|
|
||||||||
Regular Article |
a Endocrinology-Reproductive Physiology Program
b Department of Dairy Science, University of Wisconsin-Madison, Madison, Wisconsin 53706
| ABSTRACT |
|---|
|
|
|---|
1 day delay in Cox-2 induction by cAMP in fresh granulosa cells. Myristoylated protein kinase (PK) A and PKC inhibitory peptides were utilized to further confirm the PKA- or PKC-dependence of Cox-2 induction. Time-course experiments showed that only 2 days of forskolin treatment could induce PKC-responsiveness of the Cox-2 promoter, although maximal responsiveness was not observed until 10 days of luteinization. Promoter activity was also analyzed in a series of deletion mutants as well as site-directed mutants of C/EBP, CRE, and E-box. A 282-base pair sequence in the Cox-2 5' flanking region maintained full inducibility by PKA in granulosa cells and by PKC in luteinized granulosa cells. The E-box element was found to be the critical regulatory element for Cox-2 induction by either PKA in granulosa cells or by PKC in luteinized granulosa cells. Electrophoretic mobility shift assays were performed on nuclear extracts from fresh or luteinized granulosa cells. Upstream stimulatory factor (USF)-1 and USF-2 bound to the E-box of the Cox-2 gene, and binding was similar for nuclear extracts from fresh, cultured, or luteinized granulosa cells. Thus, although luteinization changes transcriptional regulation of Cox-2 from PKA- to PKC-dependence, the crucial role of the E-box element in this transcriptional activation is conserved.
corpus luteum, follicle, gene regulation, granulosa cells, ovary
| INTRODUCTION |
|---|
|
|
|---|
, acting through the PGF2
receptor (FP) [7]. Although PGF2
from the nonpregnant uterus is essential for initiation of luteolysis in many species, PGF2
synthesis clearly occurs in luteal cells of the human [8, 9], rhesus monkey [10], pig [11, 12], sheep [13, 14], cow [15, 16], horse [17], and pseudopregnant rat [18]. Interestingly, PGF2
production by large luteal cells is induced by small amounts of PGF2
in an auto-amplification pathway that may be essential for normal luteolysis [19]. Differential regulation of PG production in granulosa and large luteal cells is particularly intriguing, because follicular granulosa cells appear to differentiate into large luteal cells following the LH surge and ovulation. Cyclooxygenase (Cox) controls the rate-limiting step of PG synthesis [13]. Two isoforms of Cox, encoded by two different genes, have been identified as Cox-1 and Cox-2. Cyclooxygenase-1 is constitutively expressed in many cells and is generally regarded as a housekeeping gene. In contrast, Cox-2 is generally absent in most tissues and is induced by various stimuli, including growth factors, mitogens, cytokines, and tumor promoters [13]. In Cox-2, but not in Cox-1, knock-out mice, severe impairments in ovulation, fertilization, implantation, and decidualization occurred, although ovarian follicular development appeared to be normal in these animals [2022]. A similar decrease in ovulation rate was induced by treating rats with a putative Cox-2 inhibitor, NS-398 [23], or by knock-out of the EP2 receptor [5, 6]. Collectively, these data are consistent with the existence of a crucial role for Cox-2 in female reproduction.
In granulosa or large luteal cells, an increase in Cox-2 mRNA and protein expression is coincident with either ovulation or luteolysis. In large luteal cells, treatment with PGF2
or activators of the protein kinase (PK) C intracellular effector system caused an immediate increase in Cox-2 expression [19], which is consistent with the designation of Cox-2 as an immediate early gene in many cell types [13]. In contrast, the LH surge, acting through PKA, is the primary inducer of Cox-2 expression in follicular granulosa cells. A substantial delay from treatment until Cox-2 expression has been reported in granulosa cells from sheep [13], horse [24], and cow [25]. A constant, 10-h interval from induction of Cox-2 protein to ovulation is consistent with speculation that the timing of Cox-2 expression is critical for the timing of ovulation after the LH surge [24]. Thus, although production of PGs in large luteal or granulosa cells both involves induction of Cox-2, a sharp contrast is found in the induction pathways (PKC vs. PKA) and in the timing (immediate vs. delayed).
The 5' regulatory sequence of the Cox-2 gene has been one of the most intensively studied promoter regions, and it has surprisingly diverse regulation that varies by different cell types and different stimuli. A number of cis-regulatory elements, including IRE (interferon response element) [26], NF
B [27], C/EBP (NFIL-6) [28, 29], CRE (cAMP responsive element) [30, 31], or E-box [32, 33], have been proposed as key mediators of Cox-2 transcription in various cells. In rat granulosa cells, C/EBP or E-box were reported to be essential elements for regulation of Cox-2 transcription [28, 32]. In bovine granulosa cells, only the E-box was found to be critical for induction of Cox-2 by the LH surge or PKA activators [34]. In ovine large luteal cells, Cox-2 induction by PGF2
or PKC activators was mediated not only by the E-box element but also by C/EBP and CRE sequences in a combinatorial manner [35]. In the present study, we evaluated the changes in regulation, timing, and critical 5' response elements involved in induction of Cox-2 in bovine granulosa cells before or after in vitro luteinization to produce cells similar to large luteal cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Fetal bovine serum (FBS) was from Gibco (Grand Island, NY). Luciferase assay kit, pGL2B plasmid, pGEM-T easy vector, T4 polynucleotide kinase, and restriction enzymes were purchased from Promega (Madison, WI). The PCRTMII vector was from Invitrogen (Carlsbad, CA). MicroSpin G-50 column and poly(dI-dC) oligonucleotides were purchased from Amersham Pharmacia (Piscataway, NJ). SuperFect transfection reagent and endotoxin-free plasmid purification columns were from Qiagen (Valencia, CA). Pfu DNA polymerase was from Stratagene (La Jolla, CA). The BigDye terminator cycle sequencing kit was from Applied Biosystems (Foster City, CA). Polyclonal antibodies against upstream stimulatory factor (USF)-1 and USF-2 were from Santa Cruz Biotechnology (Santa Cruz, CA). The PGF2
analogue, cloprostenol, was purchased from Cayman Chemical Company (Ann Arbor, MI). Myristoylated PKA inhibitory pseudosubstrate peptide and PKC inhibitory pseudosubstrate peptide were purchased from Calbiochem (San Diego, CA). Unless otherwise specified, other chemicals and reagents used in these studies were purchased from Sigma (St. Louis, MO).
Culture of Bovine Granulosa Cells
Bovine ovarian follicles from the slaughterhouse with diameters from 8 to 10 mm were dissected away from the ovary. Follicles were cut in half and rinsed with M199 with 10 µg/ml of DNase I and 50 U/ml of heparin. Granulosa cells were collected from the internal surface of the follicular wall using a sterile rubber policeman. Granulosa cells were plated down (250 000 cells/well for fresh granulosa cells, 150 000 cells/well for long-term culture groups) overnight in 24-well plates in the presence of 0.1% (w/v) BSA, 1 µg/ml of insulin, and 10% (v/v) FBS. The ovaries were collected from nonpregnant cows at random stages of the estrous cycle. All experiments were done on multiple occasions with granulosa cells collected from different cows. In addition, on a given day, each treatment was done in triplicate, and results from these three wells were averaged to provide the results from that particular day. All mean ± SEM results represent the average and variation between results obtained on different days or, in other words, variation between cows and not variation between wells. Fresh granulosa cells in all the reported studies were the cells that were immediately used after overnight plating. Luteinized granulosa cells were produced by culturing the granulosa cells for a further 8 days in M199 with 1% FBS containing 10 µM forskolin (PKA activator) as previously described [3639]. Cultured nonluteinized granulosa cells were cultured for 8 days in M199 with 1% FBS without forskolin.
DNA Preparation and Transient Transfection
To obtain the 5' flanking sequence of the bovine Cox-2 gene, primers were designed (5'-TGACTAGAGGAGAAAGGCTTCC-3' and 5'-GAGGAGGGCGGTGCGGAGTT-3') from -1553 base pairs (bp) to +61 bp of bovine Cox-2 genomic DNA sequence [34]. Bovine genomic DNA (100 ng) was amplified by polymerase chain reaction (PCR) using these primers with Taq DNA polymerase. The PCR proceeded with preheating at 95°C for 1 min and then 35 cycles of 1 min at 95°C, 1 min at 57°C, and 1.5 min at 72°C, followed by 10 min at 72°C. The amplified product was separated on 0.7% agarose gel and visualized after staining with ethidium bromide. The PCR product was phenol/chloroform-treated twice, precipitated with 100% ethanol, and resuspended in 1x Tris-EDTA buffer. The pure PCR product was ligated into a PCRTMII vector through a TA cloning site. The ligation mixture was used to transform Escherichia coli-competent cells (DH5
). Plasmid DNA, isolated from a positive colony, was subjected to DNA sequencing using the BigDye terminator cycle sequencing kit. The product was purified through the MicroSpin G-50 column, lyophilized, and sequenced by the Biotech Center at the University of Wisconsin-Madison. The sequence was compared to the bovine sequence from GenBank and confirmed to be the 5' flanking sequence of the bovine Cox-2 gene. Later, this 5' flanking sequence was cleaved out from the PCRTMII vector and subcloned into a luciferase reporter vector (pGL2B) through KpnI and XhoI restriction enzyme sites. Isolation of the 5' flanking sequence of ovine Cox-2 gene was reported previously [13, 35]. Previous expression plasmids had been constructed using the 5' flanking sequence from the ovine Cox-2 gene, and these were useful in determining the key regulatory elements involved in Cox-2 induction in ovine large luteal cells [35]. A 93% identity was found between the ovine and bovine Cox-2 gene sequences in the key 282-bp fragment, and complete identity was found in the key regulatory elements (E-box, CRE, and C/EBP) that were identified and mutated in that study. We used these different-size constructs and mutants to probe the key regulatory regions of the Cox-2 gene in bovine granulosa cells (Fig. 1). The plasmids containing Cox-2 promoter sequences or mutated promoter sequences were amplified in bacteria and column purified for transfection. Before transfection, cells were washed three times with serum-free media. Based on our previous studies to optimize transfection efficiency in bovine granulosa cells [40], 1 µg of plasmid and a fixed amount (2 µl) of the transfection reagent, SuperFect, were mixed and incubated to form a DNA-SuperFect complex according to the manufacturer's protocol. The DNA-SuperFect mixture was added directly to cells. After 2-h incubation at 39°C, the cells were washed three times with culture media and then subjected to treatments. A promoterless plasmid (pGL2B) with the same luciferase reporter gene was also transfected into all cell types to provide a baseline measurement of luciferase activity.
|
Experiment I
After transfection, the three treatment groups (fresh, luteinized, or cultured nonluteinized granulosa cells) were treated with 8-bromo-cAMP (1 mM), phorbol didecanoate (PDD; 10 nM), or cloprostenol (100 nM) or left untreated. At 4, 12, 24, 36, or 48 h after treatments, media were removed, and cells were washed once with 1x PBS and lysed with luciferase assay lysis reagent. Cell lysates were centrifuged at 16 000 x g for 5 sec, and the luciferase activity in the supernatant was examined using a commercial luciferase assay kit (Promega). Transfection efficiency was determined by a direct PCR method as previously reported [40]. Luciferase activity of the samples was normalized by transfection efficiencies and expressed as a fold-increase compared to promoterless (pGL2B) expression plasmid.
Experiment II
To further delineate the signal systems involved in Cox-2 regulation, the three types of treated granulosa cells were treated with myristoylated PKA pseudosubstrate peptide (25 µM) or PKC pseudosubstrate peptide (25 µM) before induction of Cox-2 by methods found to be effective in experiment 1. Fresh granulosa cells were treated with 8-bromo-cAMP (1 mM) 1 h after addition of the inhibitors and maintained for an additional 36 h. Luteinized granulosa cells (8 days of culture with forskolin) were treated with PDD (10 nM) or cloprostenol (100 nM) at 1 h after addition of the inhibitors and cultured an additional 12 h. Nonluteinized granulosa cells (8 days of culture without forskolin) were treated with 8-bromo-cAMP (1 mM) at 1 h after inhibitor addition and then cultured an additional 12 h.
Experiment III
To clarify essential regions of the 5' flanking sequence mediating Cox-2 transcription, expression plasmids containing various mutations or deletions of the ovine Cox-2 promoter, as previously described [34], were used in transfection of the three types of granulosa cells. In the first experiments, expression vectors with progressive deletions of the Cox-2 promoter were transfected into fresh, luteinized, or cultured nonluteinized granulosa cells and then treated as described for experiment 2 with 8-bromo-cAMP (fresh cells, 36 h; cultured nonluteinized cells, 12 h) or PDD (luteinized cells, 12 h). To further identify the crucial element(s) within the Cox-2 promoter region, 282-bp expression plasmids containing site-directed mutants of CRE, E-box, and/or C/EBP (Fig. 1) were transfected into the three cell types and challenged with 8-bromo-cAMP or PDD as described above. Two nonspecific mutations (random mutant 1 and random mutant 2) were also made in this short promoter to serve as controls.
