total sperm extracts.

Immunofluorescence of Enzyme-Dissociated Tissue

Samples of human testis were obtained from surgical specimens. The tissue blocks were minced, and the tissue was dissociated with collagenase, micrococcal nuclease, and trypsin. Dissociated cells were mounted on slides and dried. The slides were washed in PBS thrice, permeabilized in methanol, and washed again with PBS. The slides were blocked in 10% normal donkey serum for 1 h and incubated in PBS-Tween containing 1% normal donkey serum and 1:100 to 1:200 dilution of rat anti-SAMP32 antiserum overnight at 4°C. After three washes with PBST containing 1% normal donkey serum, the slides were incubated with secondary antibody (donkey anti-rat conjugated with tetramethylrhodamine B isothiocyanate [TRITC], 1:200 in PBST and 1% normal donkey serum) for 60 min. The slides were washed twice with PBST, washed twice with PBS, and fixed with 2% paraformaldehyde for 10 min. After the slides were washed with PBS, they were incubated in equilibration buffer. Nuclei were stained with 4',6'-diamidino-2-phenylindole (DAPI), and slides were mounted with Slow-Fade antifade reagent (Molecular Probes, Eugene, OR). Images were captured using a Zeiss Axioplan2 microscope (Carl Zeiss Inc., Thornwood, NY).

Preparation of Capacitated Spermatozoa

Human semen samples were obtained from healthy donors as described [27]. Live "swim-up" sperm were prepared as follows. Freshly ejaculated semen samples were liquefied for 30 min to 1 h at 22°C. They were diluted with an equal volume of Biggers, Whitten, and Whittingham (BWW) medium (Irvine Scientific, Santa Ana, CA) and centrifuged at 500 x g for 5 min to remove seminal plasma. The sperm pellets were washed twice with BWW containing 10 mg/ml of BSA (500 x g for 5 min). After the supernatant was removed, the sperm pellets were carefully overlaid with BWW containing 30 mg/ml of human serum albumin (HSA) (Sigma, St. Louis, MO). The samples were then incubated at 37°C for 1 h to allow the sperm to swim up. The upper half of "swim-up" sperm were carefully transferred to a fresh tube without disturbing the lower half. Capacitation was conducted in BWW containing sodium bicarbonate and BSA at 37°C overnight [32].

Immunofluorescence and Electron Microscopic Analysis

Percoll gradient-separated human spermatozoa [28] were air-dried onto poly-L-lysine-coated slides (Polysciences, Warrington, PA). They were fixed with 4% paraformaldehyde for 10 min in PBS, pH 7.2. After three washes with PBS for 10 min each, slides were blocked and permeabilized in PBST containing 10% normal goat serum and 0.1% saponin for 1 h. The sperm were then incubated with a 1:200 dilution of anti-SAMP32 primary antiserum or preimmune serum for 1.5 h at 22°C, followed by washing in PBST 3 times for 10 min, each at 22°C. After incubation with the secondary goat anti-rat immunoglobulin (Ig) G conjugated with Cy3 (Jackson ImmunoResearch, Westgrove, PA) at 1:200 dilution for 1 h, the slides were washed in PBS, coated with Slow-Fade, mounted under coverslips, and viewed in a Zeiss Axioplan2 microscope equipped with epifluorescence using Open Lab software.

For immunoelectron microscopy, pooled sperm were washed twice in Ham F-10 medium containing 3% sucrose. They were fixed in 4% paraformaldehyde and 0.2% glutaraldehyde in PBS for 15 min at 22°C. The fixatives were removed by washing, and the sperm were dehydrated by passing through a series of graded ethanol, ranging from 40% to 100%. The sperm were embedded in Lowicryl K4M (Electron Microscopy Sciences, Fort Washington, PA), the blocks were polymerized with UV light at -20°C for 72 h, and ultrathin sections were cut. To stain the sections, they were first blocked in undiluted normal goat serum for 15 min at 22°C. They were then incubated for 16 h at 4°C with either preimmune or rat-anti-SAMP32 antiserum at the dilution of 1:50 containing 1% normal goat serum, 1% BSA, and 0.1% Tween-20. After the sections were washed, they were incubated with a 1:100 dilution of 5 nm gold-conjugated goat anti-rat IgG (Goldmark Biologicals, Phillipsburg, NJ) for 1.5 h at 22°C. The sections were washed in distilled water, stained with uranyl acetate, and observed with an electron microscope (JEOL, 100CX, Akishima, Japan).

Human Serum With Anti-Sperm Antibodies Used in Western Analysis

Serum samples were collected from infertile men and women by criteria previously described [33]. Sera were tested for anti-sperm antibodies by the immunobead binding assay [34]. In all of the anti-sperm antibody-positive (ASA+) serum samples used for Western blots, >60% of the spermatozoa bound to immunobeads. All of the serum samples chosen had antibodies against the sperm head or the entire spermatozoa, as judged by the bead-binding patterns.

Hamster Egg Penetration Assay

Gamete incubations were carried out in microdrops under paraffin oil at 37°C and 5% CO2. Ejaculated human semen was allowed to liquefy for at least 30 min. Five hundred microliters of the ejaculate were placed under 2 ml of BWW medium containing 5 mg/ml HSA for 60–90 min, and the sperm were allowed to swim up. The swim up sperm were then washed two times by centrifugation (8 min at 600 x g) in 8-ml volumes of BWW in 15-ml centrifuge tubes. The sperm were capacitated overnight in 250 µl microdrops of BWW containing 30 mg/ml HSA at a concentration of 20 x 106 sperm per milliliter. Cumulus-oocyte complexes were collected from at least three superovulated Golden Syrian hamsters and placed in BWW with 5 mg/ml HSA. Cumulus cells were removed by treating eggs with 1 mg/ml hyaluronidase (Sigma) for 3 min. The oocytes were then pooled and washed (for this treatment and all subsequent treatments) by passing the eggs through 20-µl drops of media covered with mineral oil using a pulled, heat-polished Pasteur pipette. Zonae pellucida were removed by treating eggs with 1 mg/ml trypsin (Sigma) for 30 sec, followed by five washes. The eggs were then randomly allotted into two groups.

After overnight capacitation, 2 x 106 sperm were treated for 1 h in a 20-µl microdrop containing a 1:10 dilution of either decomplemented SAMP32 preimmune or immune serum in BWW plus 30 mg/ml HSA. Zona-free hamster oocytes were then added directly to the sperm suspension, and the gametes were coincubated for 3 h. After gamete coincubation, loosely bound sperm were removed from the oocytes by gentle pipetting. The eggs were then treated with 1 mM acridine orange in 3% DMSO (Sigma) for 15 sec to stain the chromatin and were washed through three 20-µl microdrops. To quantitate binding, oocytes were placed between a microscope slide and an elevated cover slip and visualized at 200x magnification using a light microscope (Zeiss Axioplan), and the number of sperm bound per oocyte was recorded. The number of sperm fused per egg was scored by counting the number of acridine orange-stained decondensed sperm heads within each oocyte using fluorescent microscopy. The Student t-test was used to score the statistical significance.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
SAMP32 Is Represented by a Group of Four Protein Spots With Different Apparent Molecular Weights and Isoelectric Points

Among several dozen hydrophobic sperm proteins microsequenced by mass spectrometry, four spots, designated C71, 72, 74, and 75 (Fig. 1), shared the same peptide sequences (of which ASTPEVQSEQSSVR was the longest, Table 1). However, the apparent molecular weights of these spots varied from 30 to 34 kDa, and their isoelectric points (pIs) ranged from 4.5 to 5.5. Vectorial labeling with sulfo-NHS-LC-biotin indicated that at least one of the four spots (C74) was labeled with biotin (Fig. 1).



View larger version (59K):
[in this window]
[in a new window]
 
FIG. 1. Biotinylated human sperm proteins isolated by Triton X-114 phase partitioning were silver stained (A) or blotted (B) with avidin-HRP. In A, arrows indicate four protein spots (C71, 72, 74, 75) that were analyzed by mass spectrometry after coring from a Coomassie-stained gel and were found to contain common peptides. In B, arrows indicate the relative positions of C71, 72, 74, and 75 in the avidin blot. C74 is marked by a open arrow to show biotinylation


View this table:
[in this window]
[in a new window]
 
TABLE 1. Mass spectrometry analysis of peptide sequences

SAMP32 Encodes a Novel Protein

Use of the peptide sequence described previously to search the nonredundant protein databases revealed no known gene, suggesting that this protein was novel. Since two exact matches were found in the expressed sequence tag database (entries AI419884 and AI809484), PCR was performed to amplify a hybridization probe from a testicular cDNA library using primers based on the expressed sequence tag (EST) sequences. Upon screening of the lambda DR2 human testis cDNA library, 16 clones were identified at the secondary screening stage. Of these, DNA sequencing of the largest clone 1-4-1 (1050 bp) confirmed that the EST AI419884 was embedded within. After 3' untranslated region (UTR) amplification, a 1455-bp cDNA was obtained. As shown in Figure 2, the full-length clone contains a contiguous open reading frame encoding 294 amino acids. The predicted molecular weight and pI are 32 kDa and 4.57, respectively, matching closely the molecular weight and pI of the excised spots. All three peptides obtained by mass spectrometry were recovered in the cloned protein. An amino acid FASTA search in the current database, using the full-length open reading frame, revealed similarity to two proteins from different species, Malaria circumsporozoite protein (CSP) and fission yeast KRP1 (Fig. 3).



View larger version (84K):
[in this window]
[in a new window]
 
FIG. 2. Complementary DNA and protein sequences of SAMP32. Embedded microsequences obtained by mass spectrometry are boxed. The untranslated flanking regions are shown in lowercase letters. The putative transmembrane domain is underlined, and the phosphorylated serine residue at position 256 is italicized and boxed. The arrowhead denotes the putative cleavage site for the signal peptide. This sequence has been deposited into GenBank database under accession number AF203447



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 3. FASTA algorithm results showing similarity of SAMP32 to Malaria circumsporozoite protein (CSP) in the upper panel and to Schizosaccharomyces pombe protein KRP1 in the lower panel. Overall, SAMP32 showed 30% identity and 53% similarity to CSP across 113 amino acids. SAMP32 was 25.3% identical and 52% similar to KRP1 across a region of 162 amino acids. + indicates similarity; I, identity

SAMP32 Is Phosphorylated In Vivo and Is a Predicted Membrane Protein

By running the algorithms provided in the PredictProtein server (Columbia University), three possible sites for phosphorylation by casein kinase II were disclosed (amino acids 203, 256, 274). Of these, at least one site (i.e., the serine residue at amino acid position 256) was shown to be phosphorylated in vivo by mass spectrometric analysis of peptide sequences (Table 1). Analysis of the protein architecture with algorithms provided in the Simple Modular Architecture Research Tool on an EMBL server disclosed a signal peptide from amino acids 1 to 29, a low-complexity region from amino acids 39 to 61, and a transmembrane domain from amino acids 222 to 242 (Fig. 2). The low-complexity region is composed mainly of glutamic acid (35%). In addition, possible N-glycosylation of three amino acid residues at amino acids 31, 54, and 155 was predicted.

Expression of SAMP32 Is Testis Specific

To examine the expression of SAMP32 in various tissues, a multitissue Northern blot was performed (Fig. 4, upper panel). SAMP32 was detected only in testis as a ~1.5-kilobase (kb)-long single transcript among eight tissues including spleen, thymus, prostate, ovary, small intestine, colon, and peripheral lymphocytes, which suggested that SAMP32 was testis specific. This specificity was tested further by RNA dot blot hybridization. In agreement with the multitissue Northern blot result, only testis yielded a signal (Fig. 4, lower panel).



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 4. Northern blot of eight human tissues (upper) and RNA dot blot analysis of 76 human tissues (lower). In the upper panel, a Northern membrane containing 2 µg of poly-A RNA in each lane was exposed for 96 h. In the lower panel, a membrane dotted with RNA from 76 human tissues (refer to Materials and Methods for a detailed description of the tissues contained in the membrane) was hybridized to the same probe and exposed as in the upper panel

SAMP32 Is Localized to Chromosome 6

When the entire cDNA sequence of SAMP32 was searched against the human genomic database, SAMP32 was localized to 6q15-16.2 on chromosome 6 (GenBank entry, AL136096). Comparison of the cDNA sequence with the corresponding genomic sequence revealed that SAMP32 consists of seven exons ranging in length from 60 to 650 bp distributed across a 19-kb region of chromosome 6 (Fig. 5). In all cases, the nearly invariant splicing consensus GU and AG at the 5' and 3' ends of the introns were present. By contacting the Human Genome Nomenclature Committee (HGNC), SAMP32 was given the locus name SPACA1, which stands for sperm acrosome membrane associated 1.



View larger version (11K):
[in this window]
[in a new window]
 
FIG. 5. Shown in the diagram is a correlation of the 1455-bp SAMP32 cDNA with its 19-kb genomic sequence. Designated SPACA1 by the HGNC, this locus is mapped to 16q15-16.2 (GenBank accession number AL136096). Exons are labeled with roman numerals

SAMP32 Antibody Recognizes Protein Spots Originally Cored From the Gel

To determine if SAMP32 antiserum recognized the protein spots that were cored for mass spectrometry, two-dimensional Western blots were performed on proteins that were extracted with Triton X-114 and partitioned into the Triton X-114 phase. As shown in Figure 6, the two-dimensional blot showed staining of the original cored spots with anti-rSAMP32 at 32 and 34 kDa (arrowheads). Immunostaining of a small amount of two high molecular weight doublets (arrows) at 60 kDa and 90 kDa are likely the result of aggregation due to the hydrophobic nature of this protein. In contrast, preimmune serum did not stain any protein bands (data not shown).



View larger version (10K):
[in this window]
[in a new window]
 
FIG. 6. Western blot of sperm proteins with anti-rSAMP32 serum. Sperm proteins partitioned into Triton X-114 were loaded onto a two-dimensional gel (pH 3.5–9.5 in the first dimension and 9%–16% gradient SDS-PAGE in the second dimension). After transfer, the proteins were detected by rat anti-rSMAP32 serum. Signals are indicated by arrows and arrowheads

SAMP32 Is Associated With the Human Sperm Acrosome

Since SAMP32 contains a putative transmembrane domain, we investigated its localization on fixed human spermatozoa. Immunofluorescence of noncapacitated human sperm with anti-rSAMP32 antibodies after permeabilization stained the principal segment and the equatorial segment of the acrosome (Fig. 7) of all sperm. Of the 55 sperm counted, 35 (65%) were stained only at the equatorial segment (bar pattern), and 20 (35%) displayed a faint immunofluorescent cap (principal segment) and strong bar (equatorial segment). This pattern indicated an acrosomal localization of SAMP32 with a higher concentration in the equatorial segment. The same pattern existed in capacitated sperm (data not shown). Immunostaining of live sperm yielded no signal (data not shown).



View larger version (79K):
[in this window]
[in a new window]
 
FIG. 7. Localization of SAMP32 in fixed human sperm by staining with rat anti-rSAMP32 antiserum (1:200) (A and B) and rat preimmune serum (C). Corresponding fluorescence images were overlaid on differential interference contrast (DIC) images

Immunogold Labeling Confirmed SAMP32 Is Mainly Localized to the Equatorial Segment

At the ultrastructural level, this antiserum stained mainly the inner acrosomal membrane (Fig. 8, A and B) of principal and equatorial segments, although some gold particles were also seen in the acrosomal matrix. Immunogold particles were most prominent in the equatorial segment of the acrosome-intact sperm (Fig. 8A). The gold particles lined up on the inner acrosomal membrane in most cases (Fig. 8, A and B). It is also worth noting that the gold particles remained in the region of the equatorial segment in capacitated and acrosomal reacted sperm (Fig. 8C).



View larger version (85K):
[in this window]
[in a new window]
 
FIG. 8. Immunoelectron microscopy of human spermatozoa. A and B) Noncapacitated human sperm processed and stained with anti-rSAMP32 antiserum. Arrows and arrowheads indicate gold particles in the equatorial segment and those along the inner acrosomal membrane. ES indicates equatorial segment; OAM, outer acrosomal membrane; IAM, inner acrosomal memebrane. C) Capacitated and acrosomal reacted human sperm stained with anti-rSAMP32. Note that the gold particles are still heavily associated in an area probably corresponding to the equatorial segment of the sperm (arrows)

SAMP32 Expression Follows Acrosomal Development

The fact that SAMP32 was localized to the acrosome of the sperm suggested that SAMP32 might be an antigen expressed selectively during spermiogenesis. To determine if there was a correlation between SAMP32 expression and acrosomal biogenesis, we stained enzyme-dissociated human testicular cells with anti-rSMAP32 serum. As shown in Figure 9, SAMP32 was present in the acrosome at all stages of spermatid development including the Golgi phase and the cap phase in round spermatids, the acrosomes of elongating spermatids, and the elongated mature spermatids. SAMP32 expression, however, was observed neither before acrosomal formation began nor in non-germ cells (data not shown).



View larger version (124K):
[in this window]
[in a new window]
 
FIG. 9. Immunofluorescence of enzymatically dissociated testicular cells stained with rat anti-rSAMP32 antiserum (1:200) (red) followed by donkey anti-rat IgG F(ab')2 TRITC conjugate (1:200). A series of round spermatids is presented including Golgi phase (A), early cap phase (B), and late cap phase (C). Elongating condensing spermatids contain SAMP32 in the equatorial segment (D), and in the acrosome (E and F). DAPI was used for nuclear counterstaining (blue)

SAMP32 Is an Isoantigen

In a comparison of the sperm molecules recognized by sera of fertile and ASA+ infertile men, three spots designated C48, C108, and C31 (Fig. 10, A and B) were immunoreactive on a two-dimensional Western blot transferred from a gel loaded with a Celis protein extract of human sperm [28]. When the three spots cored from a companion Coomassie-stained gel were microsequenced, we d that all three contained peptide sequences found in the SAMP32 coding region (Table 2). This confirmed that SAMP32 was isoantigenic in humans. We next asked whether serum from an infertile man with anti-sperm antibody would recognize rSAMP32. As shown in Figure 10C, rSAMP32 was recognized by serum from an ASA+ infertile man but not a fertile man's serum on a unidimensional Western blot from a gel loaded with rSAMP32. This indicated that the rSAMP32 was immunogenic and retained epitopes recognized by the human B cell antibody repertoire to the "native" SAMP32.



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 10. Immunoblot of human sperm extracts (A and B) and recombinant human SAMP32 (C). Celis buffer (containing 9.8 M urea, 2% NP-40, and 100 mM dithiothreitol [DTT]) extracts of human sperm were separated by two-dimensional gel electrophoresis, transferred to nitrocellulose membrane, and blotted with sera from an ASA+ infertile man (A) and a fertile man (B) at a dilution of 1:1000. Three protein spots (arrows), which were recognized only by the serum from the infertile man, contained SAMP32 sequences on microsequencing of the companion Coomassie-stained gel. In C, recombinant human SAMP32 was separated on 10% SDS gel and blotted with serum from a fertile man (lane 1) and an ASA+ infertile man (lane 2)


View this table:
[in this window]
[in a new window]
 
TABLE 2. Peptide sequences detected in C31, C48, and C108

Rat Anti-rSAMP32 Blocks the Penetration of Zona-Free Hamster Eggs by Human Sperm

To disclose a possible role for SAMP32 in the sperm-egg interaction during fertilization, we tested whether anti-rSAMP32 could block binding and/or fusion of capacitated human sperm to zona-free hamster eggs. As shown in Figure 11, rat anti-rSAMP32 significantly suppressed both the binding and the fusion of capacitated human sperm with zona-free hamster eggs in comparison to preimmune serum. Out of four independent assays performed (n = 45), the immune serum suppressed sperm binding to hamster egg by roughly 50% (P < 0.01). This blocking effect was even more pronounced on sperm fusion, for which the number of fused sperm was 4- to 5-fold lower for immune versus preimmune controls (P < 0.01).



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 11. Hamster egg penetration by human sperm. Capacitated human sperm preincubated with either preimmune (PreIm, filled) or immune (Im, open) sera against SAMP32 were coincubated with zona-free hamster eggs. The average numbers of sperm bound (A) or fused (B) to the eggs were counted under a fluorescence microscope. The total numbers of eggs scored (N) in both cases were 45. Bars represent standard error. *, P < 0.01


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The preferential solubilization properties of Triton X-114 were employed to construct a two-dimensional gel database enriched in hydrophobic human sperm proteins [30]. Peptide sequencing by mass spectrometry indicated that four protein spots with molecular weights of 30–34 kDa and pIs of 4.5–5.4 contained common peptide sequences. Two possibilities existed to account for the variation in mobility. First, since human cDNA is often a composite of differentially spliced exons, the protein molecular sizes could be different due to joining of different sets of exons. Second, posttranslational modification, such as phosphorylation, can affect the migration of proteins on a gel. The finding by mass spectrometry that a serine residue was phosphorylated indicated that posttranslational modification might be responsible at least in part for the molecular weight and pI differences. Furthermore, the following observations do not support the possibility of alternative splicing: 1) a single mRNA species was detected in Northern analysis, 2) EST database searches did not reveal sequences suggestive of alternative splicing, and 3) no new amino acid sequences were obtained in a separate peptide sequencing experiment that cored additional spots from two-dimensional gels. All of the peptide sequences obtained, however, were accounted for in the single open reading frame (Table 1).

Cloning of SAMP32 resulted in a cDNA of 1455 bp. This is most likely a full-length sequence because 1) its size correlates well with a message of 1.5 kb noted on the Northern blot (discussed subsequently), 2) the translation start site contains a canonical Kozak consensus sequence [35], and 3) the predicted molecular weight closely matches the apparent molecular weight of SAMP32 on two-dimensional gels. Search of the GenBank database using the deduced protein sequence indicated that SAMP32 was novel. The search also indicated that an amino terminal domain of SAMP32 was homologous to an amino terminal domain in Malaria circumsporozoite protein (CSP) and that Schizosaccharomyces pombe KRP1 and SAMP32 shared carboxyl terminus region. It is interesting to note that CSP is a surface antigen found in the circumsporozoite, which is the infectious stage of Malaria [36]. On the other hand, fission yeast KRP1 protein belongs to the family of type I membrane-bound endopeptidases. Through cleavage after pairs of dibasic residues, KRP1 is involved in p-factor maturation [37]. The significance of these homologies is unclear at present, although it is possible that SAMP32 may have the same basic pattern of folding to CSP in its N-terminus and to KRP1 in the C-terminus according to the protein global alignment study [38, 39]. This could also imply that SAMP32 is responsible for proteolytic processing in the acrosome if it does possess endopeptidase activity. We are now testing this possibility.

From mass spectrometry, phosphorylation of serine 256 was observed in vivo, and the PredictProtein program indicated that SAMP32 contained three consensus phosphorylation sites for casein kinase II. Serine 256 was among them (others include serine 203 and 274), which suggested that casein kinase II is the enzyme responsible for phosphorylation at this site. Casein kinase II, a constitutively active enzyme most abundant in the testis and the brain [40], is thought to play an important role in many processes including DNA replication and transcription, RNA processing and translation, and cell metabolism and motility [41]. Known substrates of casein kinase II include molecules involved in signal transduction, transcription, DNA replication, and the cell cycle.

A Northern blot of eight human tissues initially suggested that the RNA transcript is about 1.5 kb long, a size comparable to the cDNA, and that SAMP32 is expressed only in the testis. In agreement with this finding, an EST database search did not reveal any other tissues expressing SAMP32. This testis specificity is reinforced by our comprehensive study of RNA expression by RNA dot blot hybridization, which contained 76 human tissues. This finding may indicate that SAMP32 is a gene required for a structure or a function unique to spermatozoa.

A two-dimensional Western blot incubated with antibody to rSAMP32 revealed immunoreactivity with all of the protein spots that we originally cored for peptide sequencing. The trace amount of higher molecular weight spots at ~60 and ~90 kDa most likely represented aggregates since 1) these protein spots had sizes two or three times that of the single molecule; 2) the amount of high molecular weight protein decreased drastically when urea was included in the gel (urea keeps the protein denatured, thus preventing it from forming aggregates); and 3) independent sequencing showed that a 120-kDa spot cored from a two-dimensional gel contained several peptide sequences embedded in SAMP32 (data not shown).

Biotinylation of at least one of the SAMP32 protein spots suggested a surface localization. However, the absence of immunofluorescent staining of freshly ejaculated live sperm (few if any acrosome reacted) indicated that SAMP32 is not exposed on the sperm plasma membrane. Electron microscopy indicated that SAMP32 is localized to the equatorial segment and the inner acrosomal membrane of capacitated sperm. Thus, biotinylation of some SAMP32 may have resulted from damage to the sperm acrosome or spontaneous acrosomal reaction (10% average) during biotinylation and processing of live sperm.

Initially, Triton X-114 phase partitioning experiments indicated that SAMP32 was found only in the detergent phase, which suggested that SAMP32 was hydrophobic and thus possibly associated with membranes. On cloning the cDNA, a putative transmembrane domain residing in amino acids 222–242 was found, suggesting that SAMP32 was a potential transmembrane protein. Labeling along the inner acrosomal membrane in our immunogold staining study indicated that SAMP32 was associated with the acrosomal membrane. Taken together, these observations suggest that SAMP32 is a membrane protein (most likely a transmembrane protein). Although PH-20 is known to associate with the acrosomal membrane by virtue of its GPI anchor [1520], few intra-acrosomal membrane proteins with functional transmembrane domains have been described to date.

Male germ cells require 72 days in humans to finish the developmental process of differentiating into mature sperm. The specific pattern of SAMP32 expression during spermiogenesis suggests the SAMP32 gene expression is tightly regulated developmentally. By staining testicular cells dissociated with enzyme, SAMP32 was clearly shown to be a differentiation antigen [42], expressed exclusively in germ cells during acrosomal biogenesis. The fact that humans make antibodies to SAMP32 indicates that the immune system is not tolerant to SAMP32, suggesting that like other postmeiotic gene products, SAMP32 has not been exposed to the immune system until the onset of spermatogenesis at puberty.

By coupling two-dimensional gel Western blotting with protein microsequencing, we showed that SAMP32 was likely an isoantigen. To rule out the possibility that the ASA+ infertile man's serum was recognizing other proteins that comigrated with SAMP32, we blotted the rSAMP32 with sera from both infertile and fertile men. Recombinant SAMP32 was indeed an isoantigen since rSAMP32 strongly reacted with serum from an ASA+ infertile man. This is potentially interesting since it suggests that SAMP32 may be one of the many antigens causing immunoinfertility. From a contraceptive vaccine development perspective, the fact that antibodies from ASA+ humans reacts with rSAMP32 indicates that at least some of the immunogenic epitopes recognized by the human response are present in the expressed and purified recombinant antigen. This indicates that rSAMP32 is suitable for vaccine testing in primates. It is worth mentioning that the high-molecular weight spot (C108) in Figure 10A (Celis extracts) did not show up in Figure 6 (detergent extract). This suggests that the proteins differentially partition according to the extraction conditions and may reflect different properties or subcellular localization (e.g., cytosolic vs. transmembrane).

One mechanism by which sperm antigens may cause immunoinfertility is to induce antibody formation in the female reproductive tract and in turn block single or multiple points of sperm and egg interaction. Our hamster egg penetration assay demonstrated that antiserum against SAMP32 significantly inhibited both the binding and the fusion of sperm with hamster eggs. These results suggested that SAMP32 might have a role in one or more events of primary and secondary binding and in fusion of sperm with the oolemma or in sperm internalization. It is important to point out that sperm in the process of fusing with the egg were not directly measured but rather intracellular sperm resulting from fusion. Since fusion is dependent on binding, the inhibition of sperm-egg fusion seen here may at least partly be the result of binding inhibition. Inhibition of binding alone, however, cannot account for all inhibition of fusion because binding was only inhibited by 50%, whereas fusion was inhibited by more than 80%. Since we have identified the mouse SAMP32 (data not shown), experiments are under way to clarify its role in the fertilization process.


    ACKNOWLEDGMENTS
 
We thank Marry Jo Herriman for help in manuscript editing, Friederike Jayes for help with the two-dimensional gel, and Peggy Anderson and Gina R. Wimer, LVT, for technical assistance in protein purification and animal handling.


    FOOTNOTES
 
First decision: 9 October 2001.

1 This research was supported by U54HD29099 and D43TW/HD00654 from the Fogarty International Center. Back

2 Correspondence: John C. Herr, Department of Cell Biology, Center for Research in Contraceptive and Reproductive Health, University of Virginia, 1300 Jefferson Park Ave., Charlottesville, VA 22908. FAX: 804 982 3912; jch7k{at}virginia.edu Back

Accepted: October 24, 2001.

Received: September 17, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Eddy EM, O'Brien DA. In: Knobil E, Neill, JD (eds.), The Physiology of Reproduction. New York: Raven Press; 1994: 29–72
  2. De Krester DM, Kerr JB. In: Knobil E, Neill, JD (eds.), The Physiology of Reproduction. New York: Raven Press; 1994: 1177–1290
  3. Abou-Haila A, Tulsiani DR. Mammalian sperm acrosome: formation, contents, and function. Arch Biochem Biophys 2000; 379:173-182[CrossRef][Medline]
  4. Klemm U, Muller-Esterl W, Engel W. Acrosin, the peculiar sperm-specific serine protease. Hum Genet 1991; 87:635-641[Medline]
  5. Anakwe OO, Gerton GL. Acrosome biogenesis begins during meiosis: evidence from the synthesis and distribution of an acrosomal glycoprotein, acrogranin, during guinea pig spermatogenesis. Biol Reprod 1990; 42:317-328[Abstract]
  6. Herr JC, Flickinger CJ, Homyk M, Klotz K, John E. Biochemical and morphological characterization of the intra-acrosomal antigen SP-10 from human sperm. Biol Reprod 1990; 42:181-193[Abstract]
  7. Foster JA, Friday BB, Maulit MT, Blobel C, Winfrey VP, Olson GE, Kim KS, Gerton GL. AM67, a secretory component of the guinea pig sperm acrosomal matrix, is related to mouse sperm protein sp56 and the complement component 4-binding proteins. J Biol Chem 1997; 272:12714-12722[Abstract/Free Full Text]
  8. Kim KS, Cha MC, Gerton GL. Mouse sperm protein sp56 is a component of the acrosomal matrix. Biol Reprod 2001; 64:36-43[Abstract/Free Full Text]
  9. Myles DG, Primakoff P. Localized surface antigens of guinea pig sperm migrate to new regions prior to fertilization. J Cell Biol 1984; 99:1634-1641[Abstract/Free Full Text]
  10. de Duve C. Lysosomes revisited. Eur J Biochem 1983; 137:391-397[Medline]
  11. Bleil JD, Greve JM, Wassarman PM. Identification of a secondary sperm receptor in the mouse egg zona pellucida: role in maintenance of binding of acrosome-reacted sperm to eggs. Dev Biol 1988; 128::376-385[CrossRef][Medline]
  12. Diaz-Cueto L, Stein P, Jacobs A, Schultz RM, Gerton GL. Modulation of mouse preimplantation embryo development by acrogranin (epithelin/granulin precursor). Dev Biol 2000; 217:406-418[CrossRef][Medline]
  13. Shams-Borhan G, Huneau D, Flechon JE. Acrosin does not appear to be bound to the inner acrosomal membrane of bull spermatozoa. J Exp Zool 1979; 209:143-149[CrossRef][Medline]
  14. Cheng A, Le T, Palacios M, Bookbinder LH, Wassarman PM, Suzuki F, Bleil JD. Sperm-egg recognition in the mouse: characterization of sp56, a sperm protein having specific affinity for ZP3. J Cell Biol 1994; 125:867-878[Abstract/Free Full Text]
  15. Primakoff P, Hyatt H, Myles DG. A role for the migrating sperm surface antigen PH-20 in guinea pig sperm binding to the egg zona pellucida. J Cell Biol 1985; 101:2239-2244[Abstract/Free Full Text]
  16. Phelps BM, Primakoff P, Koppel DE, Low MG, Myles DG. Restricted lateral diffusion of PH-20, a PI-anchored sperm membrane protein. Science 1988; 240:1780-1782[Abstract/Free Full Text]
  17. Phelps BM, Myles DG. The guinea pig sperm plasma membrane protein, PH-20, reaches the surface via two transport pathways and becomes localized to a domain after an initial uniform distribution. Dev Biol 1987; 123:63-72[CrossRef][Medline]
  18. Overstreet JW, Lin Y, Yudin AI, Meyers SA, Primakoff P, Myles DG, Katz DF, Vandevoort CA. Location of the PH-20 protein on acrosome-intact and acrosome-reacted spermatozoa of cynomolgus macaques. Biol Reprod 1995; 52:105-114[Abstract]
  19. Sabeur K, Cherr GN, Yudin AI, Primakoff P, Li MW, Overstreet JW. The PH-20 protein in human spermatozoa. J Androl 1997; 18:151-158[Abstract/Free Full Text]
  20. Thaler CD, Cardullo RA. Biochemical characterization of a glycosylphosphatidylinositol-linked hyaluronidase on mouse sperm. Biochemistry 1995; 34:7788-7795[CrossRef][Medline]
  21. Zheng Y, Deng X, Martin-DeLeon PA. Lack of sharing of spam1 (Ph-20) among mouse spermatids and transmission ratio distortion. Biol Reprod 2001; 64:1730-1738[Abstract/Free Full Text]
  22. Lin Y, Mahan K, Lathrop WF, Myles DG, Primakoff P. A hyaluronidase activity of the sperm plasma membrane protein PH-20 enables sperm to penetrate the cumulus cell layer surrounding the egg. J Cell Biol 1994; 125:1157-1163[Abstract/Free Full Text]
  23. Gmachl M, Sagan S, Ketter S, Kreil G. The human sperm protein PH-20 has hyaluronidase activity. FEBS Lett 1993; 336:545-548[CrossRef][Medline]
  24. Myles DG, Hyatt H, Primakoff P. Binding of both acrosome-intact and acrosome-reacted guinea pig sperm to the zona pellucida during in vitro fertilization. Dev Biol 1987; 121:559-567[CrossRef][Medline]
  25. Primakoff P, Woolman-Gamer L, Tung KS, Myles DG. Reversible contraceptive effect of PH-20 immunization in male guinea pigs. Biol Reprod 1997; 56:1142-1146[Abstract]
  26. Snell WJ, White JM. The molecules of mammalian fertilization. Cell 1996; 85:629-637[CrossRef][Medline]
  27. Mandal A, Naaby-Hansen S, Wolkowicz MJ, Klotz K, Shetty J, Retief JD, Coonrod SA, Kinter M, Sherman N, Cesar F, Flickinger CJ, Herr JC. FSP95, a testis-specific 95-kilodalton fibrous sheath antigen that undergoes tyrosine phosphorylation in capacitated human spermatozoa. Biol Reprod 1999; 61:1184-1197[Abstract/Free Full Text]
  28. Naaby-Hansen S, Flickinger CJ, Herr JC. Two-dimensional gel electrophoretic analysis of vectorially labeled surface proteins of human spermatozoa. Biol Reprod 1997; 56:771-787[Abstract]
  29. Bordier C. Phase separation of integral membrane proteins in Triton X-114 solution. J Biol Chem 1981; 256:1604-1607[Abstract/Free Full Text]
  30. Shetty J, Diekman AB, Jayes FCL, Sherman N, Naaby-Hansen S, Flickinger CJ, Herr JC. Differential extraction and enrichment of human sperm surface proteins in a proteome: identification of immunocontraceptive candidates. Electrophoresis 2001
  31. Hao Z, Furunobu A, Nagata A, Okayama H. A zinc finger protein required for stationary phase viability in fission yeast. J Cell Sci 1997; 110:2557-2566[Abstract]
  32. Visconti PE, Bailey JL, Moore GD, Pan D, Olds-Clarke P, Kopf GS. Capacitation of mouse spermatozoa. I. Correlation between the capacitation state and protein tyrosine phosphorylation. Development 1995; 121:1129-1137[Abstract]
  33. Shetty J, Naaby-Hansen S, Shibahara H, Bronson R, Flickinger CJ, Herr JC. Human sperm proteome: immunodominant sperm surface antigens identified with sera from infertile men and women. Biol Reprod 1999; 61:61-69[Abstract/Free Full Text]
  34. Bronson R, Tung K. Human sperm antibodies and their detection. In:Rose NR, de Marcar;agio ER (eds.), Manual of Clinical Laboratory Immunology, 4 ed. Washington, DC: American Society for Microbiology; 1992: 1013–1017
  35. Kozak M. An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res 1987; 15:8125-8148[Abstract/Free Full Text]
  36. Galinski MR, Arnot DE, Cochrane AH, Barnwell JW, Nussenzweig RS, Enea V. The circumsporozoite gene of the Plasmodium cynomolgi complex. Cell 1987; 48:311-319[CrossRef][Medline]
  37. Davey J, Davis K, Imai Y, Yamamoto M, Matthews G. Isolation and characterization of krp, a dibasic endopeptidase required for cell viability in the fission yeast Schizosaccharomyces pombe. EMBO J 1994; 13:5910-5921[Medline]
  38. Altschul SF, Lipman DJ. Protein database searches for multiple alignments. Proc Natl Acad Sci U S A 1990; 87:5509-5513[Abstract/Free Full Text]
  39. Argos P, Vingron M, Vogt G. Protein sequence comparison: methods and significance. Protein Eng 1991; 4:375-383[Free Full Text]
  40. Guerra B, Siemer S, Boldyreff B, Issinger OG. Protein kinase CK2: evidence for a protein kinase CK2beta subunit fraction, devoid of the catalytic CK2alpha subunit, in mouse brain and testicles. FEBS Lett 1999; 462:353-357[CrossRef][Medline]
  41. Krehan A, Pyerin W. Intermolecular contact sites in protein kinase CK2. Mol Cell Biochem 1999; 191:21-28[CrossRef][Medline]
  42. Boyse E, Old L. Some aspects of normal and abnormal cell surface genetics. Annu Rev Genet 1969; 3:269-290[CrossRef]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
R. Jones, P. S. James, D. Oxley, J. Coadwell, F. Suzuki-Toyota, and E. A. Howes
The Equatorial Subsegment in Mammalian Spermatozoa Is Enriched in Tyrosine Phosphorylated Proteins
Biol Reprod, September 1, 2008; 79(3): 421 - 431.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
Z. Hao, K. N. Jha, Y.-H. Kim, S. Vemuganti, V.A. Westbrook, O. Chertihin, K. Markgraf, C. J. Flickinger, M. Coppola, J. C. Herr, et al.
Expression analysis of the human testis-specific serine/threonine kinase (TSSK) homologues. A TSSK member is present in the equatorial segment of human sperm
Mol. Hum. Reprod., June 1, 2004; 10(6): 433 - 444.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Shetty, M. J. Wolkowicz, L. C. Digilio, K. L. Klotz, F. L. Jayes, A. B. Diekman, V. A. Westbrook, E. M. Farris, Z. Hao, S. A. Coonrod, et al.
SAMP14, a Novel, Acrosomal Membrane-associated, Glycosylphosphatidylinositol-anchored Member of the Ly-6/Urokinase-type Plasminogen Activator Receptor Superfamily with a Role in Sperm-Egg Interaction
J. Biol. Chem., August 15, 2003; 278(33): 30506 - 30515.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles