Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xing, W.
Right arrow Articles by Sairam, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xing, W.
Right arrow Articles by Sairam, M. R.
Agricola
Right arrow Articles by Xing, W.
Right arrow Articles by Sairam, M. R.
Biology of Reproduction 67, 204-211 (2002)
© 2002 Society for the Study of Reproduction, Inc.


Regular Article

Retinoic Acid Mediates Transcriptional Repression of Ovine Follicle-Stimulating Hormone Receptor Gene via a Pleiotropic Nuclear Receptor Response Element1

Weirong Xinga,b, and M. Ram Sairam2,c

a Molecular Reproduction Research Laboratory, Clinical Research Institute of Montreal, Montreal, Quebec, Canada H2W 1R7 b Division of Experimental Medicine, Department of Medicine, McGill University, Montreal, Quebec, Canada H3A 1A3 c Faculty of Medicine, University of Montreal, Montreal, Quebec, Canada H3T 1J4


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The FSH receptor (FSHR) and retinoid receptors are critical regulators of gonadal function. Unlike the latter, the FSH receptors are expressed exclusively in ovarian granulosa and testicular Sertoli cells in a developmental fashion. Toward understanding the nature of various transcription factors that direct a tissue- and stage-specific expression of the FSHR gene, we have studied FP4, one of the two footprinting regions (FP3 and FP4) mapped at -241 to -269 and -284 to -303, respectively, upstream of the transcription start site of the ovine FSHR gene. Gel mobility shift assays with FP4 probe revealed two sequence-specific DNA-protein complexes in the presence of nuclear extracts from two immortal gonadal cell lines. Antibody supershift assays demonstrated that retinoic acid receptor (RAR) was involved in the complex 1 whereas steroidogenic factor-1 (SF-1) was present in the complex 2. Mutation studies revealed that DNA binding sites for RAR and SF-1 were overlapping each other within a 19-base pair length of nucleotide sequence of FP4, and a mutation in the half RAR binding site seriously affected SF-1 binding. Reporter assays showed that FP4 conferred SF-1 transactivation as well as RAR-mediated, ligand-dependent repression. Overexpression of SF-1 in a transformed Sertoli cell line partially overcame RAR-mediated suppression. For the first time, our studies reveal a direct retinoid modulation of the gonadotropin receptor promoter and suggest a mechanism by which activators and repressors compete for composite elements providing antagonistic pathways that could modulate the expression of FSHR.

follicle-stimulating hormone receptor, gene regulation, granulosa cells, Sertoli cells, steroid hormone receptors


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Follicle-stimulating hormone (FSH) is a pituitary glycoprotein that binds to its receptor on ovarian granulosa or testicular Sertoli cells, activating G-proteins and other signaling cascades of events leading to biological action [1]. In males, FSH stimulates proliferation of Sertoli cells during fetal and early postnatal life, inducing the first spermatogenetic wave, and maintains normal sperm production [2, 3]. In females, FSH signaling is required to stimulate ovarian follicle development, granulosa cell function, oocyte maturation, and estrogen biosynthesis [46]. Recent studies using FSHß subunit or FSH receptor (FSHR) knockout models have reinforced their critical roles in mammalian reproduction [69] as well as in the control of obesity [5], bone remodeling [5], and tumorigenesis [4, 10, 11].

Regulation of FSHR expression appears to be tissue- and stage-specific in both genders. During spermatogenesis, FSHR is expressed at higher levels in the somatic Sertoli cells of stage XIII-I in comparison with stage VI of the seminiferous epithelial cycle [12]. Similarly, FSHR is expressed at the highest level in mature follicles before ovulation and at a lower level in early preantral follicles with one to two cell layers during the folliculogenesis [13, 14]. The developmental expression pattern of this gene is particularly interesting because it could be used as a model to study the molecular mechanisms by which transcription is tightly modulated in response to various physiological stimuli. Understanding the elements that contribute to selective expression patterns of this gene might also be helpful in gene-targeting strategies. Inspection of the promoter regions of FSHR in four species of human, mouse, rat, and sheep have shown that they contain multiple TGACC motifs to which many members of the nuclear receptor super family can potentially bind [1519]. Several previous studies have shown that peptide hormones and growth factors such as insulin-like growth factor, inhibin, activins, follistatin, and transforming growth factor-ß could stimulate FSHR expression in cultured granulosa cells [17, 2022]. Some reports also indicate that retinoic acid (RA) or the environmental pollutant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) inhibit basal as well as 8-Br-cAMP-induced transcription of the endogenous FSHR gene [2325]. These studies suggest that the FSHR gene may be regulated by transcription factors that are activated through pathways involving growth signals or steroid hormones (nuclear receptors). However, the issues related to tissue- and stage-specific expression of genes appear to be more complex and dependent on the interplay of positive and negative regulators simultaneously binding to the promoter as well as chromatin remodeling by these transcription factors [2630]. Although previous studies have demonstrated that many elements such as steroidogenic factor-1 (SF-1), upstream stimulatory factor (USF), c-Fos/c-Jun, Krupple-like transcription factors, E2F, and GATA-1 are involved in the regulation of FSHR expression as activators [3135], little detailed information is available so far on the factors that lead to inhibition of the FSHR gene during various physiological situations. In addition, the location and interplay of regulatory elements for nuclear receptors such as retinoic acid receptor (RAR) and peroxisome proliferator-activated receptor (PPAR) in the promoter regions of this gene have not yet been identified.

In our previous studies, we have used ovine FSHR (oFSHR) promoter and two immortal gonadal cell lines as a model system and have characterized three regulatory elements within the strongest promoter region, from -200 to +163 relative to the transcription start site [31, 32, 35]. A series of biochemical studies have demonstrated that E-box, CACC-box, and a composite regulatory element-3 (RE-3) were required for the core promoter activity [31, 35]. However, promoter deletion studies found that maintenance of a 105-base pair (bp) region from -305 to -200 beyond the 5' end of the strongest promoter located at -200 to +163 of the oFSHR gene greatly attenuated promoter activity in transiently transfected granulosa cell line, suggesting the possible presence of a negative element(s) [31]. To identify these cis elements, we performed DNase I footprinting assays and identified two more footprinting sites (FP3 and FP4) in the region from -200 to -305 of oFSHR [31]. One of them (FP4) has been characterized as a composite nuclear receptor response element to which two functionally distinct nuclear receptors of RAR and SF-1 bind, providing an environment for competitive interactions. This might modulate FSHR transcription, with net activity being determined by the relative intranuclear concentrations of the receptors and, where present, their ligands or cofactors. Because the hormone FSH apparently controls RAR translocation and transcriptional action in the testis [36], our findings reported here highlight the close interactions and inverse relationship of these two receptor systems to maintain developmental/stage-dependent expression.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasmids, Cell Lines, and Antibodies