Experiment IV
A time-course experiment was performed to analyze changes in responsiveness of the Cox-2 promoter during in vitro luteinization or culture of granulosa cells. Bovine granulosa cells were cultured with (luteinized cells) or without (nonluteinized cells) forskolin (10 µM). At Days 0, 2, 4, 6, 8, or 10 of culture, luteinized and nonluteinized cells were transfected with the full-length bovine Cox-2 promoter construct. After transfection, cells were untreated (control) or treated with 8-bromo-cAMP (1 mM) or PDD (10 nM) for either 4 or 48 h. After treatments, cells were harvested, and luciferase activity was determined as described above.
Experiment V
Electrophoretic mobility shift assay (EMSA) was used to define potential transcription factors capable of binding to the critical elements within the Cox-2 promoter region. Bovine granulosa cells were untreated or treated with 1 mM 8-bromo-cAMP for 24 h. Luteinized granulosa cells (8 days of culture with forskolin) were challenged with medium only or with 10 nM PDD for 4 h. Cultured nonluteinized granulosa cells (8 days of culture without forskolin) were cultured in the absence or presence of 8-bromo-cAMP (1 mM) for 4 h. Nuclear extracts were prepared according to the method of Schreiber et al. [41]. A double-strand oligonucleotide containing the sequence for the bovine CRE/E-box (CAGTCATGCCGTCACGTGGGCTATTT) was end-labeled with [
-32P]ATP using T4 polynucleotide kinase and purified with a MicroSpin G-50 column. The 32P-labeled probe was mixed with nuclear extracts (5 µg) in 10 mM Hepes (pH 7.9) containing 50 mM KCl, 2.5 mM MgCl2, 10% (v/v) glycerol, 0.1 µg/µl of BSA, 1 mM dithiothreitol, and 0.25 µg/µl of poly(dI-dC) and then incubated in the presence or absence of oligonucleotide competitors for 20 min at room temperature. The unlabeled competitor sequences were wild-type (same as probe), E-box mutant (CAGTCATGCCGTCAatgaGGCTATTT), CRE mutant (CAGTCATGCaagCACGTGGGCTATTT), or C/EBP oligonucleotide sequence (CCCGGGTCTTGCGCAATTGTTTAAG). For supershift assays, nuclear extracts were incubated with USF-1 or USF-2 antibodies for 10 min at room temperature before addition of the labeled oligonucleotide. The mixtures were analyzed on a 4% acrylamide gel in 22.5 mM Tris-borate containing 0.5 mM EDTA. The gel was dried and analyzed with Cyclone Storage Phosphor System (Packard Instrument Company, Meriden, CT).
Statistical Analyses
Results from experiment I were analyzed by one-way ANOVA to test the effects of treatments. The Fisher least significant difference (LSD) test was used to compare means at each time point. In experiment II, the same methods were utilized to compare means of PKA pseudosubstrate peptide, PKC pseudosubstrate peptide, or no inhibitor in the absence or presence of treatments (8-bromo-cAMP, PDD, or cloprostenol). In experiment III, luciferase activity from different deletion mutants were compared by one-way ANOVA to the full-length promoter within untreated (control), 8-bromo-cAMP-treated, or PDD-treated granulosa cells. In experiment IV, the 8-bromo-cAMP- and PDD-treated cells were compared separately within each pretreatment group (luteinized or nonluteinized), each time of treatment (4 vs. 48 h), and each day of pretreatment (Day 0, 2, 4, 6, 8, or 10) using one-way ANOVA followed by the Fisher LSD test. The luciferase activity for each group of different site-directed mutants was compared to the full-length promoter within control or 8-bromo-cAMP-treatment and PDD-treatment groups.
| RESULTS |
|---|
|
|
|---|
The granulosa cells had been pretreated in three different manners before transfection, producing groups of freshly isolated granulosa cells (Fig. 2), granulosa cells cultured for 8 days with forskolin (luteinized granulosa cells) (Fig. 3), and granulosa cells cultured for 8 days without forskolin (nonluteinized granulosa cells) (Fig. 4). In fresh granulosa cells, luciferase activity was increased (P < 0.05) by 8-bromo-cAMP at 12, 24, 36, and 48 h after treatment, with a peak increase of sevenfold induction at 48 h (Fig. 2A). However, PDD did not alter luciferase activity at any time point in fresh granulosa cells. The 8-bromo-cAMP-stimulated Cox-2 promoter activity was inhibited (P < 0.05) by the PKA (47%), but by not the PKC, pseudosubstrate peptide (Fig. 2B). Basal promoter activity was not affected by either PKA or PKC pseudosubstrate peptides.
|
|
|
In luteinized granulosa cells, luciferase activity was rapidly induced by PDD (P < 0.05) at 4 and 12 h, with a peak increase of fourfold at 12 h after treatment (Fig. 3A). Luciferase activity was also increased by cloprostenol (P < 0.05) at 12 and 24 h (Fig. 3A). Treatment with 8-bromo-cAMP did not change luciferase activity at any time point (Fig. 3A). Luciferase activity induced by PDD or cloprostenol in luteinized granulosa cells was decreased (P < 0.05) by PKC (47% and 64% reduction, respectively), but not by PKA, pseudosubstrate peptide (Fig. 3B). Moreover, neither PKA nor PKC inhibitory peptides altered basal Cox-2 promoter activity.
In the cultured nonluteinized granulosa cells, 8-bromo-cAMP, but not PDD or cloprostenol, increased (P < 0.05) luciferase activity, with a peak increase of fourfold induction (Fig. 4A). This cAMP-mediated induction was observed only at the early time points, 4 and 12 h after treatment; it was not observed at 24, 36, or 48 h after treatment. Pseudosubstrate peptide for PKA, but not for PKC, attenuated (P < 0.05) the induction of luciferase activity by 8-bromo-cAMP (50% reduction) (Fig. 4B). Basal luciferase activity was not changed by either inhibitory peptide.
Experiment III
Progressive deletion of the Cox-2 promoter from 1500 to 282 bp in size did not change basal or 8-bromo-cAMP-mediated luciferase activity in fresh bovine granulosa cells (Fig. 5). Phorbol didecanoate did not affect luciferase activity in any deletion mutants (Fig. 5). Site-directed mutagenesis was used to produce Cox-2 promoters with mutations in key regulatory elements within the 282-bp promoter construct (Fig. 1). In fresh granulosa cells, mutation of the E-box eliminated the 8-bromo-cAMP-stimulated increase in luciferase activity (P < 0.05) (Fig. 6). However, mutation in C/EBP, in CRE, or in random sites did not alter basal or cAMP-stimulated promoter activity. Combinations of various mutations were no more effective than the E-box mutation alone in eliminating the cAMP-mediated luciferase activity. Basal luciferase activity was not altered by any of the promoter mutations (Fig. 6).
|
|
In luteinized granulosa cells, the 282-bp Cox-2 promoter maintained full basal and PDD-stimulated promoter activity as compared to the full-length (1500-bp) construct (Fig. 7). The basal luciferase activity was decreased (P < 0.05; 70%) by mutation of the E-box element, but not by mutation of C/EBP or CRE. Similarly, mutation of the E-box element, but not other mutations, eliminated PDD-stimulated promoter activity (Fig. 7).
|
In the nonluteinized granulosa cells that had been cultured for 8 days without forskolin, the 282-bp Cox-2 promoter construct maintained both basal and 8-bromo-cAMP-stimulated promoter activity (Fig. 8). The basal luciferase activity was decreased (P < 0.05; 75%) by mutation of the E-box element, but not by other mutations (Fig. 8). In the presence of 8-bromo-cAMP, only the E-box mutation decreased the promoter activity to basal levels (Fig. 8). Mutations other than the E-box mutation had no significant effect on either basal or 8-bromo-cAMP-stimulated luciferase activity in the presence or absence of the E-box mutation (Fig. 8).
|
Experiment IV
As shown in Figure 9, nonluteinized granulosa cells did not show any change in luciferase activity caused by PDD treatment on any day of culture at either 4 h (Fig. 9A) or 48 h (Fig. 9B) after treatment. Fresh (Day 0) nonluteinized granulosa cells responded to 8-bromo-cAMP with an increase in luciferase activity at 48 h (Fig. 9B), but not at 4 h (Fig. 9A), after treatment. No effect of 8-bromo-cAMP was observed in nonluteinized granulosa cells on Days 2 or 4 of culture at either 4 or 48 h after treatment, but on Days 6, 8, and 10, an increase in luciferase activity caused by 8-bromo-cAMP was observed at 4 h (Fig. 9A), but not 48 h (Fig. 9B), after treatment.
|
In luteinized granulosa cells, no effect of 8-bromo-cAMP on luciferase activity was observed at either 4 h (Fig. 9C) or 48 h (data not shown) after treatment. Also, no effect of PDD was observed at 48 h after treatment on any day of culture of luteinized granulosa cells (data not shown). At 4 h, an increase (P < 0.05) in luciferase activity in response to PDD treatment of luteinized granulosa cells was observed on Days 2, 4, 6, 8, and 10 of culture (Fig. 9C). A greater response was observed on Days 4, 6, and 8 (5.0-fold) than on Day 2 (1.8-fold), with a further increase on day 10 (8.8-fold).
Experiment V
Nuclear proteins were isolated from fresh granulosa cells that were untreated or treated with 8-bromo-cAMP. Incubation of these nuclear proteins with labeled oligonucleotide corresponding to the CRE/E-box elements of the Cox-2 promoter produced at least four bands (Fig. 10, lane 2). All bands were eliminated by incubation with excess unlabeled wild-type oligonucleotide (Fig. 10, lane 3). A distinct band (labeled I in Fig. 10) was not eliminated if the oligonucleotide contained a mutation in the E-box element (Fig. 10, lane 4). Use of an unrelated oligonucleotide that contained the C/EBP element did not eliminate band I but did reduce or eliminate other bands (Fig. 10, lane 5). Incubation with the oligonucleotide that contained a mutation of the CRE element, but not of the E-box element, eliminated all bands, including band I (Fig. 10, lane 6). Incubation of the nuclear extracts with antibodies against USF-1 or USF-2 supershifted band I to a higher position (marked as band II in Fig. 10, lanes 7 and 8). The banding pattern was similar whether nuclear proteins were from untreated or 8-bromo-cAMP-treated granulosa cells (Fig. 10).
|
In luteinized granulosa cells, nuclear extracts from either control or PDD-treated cells exhibited the same banding patterns as described above for fresh granulosa cells (Fig. 11). Mutations in the E-box element, but not in other elements, eliminated band I, and antibodies against USF-1 or USF-2 supershifted band I to the band II position (Fig. 11). Although not shown, similar results were obtained in gel shift assays using nuclear proteins from granulosa cells that had been incubated for 8 days without forskolin.
|
| DISCUSSION |
|---|
|
|
|---|
The switch in regulation of the Cox-2 gene from PKA-dependence in granulosa cells to PKC-dependence in large luteal cells allows for Cox-2 to successfully fulfill a key role in both the process of ovulation and in luteolysis, respectively. The critical role of Cox-2 in the ovulation process has been most convincingly demonstrated by studies involving Cox-2 knock-out mice, in which the ovulation rate was dramatically reduced without a change in follicular development [2022]. In preparation for ovulation, the LH surge activates the PKA pathway and stimulates Cox-2 expression, but this up-regulation is delayed by approximately 18 h in bovine granulosa cells to permit elevated production of PGs close to the time of ovulation. In sheep, PGE2 is the most potent PG in promoting DNA fragmentation and apoptosis of ovarian epithelial cells, and these processes appear to be critical in ovulation [44]. Mice with knock-out of the EP2 receptor have a dramatically reduced ovulation rate, although they still deliver a reduced number of live young [5, 6].
In contrast, knock-out of the FP receptor prevents normal luteolysis and, hence, normal parturition in mice. However, other reproductive processes (follicular growth, ovulation, embryonic growth) appear to be normal in FP-receptor knock-out mice, indicating an essential role of PGF2
only in the process of luteolysis [7]. A variety of other studies during the last 20 years have demonstrated the critical role for PGF2
in the initiation of luteolysis in many species [45], and intraluteal PGF2
production may be critical for complete luteolysis [45]. Our recent research using specific PKC inhibitors demonstrated that induction of Cox-2 by PGF2
is mediated by the PKC second-messenger system and not by Map kinase, PKA, or calcium/calmodulin systems [35]. Thus, regulated production of PGs is critical for normal function of granulosa and large luteal cells, with regulation of Cox-2 being the key rate-limiting step in both cell types.
An unexpected finding in the present study was that culture of granulosa cells eliminated the delay in cAMP-stimulated Cox-2 expression but did not change the second-messenger pathway that induced Cox-2. The acute response to 8-bromo-cAMP was particularly clear on Day 8 of culture, when granulosa cells had an acute induction of a more-than-sevenfold increase in Cox-2-promoter-regulated luciferase activity, an induction similar to what was found at 48 h after 8-bromo-cAMP in fresh granulosa cells. Previous studies have shown that induction of Cox-2 in rat granulosa cells required protein synthesis [46]. Perhaps key proteins needed for Cox-2 expression were produced during the culture period and, thus, cAMP could immediately stimulate Cox-2 expression without the need for intermediate production of these critical proteins. We have been unable to find other reports of changes in the timing of Cox-2 expression after cell culture. In contrast to fresh granulosa cells, luteinized granulosa cells [42; this study] or large luteal cells [13, 35] show immediate induction of Cox-2 in response to PKC activation but no Cox-2 induction in response to PKA activation even after long treatment times. The lack of PKA response could be explained by some type of down-regulation of the PKA response system after 8 days of treatment with forskolin; however, the initiation of responsiveness to the PKC system is the most intriguing, but least easily explainable, result in this study. The rapid induction of Cox-2 is consistent with the results of many other studies in other cell types [13]. For example, in Swiss 3T3 cells, Cox-2 mRNA is increased by 30 min after treatment with forskolin, phorbol ester, or fetal calf serum, which is consistent with the concept that Cox-2 is an immediate early gene [47]. Subsequent, in-depth analysis of changes in the timing of Cox-2 expression after either luteinization or simple culture may help to uncover the critical transcriptional mechanisms involved in delaying the expression of Cox-2 and, possibly, other genes.
Progressive deletion of the Cox-2 promoter as well as mutational analysis of specific DNA elements provided information regarding the regulatory elements involved in the induction of Cox-2 in the three different differentiation states. Previous studies have found that a variety of cis-regulatory elements mediate Cox-2 induction in different cell types, including NF
B [27], C/EBP [28, 29], CRE [30, 31], IRE [26], peroxisome proliferator response element [48], and E-box [32, 33]. All the basal and stimulated activity of the 1500-bp Cox-2 promoter was maintained in the 282-bp region, ruling out many of these DNA elements in the regulation of luteinized or nonluteinized bovine granulosa cells. Surprisingly, we found that the single E-box element at -50 bp mediated all the responses that we studied in the three differentiation states of the granulosa cells. Previous studies have reported that mutation of the E-box reduced basal transcription in rat or bovine granulosa cells [32, 34], and this mutation also reduced basal transcription in cultured and luteinized, but not in fresh granulosa, cells in our experiments. Similar to previous studies with rat granulosa cells [32], we found that cAMP stimulation of Cox-2 was eliminated by mutation of the E-box. In a previous study with ovine large luteal cells [35], we found that mutation of the E-box eliminated much of the stimulation of Cox-2 expression by PKC. However, mutations in the CRE and C/EBP elements also significantly, but less dramatically, reduced PKC stimulation of Cox-2. In the present study, we found no effect of mutations in CRE or C/EBP on PKC stimulation of Cox-2, but we did find that mutation of the E-box completely eliminated PKC stimulation of Cox-2 in bovine luteinized granulosa cells. The promoter plasmids used in these two studies were identical, indicating that differences may exist in Cox-2 regulation between these two species or that in vitro luteinized granulosa cells might not completely resemble the large luteal cells produced by natural luteinization in vivo.
Using EMSA, nuclear proteins from any of the three types of treated granulosa cells were found to specifically bind to an oligonucleotide that spans the E-box sequence. This binding was competed away by incubation with an unlabeled E-box oligonucleotide, but not by incubation with a similar oligonucleotide having a mutated E-box. Supershifting from complex I to II by antibodies to either USF-1 or USF-2 indicates that both USF-1 and USF-2 are involved in the complex formation between E-box and nuclear extracts from fresh, luteinized, or cultured granulosa cells. The USF proteins belong to a family of basic-helix-loop-helix-leucine zipper transcription factors, and USF proteins have fairly ubiquitous expression in many tissues [49]. In our studies, we found no difference in E-box binding using nuclear proteins from any of the three different differentiation states of granulosa cells. Similarly, previous studies [50] using HeLa and Saos cells have found similar binding of USF proteins in the two cell types; however, USF proteins activated transcription in HeLa cells but not in Saos cells. Those authors proposed that an unidentified coactivator or corepressor was involved in determination of whether binding of USF to E-box produced transcriptional activation [50]. Our results further suggest that the putative coactivator or corepressor may also be involved in determining the second-messenger pathway involved in stimulation of expression by the USF/E-box interaction. Further studies are needed to define the unusual molecular mechanisms involved in transcriptional regulation of Cox-2 by interaction of PKA and PKC with the E-box element and USF proteins.
| FOOTNOTES |
|---|
1 Supported by USDA 2000-2276. ![]()
2 Correspondence: Milo C. Wiltbank, University of Wisconsin-Madison, 1675 Observatory Drive, Madison, WI 53706. FAX: 608 263 9412; wiltbank{at}calshp.cals.wisc.edu ![]()
Accepted: December 12, 2001.
Received: September 10, 2001.
| REFERENCES |
|---|
|
|
|---|
induces distinct physiological responses in porcine corpora lutea after acquisition of luteolytic capacity. Biol Reprod 2000; 63:1504-1512
and progesterone release in vitro by ovine luteal tissue during induced luteolysis. Adv Exp Med Biol 1979; 112:639-644[Medline]
and progesterone production by bovine luteal cells during the estrous cycle. Biol Reprod 1983; 29:1063-1068[Abstract]
, E2 and prostacyclin in isolated corpora lutea of adult pseudopregnant rats through the luteal lifespan. Prostaglandins Leukot Essent Fatty Acids 1992; 46:151-161[CrossRef][Medline]
induces expression of prostaglandin G/H synthase-2 in the ovine corpus luteum: a potential positive feedback loop during luteolysis. Biol Reprod 1997; 57:1016-1022[Abstract]
-dependent cyclooxygenase 2 expression. J Exp Med 2000; 191:2131-2144
in bovine theca and granulosa cells luteinized in vitro. Biol Reprod 1992; 46:786-792[Abstract]
and luteinizing hormone receptors in various bovine luteal cell types. Biol Reprod 1998; 58:849-856
on in vitro luteinized bovine granulosa cells. Reproduction 2001; 122:245-253[Abstract]This article has been cited by other articles:
![]() |
S. Corre, A. Primot, Y. Baron, J. Le Seyec, C. Goding, and M.-D. Galibert Target Gene Specificity of USF-1 Is Directed via p38-mediated Phosphorylation-dependent Acetylation J. Biol. Chem., July 10, 2009; 284(28): 18851 - 18862. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z Cheng, E L Sheldrick, E Marshall, D C Wathes, D R E Abayasekara, and A P F Flint Control of cyclic AMP concentration in bovine endometrial stromal cells by arachidonic acid Reproduction, May 1, 2007; 133(5): 1017 - 1026. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sayasith, K. A Brown, and J. Sirois Gonadotropin-dependent regulation of bovine pituitary adenylate cyclase-activating polypeptide in ovarian follicles prior to ovulation Reproduction, February 1, 2007; 133(2): 441 - 453. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-J. Kang, B. A. Wingerd, T. Arakawa, and W. L. Smith Cyclooxygenase-2 Gene Transcription in a Macrophage Model of Inflammation J. Immunol., December 1, 2006; 177(11): 8111 - 8122. [Abstract] [Full Text] [PDF] |
||||
![]() |
B Lohrke, T Viergutz, and B Kruger Polar phospholipids from bovine endogenously oxidized low density lipoprotein interfere with follicular thecal function J. Mol. Endocrinol., December 1, 2005; 35(3): 531 - 545. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sayasith, J. G. Lussier, and J. Sirois Role of Upstream Stimulatory Factor Phosphorylation in the Regulation of the Prostaglandin G/H Synthase-2 Promoter in Granulosa Cells J. Biol. Chem., August 12, 2005; 280(32): 28885 - 28893. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sirois, K. Sayasith, K. A. Brown, A. E. Stock, N. Bouchard, and M. Dore Cyclooxygenase-2 and its role in ovulation: a 2004 account Hum. Reprod. Update, September 1, 2004; 10(5): 373 - 385. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. J. Diaz and M. C. Wiltbank Acquisition of Luteolytic Capacity: Changes in Prostaglandin F2{alpha} Regulation of Steroid Hormone Receptors and Estradiol Biosynthesis in Pig Corpora Lutea Biol Reprod, May 1, 2004; 70(5): 1333 - 1339. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sayasith, N. Bouchard, M. Sawadogo, J. G. Lussier, and J. Sirois Molecular Characterization and Role of Bovine Upstream Stimulatory Factor 1 and 2 in the Regulation of the Prostaglandin G/H Synthase-2 Promoter in Granulosa Cells J. Biol. Chem., February 20, 2004; 279(8): 6327 - 6336. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |