| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Regular Article |
a Department of Cell Biology, University of Virginia Health System, Charlottesville, Virginia 22908
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
epididymis, male reproductive tract
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The liver and the kidney are the only tissues capable of synthesizing L-carnitine. Other tissues, including the epididymis, must transport this molecule across their epithelia. In the epididymis, L-carnitine is transported against a concentration gradient greater than 2000-fold, with intraluminal concentrations reaching as high as 50–60 mM in the cauda epididymides of the rat [6, 7]. Studies in rats demonstrated that injection of radioactive carnitine into the bloodstream is rapidly taken up by the epithelium of the distal caput, corpus, and proximal cauda epididymides [8–10]. The mechanism of L-carnitine transport in the epididymis is not known but has been suggested to involve an active transport system [9] comprised of both a basolateral as well as an apical transporter [10]. To date, however, these transporters have not been identified.
In 1998, two independent laboratories reported the cloning of OCTN2, a high-affinity carnitine transporter [11, 12]. OCTN2 is a member of the organic cation transporter family, a family of proteins that mediate the transport of a number of organic cations [13–15]. In addition to OCTN2, other members of this family that have been found to transport L-carnitine include OCTN1 and OCTN3 [16–18]. OCTN1 interacts with carnitine with low affinity and appears to be a multispecific organic cation transporter that is expressed in a number of tissues [16, 18]. In contrast, OCTN3 is a high-affinity carnitine transporter with limited tissue distribution. OCTN3 is highly expressed in the testis, is weakly expressed in the kidney, but is not expressed in tissues such as the liver, lung, spleen, brain, and heart, suggesting that OCTN3 plays a significant role in the testis [17].
Recent studies by a number of investigators found that mutations in human OCTN2 are responsible for primary carnitine deficiency, a disorder characterized by cardiomyopathy and muscle weakness [19–22]. Koizumi and coworkers [23] described an animal model for primary carnitine deficiency, the juvenile visceral steatosis (jvs) mouse, and studies demonstrated that mutations in OCTN2 were responsible for the jvs phenotype [24]. These mice exhibit symptoms similar to those of people suffering from primary carnitine deficiency. In addition, jvs mice display a number of epididymal abnormalities, including epididymal hypoplasia [25]. Specifically, the proximal regions of the epididymides of these mice, including the corpus, are dilated. Within the corpus, a ruptured epithelium resulted in the presence of sperm in the stroma. Further, the distal regions of the epididymides of jvs mice are void of spermatozoa [25].
Taking into consideration that OCTN2 is a critical transporter of L-carnitine in a number of tissues in addition to the epididymal phenotype observed in the jvs mouse, we developed the following working hypothesis: OCTN2 is responsible for the active transport of L-carnitine across the mammalian epididymal epithelium. The first objective of this study was to test the hypothesis that OCTN2 was present in the epididymis. The second objective was to identify other putative carnitine transporters that may be responsible for L-carnitine transport in the epididymis.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Rat tissues were obtained from normal adult male Sprague-Dawley rats (Hilltop Laboratories, Philadelphia, PA). Mouse tissues were obtained from normal adult male FVB/N mice. All experiments complied with the regulations set forth by the Animal Welfare Act (Public Law 91–579), the Guide for the Care and Use of Laboratory Animals (NRC, 1996) published by the Department of Health and Human Services, and the policies and procedures of the University of Virginia Institutional Animal Care and Use Committee.
Relative Quantitative Reverse Transcription Polymerase Chain Reaction
Total RNA was isolated from rat and mouse tissues using the Trizol Reagent (Life Technologies, Rockville, MD) as per manufacturer's instructions. Four micrograms of total RNA was used for first-strand cDNA synthesis using the Superscript First-Strand Synthesis kit (Invitrogen, Carlsbad, CA). The resulting cDNAs were used for relative quantitative polymerase chain reaction (PCR) using the QuantumRNA 18S Internal Standards (Ambion, Austin, TX) in a multiplex reaction in conjunction with OCTN1, OCTN2, or OCTN3 primers. OCTN1 primers were designed (antisense: GACAGGGCTGCTTGTGGTGAGACAGGCTGG; sense: TC-GTGCAAGTTGAGGAGAGGCGGGAAGC) based on the published sequence of rat OCTN1 cDNA isolated from a rat placental cDNA library [18]. OCTN2 primers were designed (antisense: CAAGCTGTGTGTGG-TTAGCCTTGG; sense: TCTCCCGCTCTGCGGTATCC) based on the published sequence of the rat small intestine OCTN2 cDNA [12]. OCTN3 primers were designed (antisense: TTCGGGATACATTTCCTTTAGA-CTCC; sense: CTGCCGACTCTATGCTTGACTACG) based on the published sequence of mouse OCTN3 cDNA [17]. All primers were ordered from Invitrogen. The PCR products were analyzed by agarose gel electrophoresis. Each reverse transcription polymerase chain reaction (RT-PCR) experiment was conducted 3 times. The expected sizes of the PCR products for OCTN1, OCTN2, and OCTN3 were 1869, 1909, and 1674 base pairs (bp), respectively. The PCR fragments obtained were gel-purified, cloned into the TOPO II vector (Invitrogen), and sequenced.
Northern Blot Analysis
Total RNA was isolated from rat (n = 3) tissues using the Trizol Reagent as per manufacturer's instructions. A total of 10 µg of RNA was loaded in 1% agarose gels containing 2.2 M formaldehyde and was electrophoresed at constant voltage. Following gel electrophoresis, the RNA was transferred onto a nylon membrane (Hybond-XL; Amersham Pharmacia Biotech, Piscataway, NJ) by capillary action and the membrane was baked for 2 h at 80°C. The OCTN2 cDNA was released from the TOPO II vector by restriction enzyme digestion with EcoRI and was gel purified. The OCTN2 cDNA was labeled using the Prime-It II Random Primer Labeling Kit (Stratagene, La Jolla, CA) as per manufacturer's instructions. The membrane was hybridized overnight at 68°C in modified Church and Gilbert buffer (0.5 M phosphate buffer, pH 7.2, 7% SDS (w/v), 10 mM EDTA). Following hybridization, the membrane was washed and exposed to x-ray film. Blots were then stripped and probed with cyclophilin.
Immunohistochemistry and Western Blot Analysis
A rabbit polyclonal antibody was generated (QCB, Hopkinton, MA) to the carboxy-terminal region of rat OCTN2 (acetyl-CSQTRTQKDGGESPTVLK-amide). This peptide sequence was used to search the NCBI database. Results indicated that no other proteins contained the same sequence as the carboxy-terminal end of OCTN2. The affinity-purified antibody was used for Western blot analysis and immunohistochemistry. For Western blot analysis, rat tissues were isolated and frozen in liquid nitrogen. Frozen tissues were homogenized by grinding in liquid nitrogen using a mortar and pestle. Upon evaporation of the liquid nitrogen, RIPA buffer (50 mM Tris, 150 mM NaCl, 10 mM EDTA, 1.0% NP-40, 0.5% sodium deoxycholate, 0.1% SDS) plus protease inhibitors (1 mg/ml pefabloc, 5 µg/ml leupeptin, 15 µg/ml pepstatin, 2 µg/ml aprotinin) were added to the samples, vortexed, and kept on ice. Samples were centrifuged (3000 x g, 15 min, 4°C) and the supernatant transferred to a fresh tube. A total of 40 µg of protein was electrophoresed by 10% SDS-PAGE and transferred onto 0.45-µm nitrocellulose membrane (Bio-Rad, Hercules, CA). Membranes were incubated with 1x TBS/5% milk/ 0.1% Tween-20 for 1 h at room temperature. Primary antibody was diluted (1:5000) in 1x TBS/5% milk/0.1% Tween-20 and incubated with the blots overnight at 4°C. Blots were washed in 1x TBS/5% milk/0.1% Tween-20 for 1 h at room temperature and incubated with peroxidase-conjugated affini-pure goat anti-rabbit IgG (Jackson ImmunoResearch Lab, West Grove, PA), diluted 1:5000 in 1x TBS/5% milk/0.1% Tween-20 for 1 h at room temperature. The membranes were washed in 1x TBS/5% milk/0.1% Tween-20 for 1 h at room temperature. Reactive bands were detected by enhanced chemiluminescence (New England BioLabs, Beverly, MA).
For immunohistochemistry, rats (n = 4) were perfused via the testicular arteries, first with heparin to clear the testicular blood vessels, followed by Bouin fixative. Following perfusion, tissues were placed in Bouin fixative and sent to the Center for Research in Reproduction Cell Science Core at the University of Virginia for paraffin embedding and sectioning. Slide-mounted sections were deparaffinized, rehydrated, and peroxidase activity removed by incubating in 0.3% hydrogen peroxide in methanol for 30 min. Tissue sections were incubated for 60 min at room temperature in blocking solution (1x PBS, pH 7.4, containing 0.5% fish skin gelatin [FSG; Sigma-Aldrich, St. Louis, MO] and 10% normal goat serum) and rinsed in 1x PBS. Endogenous biotin was blocked by incubating sections in biotin and avidin D solutions as per manufacturer's instructions (Vector Laboratories, Inc., Burlingame, CA). Slides were rinsed in 1x PBS prior to incubating overnight at 4°C in primary antibody diluted 1:3000 in 1x PBS. For negative controls, slides were incubated with preimmune sera at the same concentration. Controls also included the use of antibody adsorbed against the purified antigen as well as incubation with secondary antibody only. Slides were washed 3 times for 10 min each in 1x PBS/0.5% FSG and incubated for 1 h at room temperature in secondary antibody diluted (1:200) in blocking solution. Slides were washed 3 times for 10 min each in 1x PBS/0.5% FSG. The Vectastain Elite ABC kit (Vector Laboratories) was used with diaminobenzidine (DAB) substrate as per manufacturer's instructions. Slides were washed with distilled water, dehydrated, and counterstained with hematoxylin prior to clearing in xylenes and mounting using Vectamount permanent mounting medium (Vector Laboratories).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
To date, three proteins have been found to transport L-carnitine, i.e., OCTN1, OCTN2, and OCTN3. Relative quantitative RT-PCR was conducted to examine the expression of OCTN1, OCTN2, and OCTN3 in the epididymis (Fig. 1). The QuantumRNA 18S Internal Standards (Ambion, Austin, TX) were used as an internal control resulting in a PCR product of 489 bp (Fig. 1). Low levels of OCTN1 expression were observed in the testis, initial segment, proximal caput, distal caput, corpus, proximal cauda, and distal cauda (Fig. 1A, lanes 2–8). In contrast, OCTN1 was highly expressed in the kidney, liver, and small intestine (Fig. 1A, lanes 9–11).
|
OCTN2 expression was observed in the testis, proximal caput, distal caput, corpus, proximal cauda, distal cauda, kidney, and small intestine (Fig. 1B, lanes 2, 4–9, and 11). Within the epididymis, a region-specific pattern of OCTN2 expression was observed with distal caput = corpus > proximal caput > proximal cauda > distal cauda. Little to no expression of OCTN2 was observed in the initial segment (Fig. 1B, lane 3). The kidney (Fig. 1B, lane 9) had higher levels of OCTN2 expression than the small intestine (Fig. 1B, lane 11). Lowest expression was observed in the liver (Fig. 1B, lane 10).
OCTN3 was highly expressed in the mouse testis (Fig. 3, lane 2) but was not expressed in the caput, corpus, or cauda epididymides (Fig. 3, lanes 3–5). PCR products were not observed in any of the no-RT control samples (Fig. 1, A and B, lane 12; Fig. 1C, lane 6).
|
The results obtained from the relative quantitative RT-PCR demonstrated that OCTN2 was the only carnitine transporter present in the epididymis in a region-dependent manner. Moreover, highest expression of OCTN2 was observed in the regions previously demonstrated to be involved in L-carnitine uptake (i.e., the distal caput, corpus, and proximal cauda epididymides). Therefore, we decided to further examine the expression of OCTN2 in the rat epididymis.
Northern Analysis
The 1.9-kilobase (kb) OCTN2 cDNA was used to probe blots containing total RNA isolated from different regions of the rat epididymis as well as the heart. A representative blot is shown in Figure 2. Northern analysis demonstrated the presence of OCNT2 RNA in the rat epididymis. A single transcript at approximately 3.5 kb was detected in the proximal caput, distal caput, corpus, proximal cauda, and the heart (Fig. 2A). This was the expected transcript size based on other reports [11, 12, 26]. Highest expression of OCTN2 was observed in the distal caput and corpus. Little to no expression of OCTN2 was detected in the initial segment or distal cauda. Blots were stripped and probed with cyclophilin, which served as our loading control (Fig. 2B).
|
Immunohistochemistry and Western Blot Analysis
To localize the protein, an antibody raised against a carboxy-terminal peptide of OCTN2 was produced in rabbits and used for Western blot analysis and immunohistochemistry. The affinity-purified antibody recognized a band of approximately 65 kDa in Western blots containing epididymal lysates isolated from the distal caput, corpus, and proximal cauda (Fig. 3A). This band was abolished when the antibody was preabsorbed with the immunizing peptide (data not shown). The use of secondary antibody alone did not detect any bands (Fig. 3B).
Immunohistochemical studies demonstrate that the OCTN2 antibody reacted with tissue sections from the distal caput, corpus, and proximal cauda. The anti-OCTN2 antibody produced a basolateral staining in the principal cells of the distal caput (Fig. 4C), corpus (Fig. 4D), and proximal cauda (Fig. 4E) as well as staining of basal cells in the distal caput (Fig. 4C) and corpus epididymidis (Fig. 4D). Moderate levels of staining were observed in the distal caput, but the staining became stronger in the corpus and then progressively weaker in the proximal cauda. Staining was not observed in the initial segment (Fig. 4A), proximal caput (Fig. 4B), distal cauda (Fig. 4F), or testis (data not shown). Sections obtained from the distal caput, corpus, and proximal cauda were also incubated with antibody that had been previously preabsorbed with the peptide. Staining was not observed in any of these sections, demonstrating the specificity of our antibody (data not shown). Staining was also not observed in sections incubated with preimmune sera (data not shown).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In this study, we examined the expression of OCTN1, OCTN2, and OCTN3 in the epididymis by relative quantitative RT-PCR. Relative quantitative RT-PCR shows low levels of OCTN1 expression in the testis, initial segment, proximal caput, distal caput, corpus, proximal cauda, and distal cauda (Fig. 1A, lanes 2–8). In contrast, high levels of expression of OCTN1 in the kidney, liver, and small intestine suggest that this transporter plays a significant role in these tissues (Fig. 1A, lanes 9–11). OCTN1 is a low-affinity, sodium-independent L-carnitine transporter [16]. In addition to a wide tissue distribution, OCTN1 has been shown to have wide substrate specificity and was suggested to function as a proton/organic cation antiporter in renal epithelial cells [16]. We speculate that OCTN1 may also function as a multispecific organic cation in the testis and epididymis. Thus far, the rat OCTN3 cDNA has not been cloned. Therefore, OCTN3 primers were designed based on the mouse OCTN3 cDNA sequence [17]. In preliminary studies, a total of three different sets of primers were used for RT-PCR using RNA isolated from rat and mouse tissues. However, our initial studies indicated that the primers were mouse specific. Therefore, in view of the lack of information on the sequence of the rat OCTN3 cDNA, the expression of OCTN3 was examined in mouse tissues. Because of the small size of mouse tissues, the epididymides were only divided into caput, corpus, and cauda. Our studies showed that OCTN3 was highly expressed in the mouse testis (Fig. 3, lane 2) but was not expressed in the caput, corpus, or cauda epididymides (Fig. 3, lanes 3–5). These results suggest that OCTN3 does not play a role in carnitine transport in the mouse epididymis, and we speculated that the same might be true in the rat epididymis, though further studies must be conducted to confirm this assumption. In contrast with the expression levels of OCTN1 and OCTN3, OCTN2 expression in the epididymis was much higher (Fig. 1B). The relative quantitative RT-PCR studies demonstrate that OCTN2 is expressed in a region-specific manner, with distal caput = corpus > proximal caput > proximal cauda > distal cauda. The highest levels of expression were observed in epididymal regions that had been previously shown to be involved in the uptake of L-carnitine. These results were of great interest and suggested that we further examine the expression of OCTN2 in the rat epididymis.
Northern analysis studies confirm that OCTN2 is expressed in a region-specific manner, with distal caput = corpus > proximal caput > proximal cauda > distal cauda. As with the RT-PCR results, highest levels of OCTN2 expression were observed in regions involved in the uptake of L-carnitine. Interestingly, the uptake of L-carnitine in the epididymis is androgen dependent [27], and recent studies reported that castration abolishes OCTN2 expression in the rat epididymis, suggesting that OCTN2 expression is regulated by testosterone [28]. OCTN2 mediates the uptake of L-carnitine against a concentration gradient and was shown to transport L-carnitine in a sodium-dependent manner [29]. Moreover, mutations in OCTN2 are responsible for primary carnitine deficiency in the juvenile visceral steatosis (jvs) mouse [24], and these mice display a number of epididymal abnormalities [25].
To localize the protein, an antibody raised against a carboxy-terminal peptide of OCTN2 was produced in rabbits and used for Western blot analysis and immunohistochemistry. The OCTN2 cDNA codes for a 557-amino acid protein with a predicted molecular mass of 63 kDa. Our affinity-purified antibody recognized a band of approximately 65 kDa in Western blots containing epididymal lysates isolated from the distal caput, corpus, and proximal cauda (Fig. 3A). Moreover, our immunohistochemical studies demonstrate that OCTN2 protein is localized to the basolateral regions of the epithelial cells of the distal caput (Fig. 4C), corpus (Fig. 4D), and proximal cauda (Fig. 4E). The strongest staining pattern was observed in the corpus. These studies suggest that OCTN2 may be the basolateral transporter previously suggested to transport L-carnitine across the epididymal epithelium [10]. We speculate that a different transporter, possibly a multispecific transporter such as OCTN1, is responsible for transporting L-carnitine from the epithelium and into the lumen of the epididymis. Though OCTN2 transcripts were detected in the testis, our antibody did not detect OCTN2 protein in the testis. A possible explanation may be that a differentially spliced variant of OCTN2 may be present in the testis that does not contain the carboxy-terminal end the antibody was raised against. Differentially spliced variants of OCTN2 have been reported recently [30]. The concentration of carnitine in the testis, however, is relatively low [31], and we speculate that OCTN2 may function in the testis to transport organic cations other than L-carnitine.
In conclusion, our studies have identified a transporter that may be responsible for L-carnitine transport in the epididymis. OCTN2 is present in the rat epididymis in a region-dependent manner, with highest expression observed in the regions previously shown to be involved in L-carnitine uptake. OCTN2 protein is localized to the basolateral region of epididymal cells and is likely responsible for transporting L-carnitine across the epididymal epithelium. The role of OCTN2 in L-carnitine transport in the epididymis warrants future study since OCTN2 may serve as a target to further study and define the role of L-carnitine in the epididymis.
|
FOOTNOTES |
|---|
1 Supported by The Rockefeller Foundation/Ernst Schering Research Foundation, Sigma Tau Inc., Training Grant NIH T-32-HD07382, and the NICHD/NIH through cooperative agreement U54 HD28934 as part of the Specialized Cooperative Centers Program in Reproduction Research. 
2 Correspondence. FAX: 434 982 3912; bth7c{at}virginia.edu
Accepted: February 18, 2002.
Received: November 12, 2001.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  D. Kobayashi, M. Irokawa, T. Maeda, A. Tsuji, and I. Tamai Carnitine/organic cation transporter OCTN2-mediated transport of carnitine in primary-cultured epididymal epithelial cells Reproduction, December 1, 2005; 130(6): 931 - 937. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. S. Prins and W. Bremner The 25th Volume: President's Message: Andrology in the 20th Century: A Commentary on Our Progress During the Past 25 Years J Androl, July 1, 2004; 25(4): 435 - 440. [Full Text] [PDF]
|
|
|
|
|
|
H. Obermann, A. Wingbermuhle, S. Munz, and C. Kirchhoff A Putative 12-Transmembrane Domain Cotransporter Associated With Apical Membranes of the Epididymal Duct J Androl, July 1, 2003; 24(4): 542 - 556. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Ezer and B. Robaire Gene Expression Is Differentially Regulated in the Epididymis after Orchidectomy Endocrinology, March 1, 2003; 144(3): 975 - 988. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