Plasmid pGL3-basic (Promega, Madison, WI) and oFSHR promoter/luciferase constructs were described previously [31, 32]. SF-1 expression vector (pCMV5SF-1) was a generous gift from Dr. Keith L. Parker (The University of Texas, Southwestern Medical Center, Dallas, TX). A mouse Sertoli cell line (15P1) provided by Dr. Francois Cuzin (University of Nice, Nice Cedex 2, France) [37] and a porcine ovarian granulosa cell line (JC-410) established by Dr. Jorge P Chedrese (University of Saskatchewan, Saskatoon, SK, Canada) [38] were used in the current work. Both cell lines have been previously utilized to study signal transduction mechanisms. SF-1 antibody directed against its DNA binding domain was purchased from Upstate Biotechnology (Lake Placid, NY). Estrogen receptor {alpha} (ER{alpha}) antibody was a generous gift from Dr. Geoffrey L. Greene (University of Chicago, Chicago, IL) and Dr. Pierre Chambon (IGBMC, Illkirch, France). The ERß antibody was supplied by Dr. P.T.K. Saunders (Medical Research Council, Edinburgh, U.K.). The estrogen-related receptor {alpha} (ERR{alpha}) was provided by Dr. V. Giguere (McGill University, Montreal, PQ, Canada). The RAR ({alpha}, ß, {gamma}), COUP-TFI, RXR{alpha} (SC-774 that also reacts with the ß and {gamma} isotypes) antibodies and control IgG were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

Cell Culture and Transient Transfections

Cell culture and transient transfections were carried out as described previously [31, 39]. The cells (5 x 106) were resuspended in 500 µl of serum- and antibiotics-free F-12/DMEM medium containing 5 µg of luciferase reporter and 0.5 µg of pCMVlacZ in the presence or absence of 2.5 µg of pCMV5SF-1. After 10 min of incubation at room temperature, the cells were electroporated in a 0.4-cm gap-width electroporation cuvette with 960 µF at 220 V using a Gene Pulser (Bio-Rad, Hercules, CA). The cells were incubated at 37°C for 10 min and then cultured on 60-mm Petri dishes. After 48 h of incubation, cells were lysed for use in both luciferase and ß-galactosidase assays. The relative luciferase activity was normalized to ß-galactosidase activity and expressed as fold induction or reduction compared with the activity of the proper control vector. The data shown are means ± SD from 3 independent experiments. ANOVA or the Student t-test was used for statistical analyses [31].

Preparation of Nuclear Extract

Nuclear extract preparation and electrophoretic mobility shift assays (EMSAs) were performed as described previously [31]. Both 15P1 and JC-410 cells were lysed on ice for 5 min in buffer E (0.3% NP-40, 10 mM Tris-HCl [pH 8.0], 60 mM NaCl, 1 mM EDTA, 1 mM DTT, 1 mM phenylmethylsulfonylfluoride [PMSF], 5 µg/ml leupeptin, 1 µg/ml pepstatin A, and 4 µg/ml aprotinin). Nuclei were pelleted by spinning for 5 min at 2500 rpm at 4°C. The pellet was washed in buffer E lacking NP-40 and resuspended in buffer C (20 mM HEPES, pH 7.9, 0.75 mM spermidine, 0.15 mM spermine, 0.2 mM EDTA, 2 mM EGTA, 2 mM DTT, 20% glycerol, 1 mM PMSF, 5 µg/ml leupeptin, 1 µg/ml pepstatin A and 4 µg/ml aprotinin). NaCl was added to a final concentration of 0.4 M, and the nuclei were gently shaken for 20 min at 4°C, then spun for 10 min at 12 000 rpm at 4°C. Nuclear proteins were stored at -80°C.

Electrophoretic Mobility Shift Assay

All oligonucleotides were commercially synthesized by BioCorp, Inc. (Montreal, PQ, Canada). The EMSA was carried out as described previously [31]. Briefly, double strand DNA was labeled at the 5' ends using T4 polynucleotide kinase and [{gamma}-32P]ATP. Nuclear extract (10 µg) from either 15P1 or JC-410 cells was incubated in a binding buffer [31] containing 50 µg/ml poly dI-dC and 20 fmole of labeled DNA probe. After addition of radiolabeled probe, the mixture was incubated at room temperature for another 20 min. For antibody supershift assay, the reaction was incubated at room temperature for an additional 15 min after adding 1 µg of antibody. Excess unlabeled DNA competitors were added 5 min before adding the radiolabeled DNA probe. Gels were dried and then visualized by autoradiography.

Site-Directed Mutagenesis

Site-directed mutagenesis was performed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). In brief, the P519 construct containing a wild-type FSHR promoter fused to a luciferase gene was used as a template [31]. A pair of synthetic oligonucleotides with a directed mutation was extended by means of Pfu turbo DNA polymerase. The extension product was treated with 10 units of Dpn I endonuclease at 37°C for 1 h to digest the parental double strand DNA templates. The nicked vector DNA incorporating a mutation was then transformed into Escherichia coli XL1-Blue Supercompetent Cells. Individual clones were isolated, and the purified DNA was sequenced to confirm which clones had the correct mutational changes.

Western Blot Analysis

An aliquot (30 µg) of nuclear extracts from 15P1 and JC-410 cells were separated on a 7.5% SDS-PAGE denaturing gel. Proteins were then transferred to nitrocellulose, and the membrane was incubated at 4°C overnight in a buffer containing 5% dry skim milk, 150 mM NaCl, 50 mM Tris-HCl (pH 8.0) and 0.05% Tween-20. The immunoblotting was performed in the same buffer containing 0.4 µg/ml rabbit polyclonal RXR{alpha} antibody at room temperature for 1 h. Specific proteins were detected using a ECL+Plus Western blotting detection system (Amersham Pharmacia Biotech U.K. Limited, Buckinghamshire, U.K.) as described previously [5].

DNase I Footprinting

Noncoding strand probe was prepared by cutting the plasmid P519 with Bgl II for 5'-end labeling by T4 polynucleotide kinase [31]. The probe released from the plasmid by digesting with HindIII was purified by 1% agarose gel electrophoresis. DNase I footprinting reactions were carried out as described previously [31]. Binding reactions were incubated at temperature for 15 min, followed by 5 min of DNase I digestion on ice. The footprint reactions were terminated by the addition of 80 µl of a stop buffer [31]. The samples were incubated at 45°C for 1 h, purified, and loaded on a 7% sequencing gel along with A, C, G, and T DNA sequence tracks, followed by autoradiography.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Nuclear Proteins Bind to the oFSHR Promoter

Previous promoter deletion studies had suggested the possible existence of inhibitory elements in a region from -200 to -305 [31]. To further identify regulatory elements, we performed DNase I footprinting assays using the previously reported P519 plasmid as a template [31]. Two cis elements from -142 to -309 relative to transcription start site of oFSHR promoter were recognized by nuclear proteins isolated from the pig granulosa cell line (JC-410) and were protected from DNase I digestion (Fig. 1). Footprinting 3 (FP3) was localized from -241 to -269, and footprinting 4 (FP4) was mapped at -284 to -303 upstream of the transcription start site (the first translation codon starts at +163 downstream of the transcription start site in this species). Two sites hypersensitive to DNase I digestion can also be seen at -185 and -238 (Fig. 1).



View larger version (51K):
[in this window]
[in a new window]
 
FIG. 1. Nuclear proteins bind to oFSHR promoter. A 519-bp promoter was labeled at the 5' end and then subjected to DNase I footprinting assay in the presence or absence of nuclear extract from JC-410 cells. Brackets indicate the regions of protection from DNase I digestion, and the arrowheads indicate DNase I hypersensitive sites. The protected sequences against DNase I digestion in the presence of nuclear extract are given on the left side of the DNA sequence tracks. Lanes 1–4: DNA sequence tracks; lane 5: DNase I digestion without nuclear extract (-NE); lane 6: DNase I digestion with 20 µg of nuclear extract from JC-410 cells (+NE)

To test sequence-specific binding of nuclear proteins to the FP3 and FP4 regions, we synthesized oligonucleotides that encompass these footprinting sequences (Fig. 1). Using an FP3 double stranded DNA probe, our EMSAs detected 2 retarded protein-DNA complexes in the presence of nuclear extract from JC-410 cells (data now shown). One of them appeared to be sequence specific, as it was competed by the unlabeled FP3 probe in a concentration-dependent manner but remained unchanged in the presence of a retinoic acid response element (RARE) even at high concentration of 200-fold molar excess (data not shown). The slow-migrating band was not specific since it could not be competed by either unlabeled FP3 or unlabeled RARE (data not shown). Similarly, we also incubated a 32P-labeled FP4 probe with nuclear extracts from two gonadal cell lines, the JC-410 and 15P1 (Fig. 2). Two retarded DNA-protein complexes were formed in the presence of nuclear protein from JC-410 cells (Fig. 2). However, a single complex was present in the presence of nuclear extract from the 15P1 cells, suggesting that the protein involved in complex 2 is not expressed in this cell line (Fig. 2). Competition experiments revealed that the slower migrating complex 1 was displaced by unlabeled FP4, RARE, and estrogen response element (ERE), partially competed by SF-1 response element (SFRE), but not affected in the presence of a 100-fold molar excess of activator protein-1 regulatory element (Ap-1) (Fig. 2). The retarded complex 2 was only competed by unlabeled FP4 and SFRE, but remained in the presence of unlabeled RARE, ERE, and Ap-1 competitors (Fig. 2).



View larger version (69K):
[in this window]
[in a new window]
 
FIG. 2. Nuclear proteins bind to FP4 oligonucleotides. An EMSA was conducted using nuclear extract (10 µg) either from JC-410 or 15P1 cells with a 32P-labeled FP4 probe. Lane 1: probe control without nuclear extract; lane 2: probe with nuclear extract from JC-410 cells; lanes 3–7: probe with nuclear extract from JC-410 cells, the reaction containing 100-fold molar excess of unlabeled FP4, SFRE, RARE, ERE, and Ap-1, respectively; lane 8: probe with nuclear extract from 15P1 cells; lanes 9–13: probe with nuclear extract from 15P1 cells, the reaction containing 100-fold molar excess of unlabeled FP4, SFRE, RARE, ERE, and Ap-1, respectively

SF-1 and RARs Bind to FP4 of oFSHR Promoter

To identify DNA binding proteins, we incubated the DNA probe with nuclear extract from JC-410 cells in the presence of antibodies specific to SF-1, COUP-TFI, ER{alpha}, ERß, ERR{alpha}, RAR{alpha}, RARß, RAR{gamma}, or RXR (Fig. 3A). It may be noted that, as the RXR{alpha} antibody also reacts with RXRß, RXR{gamma}, we have designated this as RXR antibody. Among these, the antibody against RAR{gamma} specifically supershifted DNA-protein complex 1 whereas anti-RARß and anti-RXR antibodies only slightly reduced the intensity of complex 1 (Fig. 3A). All other antibodies specific to SF-1, COUP-TFI, ER{alpha}, ERß, ERR{alpha}1, RAR{alpha}, or control rabbit IgG did not affect DNA-protein complex 1 (Fig. 3A). However, DNA-complex 2 disappeared in the presence of anti-SF-1 antibody that is directed against the DNA binding domain but remained with anti-COUP-TFI, anti-ER{alpha}, anti-ERß, anti-ERR{alpha}, anti-RAR{alpha}, anti-RARß, anti-RAR{gamma}, anti-RXR, or rabbit IgG (Fig. 3A). Similarly, we were able to show that anti-RAR{gamma} antibody specifically recognized protein-FP4 complex 1 whereas anti-RXR interfered with the formation of the same complex in the presence of nuclear extract from the 15P1 cells. However, other antibodies failed to supershift the complex 1 (Fig. 3B).



View larger version (46K):
[in this window]
[in a new window]
 
FIG. 3. SF-1 and RAR bind to FP4 oligonucleotides. A) An antibody supershift assay was performed using nuclear extract from JC-410 cells. Lane 1: probe and nuclear extract in the absence of antibody; lanes 2–11: probe with nuclear extract, the reaction containing anti-SF-1, anti-COUP-TFI, anti-ER{alpha}, anti-ERß, anti-ERR{alpha}, anti-RAR{alpha}, anti-RARß, anti-RAR{gamma}, anti-RXR, and control rabbit IgG, respectively. The probe sequence and putative cis elements are given below. B) RAR binds to FP4 oligonucleotides. An antibody supershift assay was performed using nuclear extract from 15P1 cells. Lane 1: probe and nuclear extract in the absence of antibody; lanes 2–6: probe with nuclear extract, the reaction containing anti-RAR{alpha}, anti-RARß, anti-RAR{gamma}, control rabbit IgG, and anti-RXR, respectively. C) RXR is expressed in 15P1 and JC-410 cells. A Western blot was performed to detect the expression of RXR in two gonadal cell lines. Lane 1: nuclear extract from 15P1 cells; lane 2: nuclear extract from JC-410 cells

Antibodies against RAR{gamma} and RXR recognized the corresponding nuclear proteins expressed in granulosa cells of immature follicles and Sertoli cells of testicular tubules in mice, whereas control rabbit IgG did not show any positive-staining cells (data not shown). Because we had not observed a significant effect of the RXR antibody in the EMSAs (see Fig. 3, A and B), a Western blot was performed with nuclear extracts from both gonadal cell lines used in the current study. This demonstrated the presence of a distinct positive band corresponding to the predicted size of the RXR protein (Fig. 3C). However, because of the cross reactivity of the antibody, we could not identify the {alpha}, ß, {gamma} forms of RXR.

RA Mediates Transcription Repression via a Composite FP4 of oFSHR Promoter

To understand contributions of FP4 to the promoter activity of oFSHR, we mutated the central 2 bp or 4 bp within the FP4 regulatory element and used mutated FP4m1 or FP4m2 probe (FP1mt) to test the nuclear protein binding. Our gel competition experiments found that unlabeled FP4m1 probe was able to partially interfere with the formation of DNA-protein complex 2 (Fig. 4, lanes 2 and 3) but failed to replace DNA-protein complex 1 (Fig. 4, lanes 1 and 3). However, the 4-bp mutation of FP4m2 probe completely failed to compete for RARs and SF-1 binding to the wild-type probe (Fig. 4). A control experiment was performed showing that Ap-1 did not affect protein-DNA interactions (Fig. 4, lane 5). In addition, 32P-labeled FP4m2 probe was not retarded by any nuclear proteins (Fig. 4, lane 7), suggesting that extra flanking sequences upstream and downstream of FP4, which were designed for site-directed mutagenesis, did not affect the competition results. As SFREs and RARE share common TGACCT motifs, the mutation of a half-RARE also diminished SF-1 binding (Figs. 2 and 4). To assess the contribution of the FP4 sequence to the promoter's function, we also incorporated the same mutation as FP4m2 into oFSHR promoter/luciferase reporter P519 to make a mutant construct P519m1 (Fig. 5) [31]. In addition, we have recently demonstrated that regulatory element 3 (RE-3) located at -171 to -197 of the strongest promoter also contains an SF-1 binding site embedded in a composite cis element and have performed functional studies [35]. In view of this, we made a block replacement by incorporating a mutant RE-3 sequence into P519 (P519m2) to abolish all proteins from binding to the RE-3 [35]. Furthermore, a double mutation (P519m3) containing a mutant RE-3 and a mutant FP4 was also constructed by replacing FP4 of P519m2 with a FP4m2 sequence (Fig. 5). We cotransfected wild-type (P519) or mutant reporters into 15P1 cells with or without SF-1 expression vector to analyze the promoter activities (Fig. 5). In agreement with the protein binding assays shown in Figure 2, wild-type promoter activity in the cells with overexpressed SF-1 was augmented nearly threefold compared with the luciferase activity in the cells without SF-1 (Fig. 5). Mutation of FP4 to abolish nuclear factor(s) binding increased the basal promoter activity by approximately 50% (P < 0.05) in the absence of RA (Fig. 5) and more than 200% in the presence of RA (Fig. 6; compare bar 2 with bar 6), indicating that RARs function as negative regulators under our cell culture conditions. However, the promoter of P519m1 was still responsive to SF-1 overexpression in 15P1 cells, as the reporter gene activity was significantly elevated compared with its basal level (Fig. 5). Consistent with the results from previous studies [35], RE-3 mutation in the 519-bp length of the promoter (P519m2) dramatically diminished its activity, by approximately 66% (Fig. 5). Similarly, the promoter with a single mutation (leaving FP4 intact) was stimulated by SF-1 overexpression by 100% (Fig. 5). Double mutations of RE-3 and FP4 (P519m2) reduced the basal promoter activity and completely abolished SF-1 activation (Fig. 5).



View larger version (59K):
[in this window]
[in a new window]
 
FIG. 4. Mutation of FP4 probe abolishes nuclear protein binding. EMSA was conducted as described in Figure 2. Lane 1: FP4 probe with nuclear extract only; lanes 2–5: FP4 probe with nuclear extract, the reaction containing 100-fold molar excess of unlabeled FP4, mutant FP4m1, FP4m2, and Ap-1, respectively; lanes 6 and 7: FP4m2 probe in the absence and presence of nuclear extract, respectively. The sequences of oligonucleotides are given at the bottom



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 5. Both FP4 and RE-3 in oFSHR promoter contribute SF-1 transactivation. The 15P1 cells were transfected with a reporter in the presence or absence of pCMV5SF-1 as illustrated. Luciferase and ß-galactosidase assays were carried out 48 h after transfection. The relative luciferase activity was expressed in relation to the activity of plasmid P519 in the absence of pCMV5SF-1. An asterisk indicates statistical significance (P < 0.05, compared with the same reporter in the absence of pCMV5SF-1)



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 6. RA mediates transcriptional repression of oFSHR gene via FP4 composite element. The 15P1 cells were transfected with a reporter in the presence or absence of pCMV5SF-1 as illustrated in the figure. Luciferase and ß-galactosidase assays were carried out 18 h after treatment with all-trans RA (1 µM). The relative luciferase activity expressed in relation to the activity of plasmid P519 in the absence of pCMV5SF-1 without RA treatment (bar 1). An asterisk indicates statistical significance (P < 0.05, compared with the same without RA treatment)

We also transfected the promoter/reporters containing the wild-type FP4 sequence (P519) or mutant FP4 (P519m1) into 15P1 cells in the presence or absence of the SF-1 expression vector (pCMV5SF1) to analyze the luciferase activities following all-trans RA stimulation (1 µM) (Fig. 6). Under these conditions, the promoter activity of oFSHR (P519) was inhibited by approximately 58% after adding all-trans RA in the cell culture system (Fig. 6, bars 1 and 2). This ligand-dependent repression could be abolished by FP4 mutation (Fig. 6, bars 5 and 6). However, overexpression of SF-1 in 15P1 cells greatly increased the basal luciferase activity, nearly threefold, and attenuated the effect of RA. Under these conditions, the RA-mediated repression was only 27% (58% vs. 27%; P < 0.05) (Fig. 6), indicating that SF-1 partially antagonized RARs repression by competing for the same binding sites (Fig. 4).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The FSHR gene, exclusively expressed in ovarian granulosa cells and testicular Sertoli cells and required for gonadal development and function, appears to be regulated by autocrine and/or paracrine action of steroid and peptide hormones as well as growth factors [24]. It is generally believed that the DNA consensus sequences located in the promoter regions of genes regulate transcription upon binding sequence-specific transcription factors. Analyzing the FSHR gene promoter might help us understand the factors responsible for cell-specific expression. In the present investigation, we extended our previous findings and mapped two additional protein-binding sites, located at -241 to -269 and -284 to -303, of oFSHR promoter (Fig. 1). The EMSAs with nuclear proteins from gonadal cell lines and 32P-labeled oligonucleotides demonstrated that these protein-DNA interactions were sequence specific (Fig. 2 and data not shown). The FP3 is considered as a potential cis-acting site, and its function needs to be defined. The FP4 investigated in this study was characterized as a RARE that is composed of two AGGTCA-like motifs arranged as a direct or inverted repeat with 1-bp spacing and is preferentially recognized by RARs (Fig. 3, A and B). Our demonstration of the expression of these nuclear receptors in the ovary and testis as well as in the two cell lines (Fig. 3C and data not shown) and the reported synthesis of their ligand(s) in immature granulosa cells [40] suggests that the likelihood of mutual regulation (FSHR and retinoid receptors) is quite high. Transient transfection studies indicated that the FP4 mediated a RA-dependent repression (Fig. 6, bars 1 and 2), and a complete mutation of this element abolished the RA response but slightly increased basal promoter activity (Fig. 6, bars 1, 2, 5, and 6). These results, considered together with the earlier observation that expression of endogenous FSHR protein was inhibited by RA treatment in primary granulosa cells from rat and pig, suggest that RA and its receptors are directly involved in the suppression of FSHR expression [23, 41].

RAR belongs to a steroid receptor superfamily that consists of three receptor isotypes {alpha}, ß, {gamma} and normally form a heterodimer with RXR ({alpha}, ß, {gamma}) in the presence of RA ligand to bind to RARE present in target gene promoters. While RAR{alpha} is ubiquitously expressed in adult tissues, RARß and RAR{gamma} expression is much more restricted, suggesting a mechanism by which tissue-specific expression of retinoid target genes may be achieved through expression of different RARs [42, 43]. Our observation that RA represses FSHR expression strongly supports the conclusion that retinoid signals may indeed be involved in the stage-specific regulation of FSHR gene expression. The stage specificity of RAR isotypes expression during testicular development [44] and folliculogenesis in which the granulosa cells in the primary follicle express higher level of RARs than in the fully developed and mature follicle [43] also suggest their potential role for modulating target gene expression. The predominant expression of RAR{gamma} in our cell lines may be cell-line dependent, reflecting the particular stage at which the cell was immortalized. Thus, the involvement of other retinoid receptors cannot be excluded until more gonadal cell lines (or primary cultures at different stages of development from other species) are examined.

One of the interesting features of the FP4 that bears nuclear receptor target elements is that it overlaps two SFREs within a 19-bp promoter region, which the orphan receptor SF-1 has been shown to recognize (Fig. 3A). Mutation studies revealed that the DNA binding sites for RAR and SF-1 shared at least one AGGTCA motif because a mutation of a half RARE affected both RAR and SF-1 binding (Fig. 4, lane 3). Biochemical studies indicated that SF-1 functioned as a positive regulator and both elements of RE-3 and FP4 in the proximal promoter were required for the SF-1 transactivation (Figs. 5 and 6). Our data suggests that both distal and proximal SF-1 binding sites in the oFSHR promoter are able to confer SF-1 stimulation and possibly are necessary for optimal promoter activity in response to hormonal or metabolic stimulation [43, 45, 46]. Overexpression of SF-1 in the 15P1 cells that lack this factor could partially overcome RA-mediated suppression (Fig. 6). Thus, the conclusion that competitive binding to composite elements by nuclear receptors could be one of the molecular mechanisms controlling the expression of the RA-targeted FSHR gene, allowing cross talk between different hormonal and regulatory pathways, appears justified. Such a mutually exclusive binding of two distinct nuclear receptors to the promoter could recruit their corresponding coactivators or corepressors to further modulate the receptor-mediated transcription. However, other inhibitory mechanisms such as direct silencing, quenching, or titrating out a hormonal partner or coactivator cannot be excluded. Along with the observations of SF-1 tissue specificity and expression patterns increasing with follicular maturation and decreasing after ovulation [4750], our data also imply that different levels and activity status of SF-1 at varying stages of gonadal development might contribute to controlling the stage- and tissue-specific expression of the FSHR gene. In fact, based on results from this and previous studies, we can visualize a model for the mechanisms by which the cellular levels of RARs and SF-1 determine the overall expression of the oFSHR gene in an inverse concentration-dependent manner in response to various physiological stimuli. Upon growth stimulation, active SF-1 binds to the half sites of RARE with a higher affinity and recruits coactivators such as SRC (steroid receptor coactivator) and CBP (cAMP response element binding protein) to activate transcription. In the presence of RARs and its ligand, however, RARs readily displace SF-1, bind to its site, and recruit their corepressors such as N-CoR (nuclear receptor corepressor) and SMRT (silencing mediator of retinoic acid and thyroid hormone receptor) to repress transcription. It is predicted that this kind of receptor-promoter interaction would remodel the chromatin structure, further modulating transcription in vivo.

As discussed previously, direct characterization of the oFSHR promoter in primary granulosa and Sertoli cells from the same species would be ideal but is currently difficult because they require a large amount of primary cells that are homogeneous from the same stage of the follicular development or seminiferous epithelial cycle [31]. However, the use of two gonadal cell lines from other species has provided us a feasible alternative because of the conservation and similarity of the expression patterns of transcription factors and regulatory elements of the promoters among the species [16, 32, 34]. Evidence supporting this was demonstrated by earlier studies in which several features like E-box, initiator region, CACC-box, multiple SF-1 and AP-1 binding sites have been shown to be well conserved in the corresponding promoter regions of rat, mouse, human, and ovine FSHR genes [31, 32, 34, 35]. Unlike the SFREs characterized in the mouse and rat FSHR promoters [34, 51], we have, for the first time, identified an SFRE embedding in a pleiotropic hormone response element of the ovine FSHR promoter. Similar steroid hormone response elements could be found in the promoters of human, rat, and mouse FSHR genes [18, 19, 52]. For example, there is an inverted repeat with 2-bp spacing (TGGGTCACATGACCCT) from -111 to -128 relative to the first nucleotide of the translation initiation codon of human FSHR promoter [18]. Similarly, multiple repeats with 0–3-bp spacing (ATGACTGGTGACTGTGACCAG) from -677 to -699 of mouse FSHR promoter and an inverted repeat with 6-bp spacing (GAGGTCACACAAGTGACTTG) in a region from -646 to -664 of rat FSHR promoter seem notable [19, 52]. These cis elements also contain putative AGGTCA motifs to which SF-1 can potentially bind. These data further suggest that the conserved nuclear receptor response elements including RARE and SFRE might play an important role in the regulation of FSHR expression and raise a possibility that the chromatin architecture of the FSHR gene could be remodeled by nuclear receptors [43, 53, 54].

The composite FP4 element mediates basal as well as hormone-dependent repression (Fig. 6). A complete mutation of FP4 resulted in an approximately 50% increase in the promoter activity (Fig. 6, bars 1 and 5). However, previous deletion studies had shown that removal of -305 to -200 of the construct P468 (-305 to +163) increased in the promoter activity by 200% [31]. Such a great difference between the FP4 mutation and promoter deletion studies could be attributable to the FP3, another cis element mapped upstream of the FP4 in our DNase I footprinting assays (Fig. 1). Further characterization of this regulatory element will be a part of our future work.

In summary, we have identified a complex regulatory element of FP4 within the oFSHR promoter, which is recognized by SF-1 and RARs and confers transcriptional activation or repression. Such an element enables modulation of FSHR gene transcription perhaps in response to a variety of metabolic and physiological signals and in a pattern that is predicted to vary in different stages of gonadal development as a function of nuclear receptor expression and activation. However, further studies need to be carried out in primary cell culture from the ovine as well as in transgenic animal models.


    ACKNOWLEDGMENTS
 
We are grateful to Dr. P.J. Chedrese (University of Saskatchewan, Saskatoon) and Dr. F. Cuzin (University of Nice, France) for providing the cell lines used in this study. We also thank Dr. Keith L. Parker (University of Texas, Dallas), Dr. Geoffrey L. Greene (University of Chicago), Dr. Pierre Chambon (University Louis Pasteur, France), Dr. P.T.K. Saunders (Medical Research Council, Edinburgh, U.K.), and Dr. V. Giguere (McGill University, Montreal, PQ, Canada) for generously providing either SF-1 expression vectors or antibodies tested in this study. We also wish to acknowledge the help of Dr. Natalia Danilovich in immunohistochemical investigations.


    FOOTNOTES
 
First decision: 19 December 2001.

1 This investigation was supported by grants from the Canadian Institutes of Health Research (CIHR). W.X. holds a doctoral fellowship award of the CIHR. Back

2 Correspondence: M. Ram Sairam, Molecular Reproduction Research Laboratory, Clinical Research Institute of Montreal, 110 Pine Avenue West, Montreal, PQ, Canada H2W 1R7. FAX: 514 987 5585; sairamm{at}ircm.qc.ca Back

Accepted: February 1, 2002.

Received: November 28, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Simoni M, Gromoll J, Nieschlag E. The follicle stimulating hormone receptor. Biochemistry, molecular biology, physiology and pathophysiology. Endocr Rev 1997; 18:739-773[Abstract/Free Full Text]
  2. Krishnamurthy H, Danilovich N, Morales C, Sairam MR. Qualitative and quantitative decline in spermatogenesis follicle stimulating hormone receptor knock-out (FORKO) mouse. Biol Reprod 2000; 62::1146-1159[Abstract/Free Full Text]
  3. Weinbauer GF, Nieschlag E. Hormonal regulation of spermatogenesis. In: De Kretser D (ed.), Molecular Biology of the Male Reproductive System. New York: Academic Press; 1993: 99–142
  4. Danilovich N, Roy I, Sairam MR. Ovarian pathology and high incidence of sex cord tumors in follitropin receptor knockout (FORKO) mice. Endocrinology 2001; 142:3673-3684[Abstract/Free Full Text]
  5. Danilovich N, Babu PS, Xing W, Gerdes M, Krishnamurthy H, Sairam MR. Estrogen deficiency, obesity, and skeletal abnormalities in follicle- stimulating hormone receptor knockout (FORKO) female mice. Endocrinology 2000; 141:4295-4308[Abstract/Free Full Text]
  6. Dierich A, Sairam MR, Monaco L, Fimia GM, Gansmuller A, LeMeur M, Sassone-Corsi P. Impairing follicle-stimulating hormone (FSH) signaling in vivo. Targeted disruption of the FSH receptor leads to aberrant gametogenesis and hormonal imbalance. Proc Natl Acad Sci U S A 1998; 95:13612-13617[Abstract/Free Full Text]
  7. Kumar TR, Wang Y, Lu N, Matzuk MM. Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nat Genet 1997; 15:201-204[CrossRef][Medline]
  8. Abel MH, Wootton AN, Wilkins V, Huhtaniemi I, Knight PG, Charlton HM. The effect of a null mutation in the follicle-stimulating hormone receptor gene on mouse reproduction. Endocrinology 2000; 141::1795-1803[Abstract/Free Full Text]
  9. Kumar TR, Low MJ, Matzuk MM. Genetic rescue of follicle-stimulating hormone ß-deficient mice. Endocrinology 1998; 139:3289-3295[Abstract/Free Full Text]
  10. Kotlar TJ, Young RH, Albanese C, Crowley WF Jr, Scully RE, Jameson JL. A mutation in the follicle-stimulating hormone receptor occurs frequently in human ovarian sex cord tumors. J Clin Endocrinol Metab 1997; 82:1020-1026[Abstract/Free Full Text]
  11. Kumar TR, Palapattu G, Wang P, Woodruff TK, Boime I, Byrne MC, Matzuk MM. Transgenic models to study gonadotropin function: the role of follicle-stimulating hormone in gonadal growth and tumorigenesis. Mol Endocrinol 1999; 13:851-865[Abstract/Free Full Text]
  12. Rannikko A, Penttila TL, Zhang FP, Toppari J, Parvinen M, Huhtaniemi I. Stage-specific expression of the FSH receptor gene in the prepubertal and adult rat seminiferous epithelium. J Endocrinol 1996; 151:29-35[Abstract/Free Full Text]
  13. Tisdall DJ, Watanabe K, Hudson NL, Smith P, McNatty KP. FSH receptor gene expression during ovarian follicle development in sheep. J Endocrinol 1995; 15:273-281
  14. O'Shaughnessy PJ, Dudley K, Rajapaksha WR. Expression of follicle stimulating hormone-receptor mRNA during gonadal development. Mol Cell Endocrinol 1996; 125:169-175[CrossRef][Medline]
  15. Goetz TL, Lloyd TL, Griswold MD. Role of E box and initiator region in the expression of the rat follicle-stimulating hormone receptor. J Biol Chem 1996; 271:33317-33324[Abstract/Free Full Text]
  16. Sairam MR, Subbarayan VSR. Characterization of the 5' flanking region and potential control elements of the ovine follitropin receptor gene. Mol Reprod Dev 1997; 48:480-487[CrossRef][Medline]
  17. Heckert LL, Daley IJ, Griswold MD. Structural organization of the follicle-stimulating hormone receptor gene. Mol Endocrinol 1992; 6::70-80[Abstract/Free Full Text]
  18. Gromoll J, Dankbar B, Gudermann T. Characterization of the 5' flanking region of the human follicle-stimulating hormone receptor gene. Mol Cell Endocrinol 1994; 102:93-102[CrossRef][Medline]
  19. Huhtaniemi I, Eskola V, Pakarinen P, Matikainen T, Sprengel R. The murine luteinizing hormone and follicle-stimulating hormone receptor genes: transcription initiation sites, putative promoter sequences and promoter activity. Mol Cell Endocrinol 1992; 88:55-66[CrossRef][Medline]
  20. Zhou J, Kumar TR, Matzuk MM, Bondy C. Insulin-like growth factor I regulates gonadotropin responsiveness in the murine ovary. Mol Endocrinol 1997; 11:1924-1933[Abstract/Free Full Text]
  21. Findlay JK. An update on the roles of inhibin, activin, and follistatin as local regulators of folliculogenesis. Biol Reprod 1993; 48:15-23[Abstract]
  22. Minegishi T, Kishi H, Tano M, Kameda T, Hirakawa T, Miyamoto K. Control of FSH receptor mRNA expression in rat granulosa cells by 3',5'-cyclic adenosine monophosphate, activin, and follistatin. Mol Cell Endocrinol 1999; 149:71-77[CrossRef][Medline]
  23. Minegishi T, Hirakawa T, Kishi H, Abe K, Tano M, Abe Y, Miyamoto K. The mechanisms of retinoic acid-induced regulation on the follicle- stimulating hormone receptor in rat granulosa cells. Biochim Biophys Acta 2000; 1495:203-211[Medline]
  24. Hirakawa T, Minegishi T, Abe K, Kishi H, Inoue K, Ibuki Y, Miyamoto K. Effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin on the expression of follicle-stimulating hormone receptors during cell differentiation in cultured granulosa cells. Endocrinology 2000; 141:1470-1476[Abstract/Free Full Text]
  25. Zheng WL, Bucco RA, Sierra-Rievera E, Osteen KG, Melner MH, Ong DE. Synthesis of retinoic acid by rat ovarian cells that express cellular retinoic acid-binding protein-II. Biol Reprod 1999; 60:110-114[Abstract/Free Full Text]
  26. Brembeck FH, Rustgi AK. The tissue-dependent keratin 19 gene transcription is regulated by GKLF/KLF4 and Sp1. J Biol Chem 2000; 275:28230-28239[Abstract/Free Full Text]
  27. Wieczorek E, Lin Z, Perkins EB, Law DJ, Merchant JL, Zehner ZE. The zinc finger repressor, ZBP-89, binds to the silencer element of the human vimentin gene and complexes with the transcriptional activator, Sp1. J Biol Chem 2000; 275:12879-12888[Abstract/Free Full Text]
  28. Collingwood TN, Urnov FD, Wolffe AP. Nuclear receptors: coactivators, corepressors and chromatin remodeling in the control of transcription. J Mol Endocrinol 1999; 23:255-275[Abstract]
  29. Griswold M, Kim J. Site-specific methylation of the promoter alters deoxyribonucleic acid-protein interactions and prevents follicle-stimulating hormone receptor gene transcription. Biol Reprod 2001; 64::602-610[Abstract/Free Full Text]
  30. Griswold MD, Kim JS, Tribley WA. Mechanisms involved in the homologous down-regulation of transcription of the follicle-stimulating hormone receptor gene in Sertoli cells. Mol Cell Endocrinol 2001; 173:95-107[CrossRef][Medline]
  31. Xing W, Sairam MR. Characterization of regulatory elements of ovine follicle-stimulating hormone (FSH) receptor gene: the role of E-box in the regulation of ovine FSH receptor expression. Biol Reprod 2001; 64:579-589[Abstract/Free Full Text]
  32. Xing W, Sairam MR. Role of CACC box in the regulation of ovine FSH receptor expression. Biol Reprod 2001; 65:1142-1149[Abstract/Free Full Text]
  33. Kim JS, Griswold MD. E2F and GATA-1 are required for the Sertoli cell-specific promoter activity of the follicle-stimulating hormone receptor gene. J Androl 2001; 22:629-639[Abstract]
  34. Levallet J, Koskimies P, Rahman N, Huhtaniemi I. The promoter of murine follicle-stimulating hormone receptor: functional characterization and regulation by transcription factor steroidogenic factor 1. Mol Endocrinol 2001; 15:80-92[Abstract/Free Full Text]
  35. Xing W, Danilovich N, Sairam MR. Orphan receptor chicken ovalbumin upstream promoter transcription factors inhibit steroid factor-1, upstream stimulatory factor, and activator protein-1 activation of ovine follicle-stimulating hormone receptor expression via composite cis-elements. Biol Reprod 2002; 66:1656-1666[Abstract/Free Full Text]
  36. Braun KW, Tribley WA, Griswold MD, Kim KH. Follicle-stimulating hormone inhibits all-trans-retinoic acid-induced retinoic acid receptor alpha nuclear localization and transcriptional activation in mouse Sertoli cell lines. J Biol Chem 2000; 275:4145-4151[Abstract/Free Full Text]
  37. Rassoulzadegan M, Paquis-Flucklinger V, Bertino B, Sage J, Jasin M, Miyagawa K, Van Heyningen V, Besmer P, Cuzin F. Transmeiotic differentiation of male germ cells in culture. Cell 1993; 75:997-1006[CrossRef][Medline]
  38. Chedrese PJ, Rodway MR, Swan CL, Gillio-Meina C. Establishment of a stable steroidogenic porcine granulosa cell line. J Mol Endocrinol 1998; 20:287-292[Abstract]
  39. Rols MP, Delteil C, Serin G, Teissie J. Temperature effects on electrotransfection of mammalian cells. Nucleic Acids Res 1994; 22:540[Free Full Text]
  40. Zhuang YH, Ylikomi T, Lindfors M, Piippo S, Tuohimaa P. Immunolocalization of retinoic acid receptors in rat, mouse and human ovary and uterus. J Steroid Biochem Mol Biol 1994; 48:61-68[CrossRef][Medline]
  41. Hattori M, Takesue K, Nishida N, Kato Y, Fujihara N. Inhibitory effect of retinoic acid on the development of immature porcine granulosa cells to mature cells. J Mol Endocrinol 2000; 25:53-61[Abstract]
  42. Cheung B, Hocker JE, Smith SA, Reichert U, Norris MD, Haber M, Stewart BW, Marshall GM. Retinoic acid receptors beta and gamma distinguish retinoid signals for growth inhibition and neuritogenesis in human neuroblastoma cells. Biochem Biophys Res Commun 1996; 229:349-354[CrossRef][Medline]
  43. Kascheike B, Ivell R, Walther N. Alterations in the chromatin structure of the distal promoter region of the bovine oxytocin gene correlate with ovarian expression. DNA Cell Biol 1997; 16:1237-1248[Medline]
  44. Mollard R, Viville S, Ward SJ, Decimo D, Chambon P, Dolle P. Tissue-specific expression of retinoic acid receptor isoform transcripts in the mouse embryo. Mech Dev 2000; 94:223-232[CrossRef][Medline]
  45. Hammer GD, Krylova I, Zhang Y, Darimont BD, Simpson K, Weigel NL, Ingraham HA. Phosphorylation of the nuclear receptor SF-1 modulates cofactor recruitment: integration of hormone signaling in reproduction and stress. Mol Cell 1999; 3:521-526[CrossRef][Medline]
  46. Sarkar D, Kambe F, Hayashi Y, Ohmori S, Funahashi H, Seo H. Involvement of AP-1 and steroidogenic factor (SF)-1 in the cAMP- dependent induction of human adrenocorticotropic hormone receptor (ACTHR) promoter. Endocr J 2000; 47:63-75[Medline]
  47. Hanley NA, Ikeda Y, Luo X, Parker KL. Steroidogenic factor 1 (SF-1) is essential for ovarian development and function. Mol Cell Endocrinol 2000; 163:27-32[CrossRef][Medline]
  48. Ikeda Y, Shen WH, Ingraham HA, Parker KL. Developmental expression of mouse steroidogenic factor-1, an essential regulator of the steroid hydroxylases. Mol Endocrinol 1994; 8:654-662[Abstract/Free Full Text]
  49. Ramayya MS, Zhou J, Kino T, Segars JH, Bondy CA, Chrousos GP. Steroidogenic factor 1 messenger ribonucleic acid expression in steroidogenic and nonsteroidogenic human tissues: Northern blot and in situ hybridization studies. J Clin Endocrinol Metab 1997; 82:1799-1806[Abstract/Free Full Text]
  50. Shapiro DB, Pappalardo A, White BA, Peluso JJ. Steroidogenic factor-1 as a positive regulator of rat granulosa cell differentiation and a negative regulator of mitosis. Endocrinology 1996; 137:1187-1195[Abstract]
  51. Heckert LL. Activation of the rat follicle-stimulating hormone receptor promoter by steroidogenic factor 1 is blocked by protein kinase A and requires upstream stimulatory factor binding to a proximal E box element. Mol Endocrinol 2001; 15:704-715[Abstract/Free Full Text]
  52. Linder CC, Heckert LL, Goetz TL, Griswold MD. Follicle-stimulating hormone receptor gene promoter activity. Endocrine 1994; 2:957-966
  53. Fryer CJ, Archer TK. Analyzing the contributions of chromatin structure in nuclear hormone receptor activated transcription in vivo. Methods Mol Biol 2001; 176:283-296[Medline]
  54. Dilworth FJ, Fromental-Ramain C, Yamamoto K, Chambon P. ATP-Driven chromatin remodeling activity and histone acetyltransferases act sequentially during transactivation by RAR/RXR in vitro. Mol Cell 2000; 6:1049-1058[CrossRef][Medline]



This article has been cited by other articles:


Home page
ReproductionHome page
N. Vernet, C. Dennefeld, M. Klopfenstein, A. Ruiz, D. Bok, N. B Ghyselinck, and M. Mark
Retinoid X receptor beta (RXRB) expression in Sertoli cells controls cholesterol homeostasis and spermiation
Reproduction, November 1, 2008; 136(5): 619 - 626.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R. Gonzalez-Fernandez, E. Martinez-Galisteo, F. Gaytan, J. A. Barcena, and J. E. Sanchez-Criado
Changes in the Proteome of Functional and Regressing Corpus Luteum During Pregnancy and Lactation in the Rat
Biol Reprod, July 1, 2008; 79(1): 100 - 114.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Xing, A. Singgih, A. Kapoor, C. M. Alarcon, D. J. Baylink, and S. Mohan
Nuclear Factor-E2-related Factor-1 Mediates Ascorbic Acid Induction of Osterix Expression via Interaction with Antioxidant-Responsive Element in Bone Cells
J. Biol. Chem., July 27, 2007; 282(30): 22052 - 22061.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. Stocco, C. Telleria, and G. Gibori
The Molecular Control of Corpus Luteum Formation, Function, and Regression
Endocr. Rev., February 1, 2007; 28(1): 117 - 149.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. R. Wood, V. L. Nelson, C. Ho, E. Jansen, C. Y. Wang, M. Urbanek, J. M. McAllister, S. Mosselman, and J. F. Strauss III
The Molecular Phenotype of Polycystic Ovary Syndrome (PCOS) Theca Cells and New Candidate PCOS Genes Defined by Microarray Analysis
J. Biol. Chem., July 11, 2003; 278(29): 26380 - 26390.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xing, W.
Right arrow Articles by Sairam, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xing, W.
Right arrow Articles by Sairam, M. R.
Agricola
Right arrow Articles by Xing, W.
Right arrow Articles by Sairam, M. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS