Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Siebel, A. L.
Right arrow Articles by Parry, L. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Siebel, A. L.
Right arrow Articles by Parry, L. J.
Agricola
Right arrow Articles by Siebel, A. L.
Right arrow Articles by Parry, L. J.
Biology of Reproduction 66, 1237-1243 (2002)
© 2002 Society for the Study of Reproduction, Inc.


Regular Article

Up-Regulation of Mesotocin Receptors in the Tammar Wallaby Myometrium Is Pregnancy-Specific and Independent of Estrogen1

Andrew L. Siebela,b, Helen M. Gehringa,b, Chris D. Navea, Ross A.D. Bathgateb, Clare E. Borchersa, and Laura J. Parry2,,a,b

a Department of Zoology, b Howard Florey Institute of Experimental Physiology & Medicine, University of Melbourne, Parkville, Victoria 3010, Australia


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The oxytocin-like peptide of most Australian marsupials is mesotocin, which stimulates uterine contractions and is important for normal birth in the tammar wallaby. Female marsupials have two uteri and, in monovular species such as the tammar, one uterus is gravid with a single fetus, whereas the contralateral uterus is nongravid. A significant increase in myometrial mesotocin receptor concentrations occurs only in the gravid uterus on Day 23 of the 26-day gestation. This study examined whether or not mesotocin receptors are present in the myometrium and are up-regulated at the equivalent stage of the luteal phase in unmated tammars. In contrast to the marked increase in mesotocin receptor mRNA and protein concentrations in the myometrium of the gravid uterus during pregnancy, receptors did not increase in the unmated animals. There were also no significant differences between the two uteri, except on Day 27. Plasma profiles of peripheral estradiol-17ß and progesterone did not differ significantly between pregnant and nonpregnant cycles. However, progesterone concentrations were significantly lower on Day 1 postpartum compared with Day 27 of the nonpregnant cycle. In pregnant tammars, the molar ratio of circulating estradiol-17ß to progesterone increased significantly between Day 25 of gestation and 1 day postpartum, but was not correlated with an increase in mesotocin receptor concentrations in either uterus. The data confirm that a local fetal influence is more important than systemic factors, such as estrogen, in the regulation of uterine mesotocin receptors in the tammar wallaby.

estradiol, female reproductive tract, oxytocin, pregnancy, uterus


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The nonapeptide hormone oxytocin (OT) is a potent stimulator of uterine contractions and is associated with the marked increase in uterine activity at the end of pregnancy [1]. Administration of different OT receptor (OTR) antagonists delays the onset of delivery and prolongs labor in rats [2] and guinea pigs [3]. Treatment with OTR antagonists also attenuates the frequency of small uterine contractions, which are presumed to be caused by pulses of OT in sheep [4] and nonhuman primates [5].

Oxytocin receptors are present in the plasma membranes of target cells in all tissues associated with an OT physiology. In general, the levels of OTR mRNA and protein within the myometrium increase in parallel at the end of pregnancy and reach peak values just before the onset of parturition [1]. This receptor up-regulation is correlated with the marked increase in myometrial sensitivity to OT. However, there are notable species differences, especially in the timing of receptor up-regulation and the mechanisms controlling OTR expression. In rodents, an abrupt increase in uterine OTR gene expression and receptor concentrations occurs a few hours before birth [6, 7] and is regulated by a decrease in progesterone and an increase in estrogen [6, 8]. However, in the cow and guinea pig, myometrial OTRs gradually increase from mid-pregnancy and reach high levels weeks before the onset of labor in the presence of relatively high levels of circulating progesterone and low levels of estrogen [9, 10]. In the sheep, the timing of OTR expression varies between different tissues despite a similar steroid environment [11].

Unlike eutherians, most Australian marsupials secrete mesotocin (MT) which differs from OT by a single amino acid, an isoleucine for leucine at position 8 [12]. Female marsupials have two anatomically separate uteri, which open into the anterior vaginal expansion via separate cervices. Macropodid marsupials, such as the tammar wallaby, Macropus eugenii, are monovular species and so only one uterus, the gravid uterus, will contain the single conceptus in each pregnancy cycle, whereas the contralateral uterus is nongravid. At parturition, the fetus moves from the gravid uterus, through the cervix, and into the median vagina. It is believed that contractions initiated in the uterus result in the rapid expulsion of the fetus. MT is one of the key hormones regulating this contractile activity in marsupials [13]. From Day 20 of gestation to the day of birth (Day 26) in the tammar wallaby, the gravid uterus becomes increasingly sensitive to exogenous MT, which stimulates an increase in frequency and amplitude of in vitro myometrial contractions [14, 15]. This uterotonic effect of MT appears to be essential for normal parturition in the tammar wallaby as continuous intravenous infusion with the OTR antagonist atosiban delays the onset of birth [16]. As in eutherians, the change in uterine responsiveness to MT at the end of pregnancy in the tammar is related to a significant increase in MT receptors (MTRs) in the myometrium [14]. A marked up-regulation in MTR concentrations occurs on Day 23 of pregnancy, but in the myometrium of the gravid uterus only. In contrast, MTR concentrations in the nongravid uterus are down-regulated compared with earlier pregnancy stages [14]. It was suggested that the increase in myometrial MTRs in the gravid uterus is due to a stimulatory endocrine factor originating from the feto-placental unit. The mechanisms involved in the regulation of uterine MTRs in marsupials have not yet been established.

In most marsupials, the life span of the corpus luteum is not extended by the presence of a conceptus, and the luteal phase in unmated animals is similar in duration to the length of gestation [17]. Moreover, in the tammar wallaby, the estrous cycle is not interrupted by pregnancy. Regardless of whether or not the animal is pregnant, one uterus will be associated with an active corpus luteum, whereas the other uterus will be associated with a developing follicle. The important difference between the two reproductive cycles is the absence of a conceptus in the nonpregnant cycle. The aim of this study was to establish whether or not the up-regulation in myometrial MTRs is dependent on the presence of the feto-placental unit or occurs at the equivalent stage of the luteal phase in both reproductive cycles. We also measured circulating estradiol-17ß and progesterone concentrations to examine the relationship between these steroids and changes in MTR concentrations.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
All experiments were conducted with approval from the University of Melbourne Animal Experimentation Ethics Committee according to the National Health and Medical Research Council Guidelines for the Use of Animals in Biomedical Research and the Guidelines for the Use of Native Fauna in Biomedical Research.

Animals

Most of the pregnancy tissues were obtained from adult female tammar wallabies that were shot in the wild on Kangaroo Island, with approval from the South Australia National Parks and Wildlife Services (permit A23892). Stages of pregnancy were determined by measuring the crown rump and head lengths of the fetus, as well as assessing developmental characteristics. The remainder of the samples were obtained from adult female tammars (originally from Kangaroo Island) housed in a captive breeding colony (University of Melbourne) in open grassed enclosures with water, lucerne cubes, and fresh vegetables readily available. Pregnant and nonpregnant cycles were synchronized by first removing the pouch young of tammars that were assumed to be carrying a blastocyst in embryonic diapause. Removal of the pouch young terminates embryonic diapause, and the blastocyst and corpus luteum resume development. Animals were checked for births 26–27 days later. One group of animals was housed without males, so no postpartum matings occurred during the subsequent estrus period. In this way, it was possible to obtain tissues from unmated animals at equivalent stages of the luteal phase to compare with pregnant animals.

MTR Concentrations in Pregnancy Versus the Nonpregnant Cycle

Uterine tissues and blood samples (5 ml) were obtained from pregnant tammars on Days 17, 19, 21, 22, 23, 24, and 25; and 1 day postpartum (n = 3 or 4 at each stage); and on Days 19, 21, 23, 25, and 27 of the nonpregnant cycle (n = 3 or 4 at each stage). The animals from the breeding colony were killed by intracardiac injection of 5–10 ml of sodium pentobarbitone (60 mg/ml in 0.9% sterile saline; Abbot, Kurnell, NSW, Australia) after first inducing anesthesia via the lateral tail vein. The reproductive tracts were removed as quickly as possible after the animal was killed, and the uterus ipsilateral to the corpus luteum was identified. The two uteri were then dissected from the extrauterine tissue, cut longitudinally, and gently pulled apart to open the uterine cavity. The yolk sac placenta, or endometrium and cervix (or all) were separated from each myometrium. Tissues were snap-frozen and stored at -80°C until further processing. Blood samples were centrifuged at 1700 x g for 10 min at 4°C, and plasma was stored at -20°C until assayed. In pregnant animals, the uterus ipsilateral to the corpus luteum and containing the fetus is the gravid uterus, whereas the contralateral uterus is nongravid. In a nonpregnant cycle, the uterus ipsilateral to the corpus luteum is designated the CL-uterus and the contralateral uterus is the follicle-uterus. In this experiment, MTR mRNA and protein concentrations were measured in the myometrium of the two uteri in each animal, and compared between the pregnant and nonpregnant cycles.

Radioreceptor Assay

Radioreceptor assays were carried out as described in Parry et al. [19] using [125I] d(CH2)5 [Tyr(Me)2, Tyr4, Orn8, Tyr-NH29]-vasotocin (125I-OTA; Amrad Biotech, Boronia, Victoria, Australia) with a specific activity of 2200 Ci/mmol. The receptor assay mixture consisted of duplicate aliquots of 0.1 ml diluted tissue suspension, 0.1 ml 125I-OTA (15 000–20 000 cpm/tube), and 0.1 ml assay buffer (50 mM Tris-HCl, 5 mM MgCl2, 0.2% BSA pH 7.6) containing a range of 0.01–1 pmol/tube of unlabeled OTA (kindly provided by Dr. Maurice Manning, Medical College of Ohio, Toledo, OH). Protein concentrations in the resuspended membrane fractions were measured using a DC Protein Assay Kit (Bio-Rad, Regents Park, NSW, Australia) with BSA as the protein standard. Assay protein concentrations were in the range of 60–120 µg/ml, which was within the range at which specific binding is linearly correlated with protein concentration. Data were analyzed by nonlinear regression using the Ligand computer program [18] to obtain the binding affinity (Ka) and the receptor content (Ro) for radiolabeled ligand binding.

Competitive binding assays were carried out to determine the ligand specificity of the 125I-OTA binding site in the myometrium of unmated animals. A 0.1-ml aliquot of myometrium membrane preparation obtained from animals on Days 25 and 27 of the nonpregnant cycle was incubated with 0.1 ml 125I-OTA in competition with a series of ligand solutions of varying molar concentrations prepared in assay buffer using the following ligands: OT, MT, [Arg-8]vasopressin (AVP), [Lys-8]vasopressin (LVP), (all from Sigma, Castle Hill, NSW, Australia); a vasopressin V1 receptor antagonist d(CH2)5, Tyr (Me)2-AVP (MC), and phenypressin ([Phe2]vasopressin, PP) (both kindly provided by Dr. Maurice Manning). The interaction of each peptide with 125I-OTA was expressed as a relative displacement curve (B/B0) versus log molar concentration and fitted with sigmoidal curves (GraphPad Prism). Two independent experiments were conducted using triplicates of each ligand to determine the respective IC50 values.

MR Gene Expression

Real-time polymerase chain reaction (PCR) was used to quantify MTR gene expression in the myometrium. For each sample, 600 ng total RNA was reverse transcribed in a 30-µl reaction containing 1x TaqMan buffer, 5.5 mM MgCl2, 500 µm dNTPs, 2.5 µM oligo(dT), 0.4 µl RNase inhibitor, and 1.25 U/µl MultiScribe reverse transcriptase (Applied Biosystems, Inc., Foster City, CA). A second reaction mixture using 30 ng total RNA from each sample and a series of myometrium RNA dilutions (100–0.001 ng) was prepared for the endogenous reference 18S ribosomal RNA PCR reactions and to generate the 18S standard curves, respectively. First-strand cDNA synthesis for all samples was carried out simultaneously at 25°C for 10 min, 42°C for 45 min, and 95°C for 10 min, with a final cooling temperature at 4°C before storage at -20°C.

For real-time PCR, tammar-specific MTR primers and probe were designed using Primer Express (Applied Biosystems) to span the second intron of the MTR gene [19]. A 75-base pair (bp) fragment was amplified using a 22-mer forward primer (5'-CATCACCTTCCACTTTTACGGG) and a 19-mer reverse primer (5'-TGCCCACCACCTGCAGATA). The probe, labeled at the 5' end with FAM (6-carboxy fluorescein) CGACTTTCTCTGCCGCCTCGTCAA (Keystone Division, Biosource International, Foster City, CA) was included with the primers in each reaction tube. The primers and FAM-labeled probe (Keystone Division, Biosource International) for the 18S PCR reaction were as follows: forward primer, 5'-CGGCTACCACATCCAAGGAA; reverse primer, 5'-GCTGGAATTACCGCGGCT; and the probe, FAM 5'-TGCTGGCACCAGACTTGCCCTC. PCRs were carried out in triplicate using 96-well optical reaction plates (Applied Biosystems) in 25-µl volumes consisting of 1x TaqMan Universal PCR Master Mix (including the passive dye reference), 0.8 µM forward and reverse MTR primers, 0.4 µM MTR probe, and 2.5 µl cDNA template. Primer, probe, and cDNA concentrations were optimized in preliminary experiments. Real-time PCR was carried out in an ABI PRISM 7700 Sequence Detector (Applied Biosystems) using the following conditions: 50°C for 10 min and 95°C for 10 min, followed by 40 cycles at 95°C for 15 sec and 58°C for 1 min. Negative template samples were included in each plate as controls. The relative CT standard curve method was used in this study, where CT is the cycle number at which DNA amplification is first detected. In the relative standard curve method, MTR and 18S gene (endogenous reference) expressions are assessed in separate PCRs, and the CT values for both genes are related to those of the endogenous reference standard curve. Expression of the MTR gene is calculated by dividing the normalized target (MTR log CT) values by the normalized endogenous target (18S log CT) values in each sample. The intraassay coefficient of variation was less than 1% using the same 18S standards in four separate assays, and the interassay coefficient of variation was 2.4%.

Steroid Assays

Plasma progesterone concentrations were measured by radioimmunoassay that had been previously validated for tammars [16] with minor modifications using an antiserum raised in sheep against progesterone-11-hemi-succinate-BSA. Progesterone was extracted from 750 µl of plasma with 8 ml of ethyl acetate and reconstituted in 250 µl of assay buffer. Duplicate 100-µl aliquots were all measured in the same assay. The recovery of 3H-progesterone (1,2,6,7-H3-progesterone, Amersham Pharmacia Biotech, Castle Hill, Sydney, Australia) from tammar plasma was 84%. Solvent and buffer blanks were consistently below the sensitivity of the assay, which was 20 pg/ml. The intraassay coefficient of variation was 5.3%.

Estradiol-17ß was measured by the radioimmunoassay method of Shaw and Renfree [20] with minor modifications, using sheep antiestradiol-17ß (SIROsera, BioQuest, Sydney, Australia) at a final dilution of 1:50 000. The cross-reactivity for the antiserum was 100% for estradiol-17ß; 8.4% for estradiol-17{alpha}-benzoate; and <1% for estradiol-17{alpha}, estrone, testosterone, androstenedione, progesterone, cortisol, and 17{alpha}-hydroxyprogesterone. Estradiol was first extracted by the addition of 5 ml of diethyl ether to 1 ml of plasma and vigorous shaking for 10 min. The phases were allowed to separate, the aqueous phase was snap-frozen, and the organic phase was decanted into 13 x 100 mm borosilicate glass tubes and dried under a stream of filtered air. The dried extracts were reconstituted in 450 µl of assay buffer and equilibrated for 1 h at 50°C with regular vortexing. The recovery of 3H-estradiol-17ß (2,4,6,7-H3-estradiol; Amersham Pharmacia Biotech) from tammar plasma using this method was 79%. Duplicate 200-µl aliquots of the extracts were all measured in the same assay. The sensitivity of the assay was 17 pg/ml. A single plasma pool containing a high concentration of estradiol (133 ± 10 pg/ml, n = 3) was used as the quality control sample. The intraassay coefficient of variation was 13%.

Statistical Analysis

Data for MTR mRNA and protein concentrations did not show homogeneity of variance and were log-transformed (SPSS 10.0). ANOVA was performed (SPSS 10.0) to test for significant differences in MTR concentrations and plasma steroid hormone concentrations at each stage of the pregnant and nonpregnant cycles. Paired t-tests were used to compare MTR concentrations between matched samples from the two uteri (gravid versus nongravid; CL-uterus versus follicle-uterus). Correlations between receptor and steroid concentrations were calculated using the method of least squares regression.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Characterization of the MTR in the Myometrium of Nonpregnant Animals

The linearity of Scatchard plots of 125I-OTA binding to matched samples of the CL-uterus and follicle-uterus demonstrated a single class of binding site in the myometrium of nonpregnant tammars. The binding affinities (Ka) were similar in the CL-uterus and the follicle-uterus, and there was no significant (ANOVA, P = 0.84) variation in either uterus at the various stages of the nonpregnant cycle examined. There was also no significant difference in Ka values in the two uteri between the two cycles. The specificity of 125I-OTA binding in the myometrium of unmated animals was demonstrated in a competitive displacement experiment using different OT and vasopressin receptor agonists and antagonists. Data are shown for Day 27 of the nonpregnant cycle (Fig. 1), but the relative binding affinity was the same in both uteri at other stages tested. MT bound with a relatively high affinity to the 125I-OTA binding site as did OT in both the CL-uterus and follicle-uterus. In contrast AVP, LVP, and PP all had much lower binding affinities as higher molar concentrations were needed to displace the 125I-OTA from the binding site. The vasopressin antagonist, MC, also had a relatively low binding affinity for the 125I-OTA binding site compared to MT and OT, but bound with a higher affinity than AVP, LVP, and PP. In general, the ligand affinities were in the following order of decreasing affinity: OTA > MT = OT > MC > AVP = LVP > PP. The binding affinities of the various ligands are shown in Table 1. The IC50 values were lower overall in the myometrium of unmated tammars compared with tissues obtained from pregnant animals. However, the data show that the 125I-OTA binding site discriminated between OT-like and VP-like agonists and antagonists and indicated that in the myometrium of unmated tammars, the predominant receptor is an OT-like receptor.



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 1. Competitive displacement of 125I-OTA binding in the tammar uterus on Day 27 of the nonpregnant cycle in the myometrium of the CL-uterus. The oxytocin-like peptides (OT and MT) have a higher affinity for the 125I-OTA binding site compared with the vasopressin-like peptides (AVP, LVP, PP, and MC)


View this table:
[in this window]
[in a new window]
 
TABLE 1. Binding affinities of various oxytocin and vasopressin receptor agonists and antagonists displacing 125I-IOTA binding to the mesotocin receptor in the myometrium of the gravid (pregnant) and CL-uterus (nonpregnant cycle) of the tammar wallaby

Concentrations of MTRs in matched samples of myometrium from the CL-uterus and follicle-uterus in individual animals ranged from 4 to 135 fmol/mg protein and did not change significantly at any stage of the nonpregnant cycle examined, with one exception (Fig. 2). A significant (ANOVA, P < 0.05) increase in MTRs was observed on Day 21 in the uterus ipsilateral to the corpus luteum. However, there was no large increase in MTRs in either uterus on Day 23 of the nonpregnant cycle. There was also no significant difference in MTR concentrations between the two uteri except on Day 27 (Fig. 2), when MTRs were higher in the follicle-uterus compared with the CL-uterus (paired t-test, P = 0.021).



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 2. Concentrations (mean ± SEM fmol/mg protein) of MTRs in the myometrium of matched samples of CL-uterus (solid bars) and follicle-uterus (open bars) at different stages of the nonpregnant cycle. #, Significantly (P < 0.05) greater than other stages; *, significantly (P < 0.05) different than the CL-uterus

For ethical reasons, it was not possible to collect sufficient samples from pregnant wallabies housed in captivity. Therefore, tissues for this group of animals were supplemented with samples obtained from pregnant wallabies that had been shot in the wild. A pilot study demonstrated no significant differences in either MTR mRNA or protein concentrations between wild versus colony animals at the same stage of gestation. Therefore, data from wild and colony-housed pregnant tammars were pooled at each of the stages of gestation and used in the comparison with colony-housed, nonpregnant tammars.

Mesotocin receptor concentrations were significantly (ANOVA, P < 0.05) higher in the gravid uterus compared to the CL-uterus of the nonpregnant cycle at every stage examined (Fig. 3a). This was also seen comparing the nongravid uterus to the follicle-uterus but only on Days 19, 21, and 23 of the cycle (Fig. 3b). Data from the real-time PCR experiments clearly demonstrate a differential up-regulation in MTR gene expression in the myometrium of the gravid uterus (Fig. 4), which parallels the increase in MTR protein concentrations. There was a significant (P < 0.05) increase in MTR mRNA levels in the gravid uterus on Days 22–25 of gestation compared with the earlier stages (Days 17 and 20) and also in the nongravid uterus on Days 22 and 23. However, MTR mRNA levels in the gravid uterus were significantly (P < 0.05) greater compared with both the nongravid uterus (Fig. 4) and the CL-uterus of unmated tammars (Fig. 5). Likewise, MTR mRNA levels were significantly (P < 0.05) higher in the nongravid uterus compared with the follicle-uterus on Days 19 and 21 of the nonpregnant cycle (Fig. 5). However, both MTR mRNA and protein concentrations decreased in the nongravid uterus on Day 25 of gestation, and there was no significant difference between MTRs on Day 25 and 1 day postpartum, and the equivalent stages in unmated tammars (Figs. 3b and 5).



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 3. Comparison of MTR concentrations (mean ± SEM fmol/mg protein) in the myometrium of the a) gravid (hatched bars) and CL-uterus (solid bars), and b) nongravid (hatched bars) and follicle-uterus (open bars). *, Significantly (P < 0.01) greater compared with the CL-uterus; #, compared with the follicle-uterus in the nonpregnant cycle



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 4. MTR mRNA concentrations (mean ± SEM MTR/18S mRNA ratio x 10-3) in the myometrium of the gravid (solid bars) compared with the nongravid (open bars) uterus. *, Significantly (P < 0.05) greater compared with the nongravid uterus; #, significantly (P < 0.05) greater compared with Day 17 and Day 20 of gestation



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 5. MTR mRNA concentrations (mean ± SEM MTR/18S mRNA ratio x 10-3) in the myometrium of a) pregnant and b) unmated tammar wallabies. *, Significantly (P < 0.05) greater compared with the CL-uterus; #, compared with the follicle-uterus

Steroid Hormone Concentrations

Concentrations of circulating progesterone ranged between 350 and 750 pg/ml in both pregnant and unmated tammars at equivalent stages of the luteal phase on Days 19, 21, 23, and 25. The highest concentrations measured on Day 25 of both reproductive cycles were not significantly different from other stages of the cycle, except Day 1 postpartum (Fig. 6a). The only difference between the two cycles was observed on Day 1 postpartum and Day 27 of the nonpregnant cycle (Fig. 6a). Plasma progesterone concentrations in the postpartum tammars (270 ± 29.95 pg/ml) were significantly (P < 0.01) lower compared with the unmated animals (482 ± 41.05 pg/ml). Concentrations of estradiol-17ß ranged between 20 and 50 pg/ml on Days 19, 21, 23, and 25 of the two cycles and fluctuated considerably between animals, especially in the pregnancy cycle. The only increase in plasma estradiol-17ß was detected on Day 27 of the nonpregnant cycle (Fig. 6b), but it was not significant compared with other stages of the cycle. An increase in the molar ratio was observed in both reproductive cycles on Day 1 postpartum and Day 27 of the nonpregnant cycle (Fig. 7), but was only significant (P < 0.05) compared with other stages in postpartum animals. There was no significant correlation between myometrial MTR concentrations and plasma estrogen concentrations in either the gravid or nongravid uterus at any stage of gestation (Table 2). The postpartum increase in the estradiol-17ß:progesterone molar ratio was not correlated with an increase in MTRs in either uterus. The only positive correlation (r = 0.478, P = 0.029) was observed between MTRs in the gravid uterus and progesterone concentrations; the increase in MTR concentrations in the gravid uterus was associated with elevated circulating progesterone concentrations (Table 2).



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 6. Plasma progesterone (a) and estradiol-17ß (b) concentrations (mean ± SEM pg/ml) in the pregnant ({block}) and nonpregnant cycle ({circ}). Steroid hormone concentrations are similar between the two reproductive cycles, with the exception of the significant (*P < 0.05) decrease in plasma progesterone on Day 1 postpartum. #, Significantly (P < 0.05) lower compared with all other stages of gestation



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 7. Changes in the molar (pmol/L) ratio of plasma estradiol-17ß:progesterone in pregnant ({block}) and unmated ({circ}) tammars. There is a significant (*P < 0.05) increase in the estradiol-17ß:progesterone ratio in Day 1 postpartum tammars


View this table:
[in this window]
[in a new window]
 
TABLE 2. Correlation between plasma estradiol-17ß (E) and progesterone (P) concentrations and mesotocin receptors in the gravid and nongravid uterus of pregnant tammars.*


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study confirmed the presence of an OT-like binding site in the myometrium of unmated tammars. The affinity (Ka) of this receptor for 125I-OTA is similar to that of the MTR in the myometrium of the pregnant tammar [14]. Unlike the brushtail possum and eutherians, the pregnant and nonpregnant tammar uterine MTR shows a higher affinity for MT and OT compared with AVP, LVP, and phenypressin, the latter two being the vasopressor peptides of the tammar wallaby [13]. The concentrations of the peptides or antagonists that inhibited 125I-OTA binding by 50% (IC50) were lower in nonpregnant tissues, but the receptor had the same order of ligand binding affinities compared with the MTR in pregnant tissues [14]. This was important to demonstrate because 125I-OTA binds with high affinity to the tammar testis vasopressin receptor, although the order of ligand binding affinities was markedly different, with AVP and LVP showing a higher affinity for the binding site compared with MT and OT [19]. Furthermore, previous work in the quokka (Setonix brachyurus) showed that arginine vasopressin is more effective in stimulating contractile responses in the estrogen-dominated uterus of nonpregnant animals than OT [21]. However, the relatively high affinities of OT and MT compared with the lower affinities of the vasopressor peptides for the 125I-OTA binding site in the nonpregnant tammar myometrium confirmed that this binding site represents an OT-like receptor similar to those present in the uterus of the pregnant tammar.

Mesotocin receptor mRNA and protein concentrations remain low in the nonpregnant cycle compared with pregnancy, despite the similar length of the luteal phase. This is highlighted by the difference in MTR gene and protein concentrations between the nongravid uterus in pregnancy and the follicle-uterus in unmated animals. There was an increase in myometrial MTRs on Day 21 of the nonpregnant cycle, but MTR concentrations were still significantly less than those observed in pregnant tammars. The only difference between the two uteri was observed at the end of the cycle in the follicle-uterus, but again, receptor concentrations were relatively low. In early pregnancy in the cow, myometrial OTR levels are not different from nonpregnant levels [22], but a sharp up-regulation then occurs only in the myometrium of pregnant cows. Other studies have reported a suppression of myometrial OTRs in early pregnancy but an increase in the estrous cycle [23, 24]. Although a direct comparison between earlier stages of pregnancy and the nonpregnant cycle was not carried out in the tammar, it is possible that there is a suppression of MTRs in unmated animals. The alternative hypothesis is that a pregnancy-specific factor operates very early on in pregnancy to stimulate an increase in receptors above basal levels in both the gravid and nongravid uterus. In the absence of this stimulatory factor, MTRs remain basal as seen in the five stages of the nonpregnant cycle examined.

Circulating progesterone and estradiol-17ß concentrations were similar to those reported in earlier studies [16, 20, 25] as were the similar hormone profiles between the two reproductive cycles. The only difference between the two cycles was the fall in progesterone which occurred earlier in pregnant than unmated tammars, in association with luteolysis. Estradiol-17ß concentrations were low on all days measured except on Day 27 of the nonpregnant cycle. No significant postpartum increase in estradiol-17ß was detected in this study. Females come into estrus and mate approximately 10 h postpartum, with peak estradiol-17ß measured at the time of mating [25]. In our study, animals were sampled 6 h postpartum before they showed signs of estrus. This may explain the relatively low estradiol-17ß levels. An increase in the molar ratio of estradiol-17ß:progesterone occurred in both reproductive cycles and is attributed to the fall in progesterone rather than to an increase in estradiol-17ß. However, more frequent blood sampling is needed in order to demonstrate whether or not an increase in this molar ratio occurs earlier in the peripartum period.

The marked increase in MTR mRNA and protein concentrations that occurs in the myometrium of the gravid uterus on Day 23 of pregnancy is most likely caused by a pregnancy-specific factor because no increase in MTRs occurs at the equivalent stages of the nonpregnant cycle. That there is a difference in both MTR mRNA and protein concentrations between the gravid and nongravid uterus in pregnant tammars suggests that this is a local pregnancy-specific effect derived from the feto-placental unit, rather than the peripheral circulation. In some eutherian species, maximum sensitivity to OT in the myometrium occurs in the estrogen-dominated uterus. It has clearly been demonstrated that OTRs are highly up-regulated at the time of increased estrogen and low progesterone in the systemic circulation of rodents [1, 6, 7]. The decline in progesterone triggers the stimulatory effects of estrogen on uterine OTRs [8]. However, this is not the case in ruminants or guinea pigs [911]. The data in this study suggest that the up-regulation of myometrial MTRs in the gravid uterus of pregnant tammars is also independent of increased estrogen.

The Graafian follicle is the major source of estrogen during both late gestation and the nonpregnant cycle in the tammar wallaby, and concentrations in the utero-ovarian vein ipsilateral to the follicle-uterus are higher than in the contralateral vein or peripheral plasma [25]. An extensive capillary network of ovarian veins and uterine venous system provides a means of local transfer of ovarian hormones into the uterine arterial supply [26]. Hence, estrogen of follicular origin preferentially reaches the ipsilateral nongravid uterus. The gravid uterus is, therefore, exposed to low concentrations of estrogen throughout pregnancy in contrast to the nongravid uterus, which is exposed to higher estrogen concentrations at term and during postpartum estrus. Data in this study showed that the increase in MTRs in the gravid uterus is not associated with an increase in circulating estradiol-17ß. Furthermore, the molar ratio of circulating estradiol-17ß:progesterone did not increase until 1 day postpartum, 4 days after the up-regulation in myometrial MTRs. It is interesting that there was a similar increase in the estradiol-17ß:progesterone ratio in nonpregnant tammars on Day 27 of the nonpregnant cycle, which was associated with a small increase in MTRs in the follicle-uterus. However, the correlation was not significant. This study also demonstrated that as in the cow and sheep, increased MTR concentrations are correlated with high concentrations of circulating progesterone. But as progesterone levels are elevated throughout most of gestation and the nonpregnant cycle in the tammar, it is unlikely that this steroid is the main regulator of MTRs in the myometrium of the gravid uterus.

There also appears to be no correlation between myometrial MTR and estrogen receptor concentrations. Renfree and Blanden [27] reported that progesterone and estrogen receptors in the myometrium double in concentration and are similar in both uteri between Days 0 and 5 of pregnancy in the tammar. But after Day 12, there is a down-regulation in both progesterone and estrogen receptors so that at the time of the unilateral increase in MTRs in the gravid uterus, progesterone and estrogen receptor concentrations are extremely low. Therefore, any regulatory effects of steroids are not mediated at the receptor level. This strengthens our hypothesis that estrogen is not mediating either the differential up-regulation or down-regulation in myometrial MTRs in the pregnant tammar wallaby.

One of the potential mediators of MTRs in the gravid uterus is believed to be mechanical stretch. Two independent studies in unilaterally pregnant rats demonstrated increased OTR concentrations in the distended, gravid horn compared with the nongravid horn [28, 29]. However, ovarian steroids exert the main regulatory influence and distension only has a supplementary effect on OTRs. Mechanical stretch also appears largely responsible for increased OTR mRNA in the sheep myometrium [30]. During early pregnancy in the tammar, both uteri are of similar size and weight, but from Day 20 of gestation, there is a large increase in intrauterine volume in the gravid uterus to accommodate the growing fetus. The gravid uterus becomes turgid as the volume of yolk sac fluid in the uterine cavity increases. It is likely that this causes stretching of the myometrial smooth muscle. Recent data suggest that distension of the gravid uterus may be sufficient to trigger the up-regulation in MTRs observed on Day 23 of pregnancy in the tammar wallaby [13].

This study demonstrated that a large increase in myometrial MTR gene and protein expression occurs only in the pregnant tammar wallaby and not during the nonpregnant cycle. In contrast to the marked increase in MTRs in the myometrium of the gravid uterus on Day 23 of gestation, receptor concentrations remain low at all stages of the nonpregnant cycle examined, with no difference between the two uteri until the end of the cycle. In pregnant tammars, there is no correlation between circulating estradiol-17ß and the increase in MTRs. An increase in the molar ratio of estradiol-17ß to progesterone occurs postpartum, 4 days after the up-regulation of MTRs in the myometrium. The data confirm that a local fetal influence is more important than systemic factors, particularly estrogen, in the regulation of uterine MTRs in the pregnant tammar wallaby.


    ACKNOWLEDGMENTS
 
The authors are especially grateful to Professor Marilyn Renfree (Department of Zoology, University of Melbourne) for providing the steroid hormone antibodies and facilities to house the wallabies, and Professor Geoff Tregear (Howard Florey Institute of Experimental Physiology & Medicine) for providing laboratory facilities to conduct this research. We also thank Professor Maurice Manning for his kind gifts of the OTA and VP-like peptides, Peter and Brenton Davis for assisting with the collection of tammar tissues on Kangaroo Island, and James Ingram for criticism of the manuscript.


    FOOTNOTES
 
First decision: 1 November 2001.

1 This research was supported by a Clive & Vera Ramaciotti research grant and a Small Australian Research Council grant. L.J.P. is an Australian Research Council QEII Research Fellow. R.A.D.B. held an NHMRC Howard Florey Centenary Fellowship. Back

2 Correspondence. FAX: 61 3 9348 1707; l.parry{at}hfi.unimelb.edu.au Back

Accepted: November 21, 2001.

Received: September 28, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Gimp G, Fahrenholz F. The oxytocin receptor system: structure, function and regulation. Physiol Rev 2001; 81:630-683
  2. Antonijevic IA, Douglas AJ, Dye S, Bicknell RJ, Leng G. Oxytocin antagonists delay the initiation of parturition and prolong its active phase in rats. J Endocrinol 1995; 145:97-103[Abstract]
  3. Schellenberg J-C. The effect of oxytocin receptor blockade on parturition in guinea pigs. J Clin Invest 1995; 95:13-19
  4. Owiny JR, Mitchell M, Nathanielsz PW. Effect of 48-hour infusion of the synthetic oxytocin antagonist on myometrial activity of pregnant sheep at 139–140 days of gestation. Biol Reprod 1992; 47:436-440[Abstract]
  5. Honnebier MB, Figueroa JP, Rivier J, Vale W, Nathanielsz PW. Studies on the role of oxytocin in late pregnancy in the pregnant rhesus monkey: plasma concentrations of oxytocin in the maternal circulation throughout the 24-hour day and the effect of the synthetic oxytocin antagonist on spontaneous nocturnal myometrial contractions. J Dev Physiol 1989; 12:225-232[Medline]
  6. Fang X, Wong S, Mitchell BF. Relationships among sex steroids, oxytocin, and their receptors in the rat uterus during late gestation and at parturition. Endocrinology 1996; 137:3213-3219[Abstract]
  7. Cook JL, Zaragoza DB, Sung DH, Olson D. Expression of myometrial activation and stimulation genes in a mouse model of preterm labor: myometrial activation, stimulation, and preterm labor. Endocrinology 2000; 141:1718-1728[Abstract/Free Full Text]
  8. Murata T, Murata E, Liu CX, Narita K, Honda K, Higuchi T. Oxytocin receptor gene expression in rat uterus: regulation by ovarian steroids. J Endocrinol 2000; 166:45-52[Abstract]
  9. Fuchs A-R, Helmer H, Behrens O, Liu H-C, Antonian L, Chang SM, Fields MJ. Oxytocin and bovine parturition: a steep rise in endometrial oxytocin receptors precedes onset of labor. Biol Reprod 1992; 47:937-944[Abstract]
  10. Alexandrova M, Soloff MS. Oxytocin receptors and parturition in the guinea pig. Biol Reprod 1980; 22:1106-1111[Abstract]
  11. Wathes DC, Flick Smith H, Leung ST, Stevenson KR, Meier S, Jenkin G. Oxytocin receptor development in ovine uterus and cervix throughout pregnancy and at parturition as determined by in situ hybridization analysis. J Reprod Fertil 1996; 106:23-31[Abstract]
  12. Acher R, Chauvet J. The neurohypophysial endocrine regulatory cascade: precursors, mediators, receptors, and effectors. Front Neuroendocrinol 1995; 16:237-289[CrossRef][Medline]
  13. Parry LJ, Bathgate RAD. The role of oxytocin and regulation of uterine oxytocin receptors in pregnant marsupials. Exp Physiol 2000; 85S:91-99
  14. Parry LJ, Bathgate RAD, Shaw G, Renfree MB, Ivell R. Evidence for a local fetal influence on myometrial oxytocin receptors during pregnancy in the tammar wallaby. Biol Reprod 1997; 56:200-207[Abstract]
  15. Ingram JN, Renfree MB, Shaw G. Differential regulation of contractility and nitric oxide sensitivity in gravid and nongravid myometrium during late pregnancy in a marsupial. Endocrinology 2001; 142:2244-2251[Abstract/Free Full Text]
  16. Renfree MB, Parry LJ, Shaw G. Infusion with an oxytocin receptor antagonist delays parturition in a marsupial. J Reprod Fertil 1996; 108:131-137[Abstract]
  17. Renfree MB. Endocrinology of pregnancy, parturition and lactation of marsupials. In: Lamming GE (ed.), Marshall's Physiology of Reproduction. London: Chapman & Hall; 1994: 677–766
  18. Munson PJ, Rodbard D. LIGAND: a versatile computerised approach for the characterisation of ligand-binding systems. Anal Biochem 1980; 107:220-228[CrossRef][Medline]
  19. Parry LJ, Bathgate RAD. Mesotocin receptor gene and protein expression in the prostate, but not the testis, of the tammar wallaby. Biol Reprod 1998; 59:1101-1107[Abstract/Free Full Text]
  20. Shaw G, Renfree MB. Concentrations of oestradiol-17ß in plasma and corpora lutea throughout pregnancy in the tammar (Macropus eugenii). J Reprod Fertil 1994; 72:29-37
  21. Heller H. The effects of oxytocin and vasopressin during the oestrous cycle and pregnancy on the uterus of a marsupial species, the quokka. J Endocrinol 1973; 58:657-671[Medline]
  22. Fuchs A-R, Behrens O, Helmer H, Liu C-H, Barros CM, Fields MJ. Oxytocin and vasopressin receptors in bovine endometrium and myometrium during the oestrous cycle and early pregnancy. Endocrinology 1990; 127:629-636[Abstract]
  23. Jenner LJ, Parkinson TJ, Lamming GE. Uterine oxytocin receptors in cyclic and pregnant cows. J Reprod Fertil 1991; 91:49-58[Abstract]
  24. Wathes DC, Hamon M. Localization of oestradiol, progesterone and oxytocin receptors in the uterus during the oestrous cycle and early pregnancy in the ewe. J Endocrinol 1993; 138:479-492[Abstract]
  25. Harder JD, Hinds LA, Horn CA, Tyndale-Biscoe CH. Oestradiol in follicular fluid and in utero-ovarian venous and peripheral plasma during parturition and postpartum oestrus in the tammar wallaby (Macropus eugenii). J Reprod Fertil 1984; 72:551-558[Abstract]
  26. Towers PA, Shaw G, Renfree MB. Urogenital vasculature and local steroid concentrations in the uterine branch of the ovarian vein of the female tammar wallaby. J Reprod Fertil 1986; 78:37-47[Abstract]
  27. Renfree MB, Blanden DR. Progesterone and oestrogen receptors in the female genital tract throughout pregnancy of the tammar wallaby. J Reprod Fertil 2000; 119:121-128[Abstract]
  28. Alexandrova M, Soloff MS. Oxytocin receptors and parturition. II Concentrations of receptors for oxytocin and estrogen in the gravid and nongravid uterus at term. Endocrinology 1980; 106:736-738[Abstract]
  29. Fuchs A-R, Periyasamy S, Soloff MS. Systemic and local regulation of oxytocin receptors in the rat uterus, and their functional significance. Can J Biochem Cell Biol 1983; 61:615-624[Medline]
  30. Wu WX, Ma XH, Yoshizato T, Shinozuka N, Nathanielsz PW. Differential expression of myometrial oxytocin receptor and prostaglandin H synthase 2, but not estrogen receptor alpha and heat shock protein 90 messenger ribonucleic acid in the gravid horn and nongravid horn in sheep during betamethasone-induced labor. Endocrinology 1999; 140:5712-5718[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
T. D. Hewitson, I. Mookerjee, R. Masterson, C. Zhao, G. W. Tregear, G. J. Becker, and C. S. Samuel
Endogenous Relaxin Is a Naturally Occurring Modulator of Experimental Renal Tubulointerstitial Fibrosis
Endocrinology, February 1, 2007; 148(2): 660 - 669.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
P Fu, P-J Shen, C-X Zhao, D J Scott, C S Samuel, J D Wade, G W Tregear, R A D Bathgate, and A L Gundlach
Leucine-rich repeat-containing G-protein-coupled receptor 8 in mature glomeruli of developing and adult rat kidney and inhibition by insulin-like peptide-3 of glomerular cell proliferation.
J. Endocrinol., May 1, 2006; 189(2): 397 - 408.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
A. L Siebel, R. A D Bathgate, and L. J Parry
Differential expression of mesotocin receptors in the uterus and ovary of the pregnant tammar wallaby
Reproduction, May 1, 2005; 129(5): 639 - 649.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
V. Terzidou, S. R. Sooranna, L. U. Kim, S. Thornton, P. R. Bennett, and M. R. Johnson
Mechanical Stretch Up-Regulates the Human Oxytocin Receptor in Primary Human Uterine Myocytes
J. Clin. Endocrinol. Metab., January 1, 2005; 90(1): 237 - 246.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
X.-J. Du, C. S Samuel, X.-M. Gao, L. Zhao, L. J Parry, and G. W Tregear
Increased myocardial collagen and ventricular diastolic dysfunction in relaxin deficient mice: a gender-specific phenotype
Cardiovasc Res, February 1, 2003; 57(2): 395 - 404.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. L. Siebel, H. M. Gehring, and L. J. Parry
Effects of Fetectomy on Oxytocin Receptors in the Myometrium of the Tammar Wallaby
Biol Reprod, October 1, 2002; 67(4): 1242 - 1249.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Siebel, A. L.
Right arrow Articles by Parry, L. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Siebel, A. L.
Right arrow Articles by Parry, L. J.
Agricola
Right arrow Articles by Siebel, A. L.
Right arrow Articles by Parry, L. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS