Biol Reprod Keystone Symposia Conference on Frontiers in Reproductive Biology & Regulation of Fertility.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, J. C.
Right arrow Articles by Chen, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, J. C.
Right arrow Articles by Chen, T. J.
Agricola
Right arrow Articles by Chen, J. C.
Right arrow Articles by Chen, T. J.
Biology of Reproduction 67, 8-13 (2002)
© 2002 Society for the Study of Reproduction, Inc.

Regular Article

Luteotropic Roles of Prolactin in Early Pregnant Hamsters1

Joyce C. Chen2,,a,c, Jen-Hsou Linb, Leang-Shin Wub, Yuan-Feen Tsaia, Tsung Hsien Suc,d, Chau Jang Chenc, and Tong J. Chen3,,a

a Department of Physiology, College of Medicine, b Department of Animal Science, College of Agriculture, National Taiwan University, Taipei, Taiwan c National Taipei College of Nursing, Taipei, Taiwan d Department of Obstetrics and Gynecology, Mackay Memorial Hospital, Taipei, Taiwan


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Prolactin (PRL) has long been regarded as a luteotropin maintaining early pregnancy in rodents. To delineate luteotropic roles of PRL in terms of luteal vascularization and immune privilege, luteal expression of Thy-1 differentiation protein, Fas, and Fas ligand (FasL) in early pregnancy was studied in hamsters on Day 4 of pregnancy (P4 group). Release of pituitary PRL was blocked by daily treatment with bromocriptine (1 mg s.c. given at 1000 h) on Days 1–4 of pregnancy (PB group). PRL withdrawal induced functional luteolysis, as evidenced by a precipitous drop in serum progesterone to background levels. In situ 3' end-labeling of fragmented DNA (TUNEL method) also clearly showed that many apoptotic nuclei accumulated in the disintegrated luteal vessels in the corpus luteum in the PB group. Immunohistochemical studies showed that luteal Thy-1-positive vascular pericytes were abundant in the P4 group but rare in the PB group. Thus, PRL is essential for luteal vascularization in early pregnancy. Western blotting and quantitative real-time reverse transcription-polymerase chain reaction data showed that Fas protein and mRNA levels increased, whereas those of FasL decreased after PRL withdrawal. Accordingly, apoptosis initiated by Fas-FasL interaction is involved in the bromocriptine-induced luteolysis. Therefore, luteotropic roles of PRL are to support Thy-1 positive pericytes in maintaining proper luteal vascularization and to prevent immune insult by preserving a balance between luteal Fas and FasL expression in early pregnancy.

apoptosis, corpus luteum, pregnancy, progesterone, prolactin


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The corpus luteum (CL) is an ephemeral endocrine tissue. Under pituitary control, it secretes progesterone to maintain pregnancy [1]. Prolactin (PRL) has long been regarded as a luteotropin maintaining early pregnancy in rodents. In hamsters, PRL is very important in early pregnancy. Exogenous PRL is necessary for maintenance of the CL during early pregnancy in hypophysectomized hamsters [2]. Bromocriptine, a dopamine receptor agonist, inhibits pituitary PRL secretion, and bromocriptine administration induces luteolysis in early pregnancy in hamsters [3].

Because of extensive sprouting of blood vessels during CL development, luteal capillary endothelial cells accounts for more than 50% of all cells within the CL [4–6] and are tightly associated with luteal development, function, and regression [7, 8]. Thy-1 differentiation protein is released by Thy-1-positive vascular pericytes, enhancing proliferation and preservation of endothelial cells [9]. The presence of Thy-1 differentiation protein also serves as a marker of luteal vascularization and development [10]. When pregnancy is absent or interrupted, the CL regresses to an avascular structure, and it is reasonable to speculate that luteolysis, induced by PRL withdrawal, might be associated with luteal vascular regression.

Apoptosis, or programmed cell death, is involved in luteal regression [11–13]. The Fas (CD95/APO-1) and Fas ligand (FasL) pathway was initially identified in clonal deletion and immune tolerance [14, 15]. FasL induces apoptosis of Fas-bearing immune cells [14, 16]. The Fas-FasL system is also reported to be involved in the maintenance of immune privilege in the mouse testis and anterior chamber of the eye [16–18]. In follicular atresia, the Fas-FasL system acts as a mediator of granulosa cell apoptosis [19].

Recent investigations have shown that Fas-FasL interaction is responsible for the apoptosis of PRL-induced luteolysis in rats pretreated with bromocriptine during proestrus [20–22]. These in vitro studies showed that FasL-positive nonsteroidogenic cells are CD3+ luteal immunocytes responsible for PRL-induced apoptosis and that addition of PRL increases the expression of membrane-bound FasL on these CD3+ luteal immunocytes. Fas is expressed by cultured steroidogenic luteal cells, and its expression is increased by progesterone withdrawal. Luteal FasL expression during PRL-induced luteolysis in rats has therefore been suggested to be locally regulated in an autocrine/paracrine manner by steroidogenic luteal cells [20, 22]. Thus, PRL plays a luteolytic role by up-regulation of FasL expression in luteal immune cells, which initiate apoptosis during structural luteolysis. However, CL at different stages, from consecutive estrous cycles, are present at the same time in the rat ovary, and PRL must therefore simultaneously exert luteolytic and luteotropic actions, depending on the physiologic state of the CL.

An in vivo study in the rat [23] showed that FasL protein and mRNA are present in the CL at all stages of pregnancy and postpartum and that ovarian FasL mRNA expression significantly decreases at postpartum Day 3 when structural luteolysis starts. We thus hypothesized that FasL expression during pregnancy might play a role in maintaining luteal immune privilege and ensuring the success of pregnancy. Luteal Thy-1 differentiation protein expression and Thy-1-positive vascular pericytes were used as indices of luteal vascularization and development, and Fas and FasL expression in association with apoptosis was evaluated. Daily bromocriptine treatment of pregnant hamsters for the first four gestation days was used to delineate the influences of pituitary PRL on CL formation and regression during early pregnancy, with the aim of determining its luteotropic roles in luteal vascularization and immune privilege.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Animals

Adult female golden hamsters (10 to 12 wk old) were obtained from the Animal Center for College of Medicine, National Taiwan University; maintained and cared for in the Animal Center in a controlled environment with a 14L:10D (lights-on 0500–1900 h). All experimental procedures involving laboratory hamsters in the present study were approved by the Institutional Animal Care and Use Committee of National Taiwan University College of Medicine. The estrous cycle was monitored in the morning. Day 1 of the cycle was defined by the appearance of viscous vaginal discharges after ovulation. Estrus occurred in the evening of Day 4 (D4). Three consecutive regular 4-day estrous cycles were confirmed before the hamsters were used, then the females were mated overnight with mature males. Day 1 of gestation was designated as the morning on which spermatozoa were found in the vaginal lavage.

Bromocriptine, a dopaminergic agonist that specifically blocks pituitary PRL secretion, was purchased from Sigma (St. Louis, MO) and dissolved in 95% (v/v) ethanol, then diluted with saline to a concentration of 4 mg/ml in 50% (v/v) ethanol. Animals in the experimental group (PB; n = 14) each received an s.c. injection of 1 mg of bromocriptine daily at 1000 h on gestation Days 1–4. The control group (P4; n = 12) received 50% ethanol in saline. Four untreated proestrous (D4) hamsters were also used in Western blot studies.

The animals were killed by decapitation at 1500 h on gestation Day 4. Trunk blood was collected and allowed to clot at room temperature, and the serum was saved at -20°C for subsequent assay. Ovaries from 4 hamsters from the PB and P4 groups were immersed in 4% paraformaldehyde in buffered saline overnight. After fixation, dehydration, and embedding in paraffin wax, serial sections (5 µm) were mounted on silane-coated slides and dried overnight. The ovaries from the remaining animals were frozen in liquid nitrogen for RNA preparation and Western blotting.

Immunohistochemical Localization of Thy-1, Fas, and FasL

The tissue sections were deparaffinized in xylene and dehydrated in a graded series of ethanol. Endogenous peroxidase was quenched by immersion of the slides in 2% H2O2 in methanol for 10 min. After three washes in 0.01 M PBS, pH 7.4, the slides were incubated for 1 h at 37°C with 10% normal goat serum in PBS to reduce nonspecific binding. After three PBS washes, each of 5 min, the sections were incubated overnight at 4°C with diluted (1:1000) mouse monoclonal antibody against CD90 (rat Thy-1 antigen; MRC OX-7; Serotec Ltd., Oxford, England), human-Fas (clone 13; Transduction, Lexington, KY), or human-FasL (G247-4; BD PharMingen, Los Angeles, CA). Biotinylated goat anti-mouse immunoglobulin (Ig) G (Vector Labs, Burlingame, CA) diluted 1:1600, and extra-avidin peroxidase (Sigma) diluted 1:1000 were each applied for 1 h at room temperature. Tissue-bound peroxidase was visualized with 3,3'-diaminobenzidine tetrahydrochloride (DAB; Vector), and the tissue sections were then counterstained with hematoxylin. The specific protein recognized by the primary antibody was immunostained in brown. Negative controls were treated in the same way except that antibody diluent (1% BSA in PBS) was used instead of the primary antibody.

In Situ 3' End-Labeling of Fragmented DNA

Apoptotic cells were visualized by histochemical detection of DNA fragmentation using the Apop Tag In Situ Apoptosis Detection kit (Oncor, Gaithersburg, MD) (TUNEL method). The hydrated sections were pretreated with proteinase K (20 µg/ml) according to the manufacturer's instructions. DNA fragments were 3' end-labeled with digoxigenin-dUTP using terminal deoxynucleotidyl transferase. Labeling was visualized using a peroxidase-labeled anti-digoxigenin antibody and DAB as substrate, and the sections were counterstained with methyl green (Merck, Darmstadt, Germany). Apoptotic nuclei were stained dark brown. Positive controls were pretreated with DNase I (1 U/ml; Boehringer-Mannheim, Mannheim, Germany) before DNA 3' end-labeling.

Western Blotting of Thy-1, Fas, and FasL

The CL were carefully dissected from 1 ovary of 8 hamsters from each group on Day 4 of pregnancy (n = 8 ovaries) or from both ovaries of 4 proestrous hamsters (n = 8 ovaries). After homogenization in RIPA (radioimmunoprecipitation) buffer (20 mM Tris, 1% SDS, 1% Triton X-100, 1 mM PMSF, 50 ng/ml leupeptin, pH 7.4), the samples were centrifuged for 30 min at 800 x g at 4°C, and the supernatants were used for Western blotting. The samples (10 µg of protein) were electrophoresed on a 12% polyacrylamide gel, and the protein was transferred to nitrocellulose membranes (Millipore, Bedford, MA). To ensure equal loading, membranes were also probed for {alpha}-tubulin (clone DM1A; NeoMarker, Fremont, CA). The membranes were then incubated for 2 h at room temperature with 2000-fold diluted primary antibodies (mouse anti-Thy-1, Fas, FasL, and {alpha}-tubulin, respectively) in PBS supplemented with 4% skim milk. After three 30-min washes with PBS containing 0.1% Tween 20 (PBST), the membrane was incubated for 1 h at room temperature with a 1000-fold diluted peroxidase-conjugated goat anti-mouse IgG (Vector); then, after an additional three 30-min washes with PBST, the protein was visualized using the DAB system (Vector) and processed in an image analysis system (Alpha Innotech, San Leandro, CA). Quantitative data were determined as the mean ratio of the optical density of the specific bands normalized to that of {alpha}-tubulin.

Real-Time Quantitative Reverse Transcription-Polymerase Chain Reaction for Fas and FasL mRNA

The CL were carefully dissected out of 1 ovary of 8 animals from each group (n = 8 ovaries) and stored in liquid nitrogen. Total RNA was extracted using TRIzol (Life Technologies, Inc., Gaithersburg, MD). One microgram of total RNA was reverse-transcribed using a random hexamer and the SuperScript preamplification system (Life Technologies), and an aliquot of the resulting cDNA was used for polymerase chain reaction (PCR) amplification. The primers for Fas were Fas I: CAGA-ACTTGGAAGGCCTGCATC and Fas II: TCTGTTCTGCTGTGTCTT-GGAC [24] which amplified a 682-base pair (bp) fragment. The specific primers for human FasL sequence [25] were primer a (sense): TTCTTC-CCTGTCCAACCTCT (150–169), primer b (sense): CGCCACCACT-GCCTCCACTA (243–262), primer c (antisense): CTCATCATCTTCCC-CTCCAT (737–756), and primer d (antisense): CTTCCCCTCCATCA-TCACCA (729–748). For the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene, the primers were GAPDH I: CATCACCATCTTCCAG-GAGC and GAPDH II: GGATGATGTTCTGGAGAGCC, which amplified a fragment of 404 bp. To evaluate the quantitative expression of Fas and FasL, real-time PCR was performed using a Light Cycler (Roche, Mannheim, Germany), SYBR Green I probes, and thermal cycling conditions of 45 cycles of 1 sec at 95°C, 3 sec at 55°C, and 8 sec at 72°C, with fluorescence detection at 87°C after each cycle. After the final cycle, melting point analysis of all samples and controls was performed within the range of 72–95°C.

Enzyme-Linked Immunosorbent Assay

Serum progesterone levels were measured in duplicate using a commercial kit (Diagnostic Product Corporation, Los Angeles, CA), and all samples were performed in the same assay. The sensitivity of the assay was 10 pg per tube. The intraassay coefficient of variation for the kit was 7%.

Statistical Analysis

Multiple comparisons between means were made by one-way ANOVA, and further analysis of P4 group versus PB group or D4 group was conducted by unpaired t-test. Differences were accepted as significance when P < 0.05. Data are presented as mean ± SEM for results from 4 to 8 hamsters per group.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Serum Progesterone Levels after Bromocriptine Treatment

After 4 consecutive days of bromocriptine treatment, the mean (mean ± SEM; n = 8) serum progesterone level dropped to a lower levels (3.8 ± 2.0 ng/ml) as compared with that in the vehicle-treated control group (16.8 ± 1.6 ng/ml). This functional luteolysis was accompanied by obvious shrinkage of the CL and a change in its color from reddish-pink to beige, suggesting that structural luteolysis also resulted from bromocriptine treatment.

In Situ 3' End-Labeling of Fragmented DNA

To determine whether apoptosis was involved in the structural luteolysis induced by bromocriptine treatment, in situ 3' end-labeling of fragmented DNA was performed. The CL in the control P4 animals showed a well-organized tissue structure (Fig. 1a) with highly differentiated steroidogenic luteal cells arranged in clusters and surrounded by luteal vascular pericytes and few apoptotic cells. However, in the PB group, the CL became avascular, the luteal cell clusters were lost, the steroidogenic cells contained apoptotic nuclei and showed structural breakdown, only rare luteal vascular pericytes were found, and numerous lymphocytes and apoptotic nuclei plugged the disintegrated luteal microvasculature (Fig. 1b).



View larger version (132K):
[in this window]
[in a new window]
  		FIG. 1. In situ 3' end-labeling of fragmented DNA (a, b) and immunohistochemical localization of Thy-1 differentiation protein (c, d), Fas (e, f), and FasL (g, h) in the hamster CL in pregnant Day 4 animals treated with vehicle (a, c, e, g) or bromocriptine (b, d, f, h). In CL of the vehicle-treated control group, luteal cells are in clusters with clear cell boundaries and vascular elements (black arrow). In the bromocriptine treatment group, numerous luteal cells with apoptotic nuclei immunostained in dark brown (b) and infiltrated lymphocytes (white arrowhead) are located in and along the disintegrated luteal vessels. Inset in a: positive control for 3' end-labeling. Immunostaining of Thy-1 differentiation protein and Thy-1 positive pericytes (white arrow) are evident in the control group (c) and scarce in the treatment group (d). Inset in c: higher magnification of CL from the vehicle-treated control group. Immunohistochemical staining for Fas and FasL is found in both groups, with staining intensity of Fas increased (f) and that of FasL decreased (h) in the bromocriptine treatment group. Inset in g: negative control of immunohistochemical staining. CL, Corpus luteum; A, follicular antrum. Bar = 50 µm

Immunohistochemical Localization of Thy-1, Fas, and FasL

To test the possibility that luteal vascular regression was due to PRL withdrawal, immunohistochemical staining of Thy-1 differentiation protein was performed. Specific immunostaining of Thy-1 differentiation protein was evident in luteal cells and pericytes (Fig. 1, c and d). Numerous Thy-1-positive vascular pericytes were seen along the luteal microvasculature in the P4 group (Fig. 1c), whereas in PB group, only rare Thy-1-positive pericytes were present, and Thy-1-positive granules on the surface of the steroidogenic luteal cells were also lost (Fig. 1d).

Immunohistochemistry disclosed that Fas immunoreactivity was present in the CL in both groups and was located mainly on the steroidogenic luteal cells (Fig. 1, e and f). In the PB group, Fas staining was more intense, and the unstained spaces consisted mainly of disintegrated luteal vasculature filled with apoptotic nuclei and lymphocytes. In contrast, FasL staining was less intense in the PB group (Fig. 1, g and h). In addition to luteal cells, small lymphocytes and vascular elements were lightly stained, and these FasL-positive elements filled the disintegrated luteal vasculature, leaving fewer spaces in the regressed CL.

Western Blot Analysis of Thy-1, Fas, and FasL

Western blotting was used to examine the expression of Thy-1, Fas, and FasL. Monoclonal antibody G247-4 recognizes the membrane-bound and soluble forms of FasL. In this study, FasL migrated as a doublet of 40 and 42 kDa (Fig. 2). Image analysis was used to measure semiquantitative changes in levels of these proteins after bromocriptine treatment, and these levels were summarized as the mean ratio of the optical density of the specific bands normalized to their respective {alpha}-tubulin bands (Fig. 3). Thy-1 differentiation protein and FasL were present at higher levels in the control P4 group than in the PB group. After PRL withdrawal, decreased expression of Thy-1 differentiation protein coincided with the reduced numbers of Thy-1-positive vascular pericytes seen in the immunohistochemical study. In contrast, Fas expression was increased in the PB group to a level similar to that in the D4 proestrous animals. FasL expression was increased in the P4 group and decreased in the PB group.



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 2. Western blotting of luteal Thy-1, Fas, and FasL in the CL of hamsters at proestrus (D4) or of pregnant Day 4 hamsters treated with vehicle (P4 group) or bromocriptine (PB group)



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 3. Thy-1, Fas, and FasL expression in the CL of proestrous animals (D4) and pregnant Day 4 hamsters treated with vehicle (P4 group) or bromocriptine (PB group). Summarized data are mean ratio of the optical density of the specific bands normalized to its {alpha}-tubulin respectively. Data reflect 8 measurements from 4 hamsters in the D4 group, 8 hamsters in the P4 group, and 8 hamsters in the PB group. PB vs. P4, **P < 0.01 and *P < 0.05

Real-Time Quantitative Reverse Transcription-Polymerase Chain Reaction for Fas and FasL mRNA

Luteal Fas and FasL mRNA levels in both groups, measured by a real-time quantitative reverse transcription-polymerase chain reaction assay and normalized to the corresponding GAPDH mRNA levels, are shown in Figure 4a. In the PB group, expression of Fas mRNA was significantly increased (P < 0.05), whereas that of FasL mRNA was decreased (P < 0.05). Representative data are shown in Figure 4b.



View larger version (34K):
[in this window]
[in a new window]
  		FIG. 4. Luteal Fas and FasL mRNA expression after PRL withdrawal. a) Levels of luteal Fas and FasL mRNA in the CL of pregnant Day 4 animals treated with vehicle (P4 group) or bromocriptine (PB group) normalized to those for GAPDH mRNA. Data are from 6 hamsters each for the P4 and PB groups. PB vs. P4, *P < 0.05. b) Representative RT-PCR data are shown for the D4 group, P4 group, and PB group. Lane S contains DNA molecular markers


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The luteotropic effects of PRL in maintaining early pregnancy in hamsters were investigated in the present study. Blockade of pituitary PRL by bromocriptine treatment for 4 consecutive days resulted in luteal regression. PRL withdrawal caused not only functional luteolysis, as evidenced by low serum progesterone levels, but also structural luteolysis, as indicated by apoptosis of luteal cells. In situ 3' end-labeling of fragmented DNA showed that apoptotic cells accumulated in and along the disintegrated luteal vessels. The disappearance of Thy-1-positive vascular pericytes suggested that proliferation of luteal vasculature was hindered by PRL withdrawal. The present study has also provided evidence that Thy-1 differentiation protein and Thy-1-positive vascular pericytes are essential for the development and maturation of CL [5, 9] and has further demonstrated that presence of Thy-1-positive vascular pericytes and luteal vascularization are influenced by PRL withdrawal during early pregnancy in hamsters.

Endothelial cells are located at the interface of the blood and tissues, and they guard and control the entry of blood inflammatory cells and mediators into the underlying tissue [26, 27]. Vascular endothelial cells expressed FasL and inhibited infiltration of Fas-bearing leukocytes by inducing apoptosis of invading immune cells [28]. Tumor necrosis factor {alpha} (TNF{alpha})-induced macrophage infiltration is also inhibited by preinfection of the endothelium with a replication-defective adenovirus that constitutively expresses FasL [29]. Progesterone receptor-expressing bovine luteal endothelial cells are protected from TNF{alpha}-induced apoptosis [29]. Progesterone prevents the onset of apoptosis in luteal endothelial cells. Direct evidence for this came from the in vitro culture of bovine luteal endothelial cells with physiologic levels of progesterone [30]. Thus, the decline in serum progesterone levels must be a detrimental causative factor for the initiation of apoptosis in luteal endothelial cells and CL regression. In the current study, increased levels of Fas and apoptosis were tightly associated with low serum progesterone levels and hence the luteolysis caused by bromocriptine treatment, while the decreased levels of FasL and Thy-1 in the CL of bromocriptine-treated hamsters further indicated that improper luteal vascularization and immune cell infiltration were highly associated with low serum progesterone levels. However, further experiments are required to determine how Thy-1 and FasL are regulated by progesterone during the development and degeneration of luteal endothelial cells.

Up-regulation of FasL was observed in a different profile of PRL effects as seen in the preovulatory PRL surge causing structural luteolysis [21]. Fas and FasL interaction is responsible for the initiation of apoptosis in PRL-induced structural luteolysis during proestrus [20, 22]. In cultured luteal cell prepared from either proestrous or mid-pseudopregnant rats, exogenous progesterone significantly decreases the expression of Fas, but not that of FasL, whereas FasL expression is enhanced by PRL [20, 22]. The increase in luteal FasL is associated with infiltration of FasL-positive immune cells (CD3 cells) into the nonfunctioning CL, which is no longer producing progesterone [20–22]. In pregnant rats, ovarian FasL is expressed throughout pregnancy; its levels decrease at postpartum Day 3 when structural luteolysis starts [22]. Although obtained from different physiologic states, our data are in accord with those from studies in nonpregnant animals showing that Fas is located in steroidogenic luteal cells, that a high incidence of apoptosis results from an increase in Fas during structural luteolysis, and that luteal FasL expression is decreased at low serum PRL levels [20–22]. Furthermore, numerous FasL-positive small lymphocytes accumulated in the degenerated luteal vascular spaces, implying that the barrier of luteal vessels was damaged in the bromocriptine-treated CL. Thus, a decrease in luteal FasL levels, together with an increase in luteal Fas levels, after PRL withdrawal leaves the luteal tissue more vulnerable to attacks from infiltrating immune cells (i.e., FasL-positive small lymphocytes) during bromocriptine-induced luteolysis.

In the immune system, Fas was originally identified as an apoptosis-inducing receptor [16], the Fas-FasL interaction has been demonstrated to act as an initiator in immune tolerance and clonal deletion [14], and autocrine or paracrine interactions of Fas and FasL lead to apoptosis of activated T cells and maintain T-cell tolerance [15]. On the other hand, PRL enhances the proliferative response of lymphoid cells to specific antigens, resulting in clonal expansion [31], and also reverses the antiproliferative effect of transforming growth factor ß on B cells [32]. In the present study, luteal expression of Fas and FasL was demonstrated under the regulation of PRL. However, many questions still remain unanswered, especially the local and systemic roles of FasL. An intriguing point, currently under study, is whether local luteal immune cells behave in the same way as their counterparts in the immune system during PRL withdrawal. FasL is known to contribute to the maintenance of immune privilege in the eye and testis [17, 18, 33]. Recently, FasL expression was detected in vivo by in situ hybridization in human colon tumor cells and was regarded as evidence of immune evasion [34–36]. Up-regulation of FasL is accompanied by Fas down-regulation in human breast cancer [37]. During pregnancy, luteal expression of FasL is supported by a high serum PRL concentration, while luteal Fas expression is suppressed by high serum progesterone levels. Taken as a whole, PRL modulates the presence of luteal FasL, which may in turn endow the CL as an immune-privileged tissue during early pregnancy.

The current study has demonstrated the luteotropic roles of PRL during early pregnancy in hamsters. PRL regulates serum progesterone levels and facilitates luteal vascular development by maintaining Thy-1-positive vascular pericytes. By up-regulating FasL and down-regulating Fas, PRL protects the CL from immune insult and ensures the success of pregnancy in hamsters.


   FOOTNOTES
 
First decision: 20 November 2001.

1 This work was supported in part by a grant from the National Science Council of Taiwan (NSC-89-2320-B002-116). Back

2 Correspondence: Joyce C. Chen, Department of Physiology, College of Medicine, National Taiwan University, No. 1 Sec. 1, Jen-Ai Rd., Taipei, Taiwan. FAX: 886 2 2396 4350; joyce{at}ntcn.edu.tw Back

3 Deceased Back

Accepted: January 22, 2002.

Received: November 5, 2001.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Greenwald GS. Endocrinology of the pregnant hamster. In: Siegel HI (ed.), The Hamster. New York: Plenum Press; 1985
  2. Greenwald GS. Luteotropic complex of the hamster. Endocrinology 1967; 80:118-130[Medline]
  3. Ford JJ, Yoshinaga K. Ergocriptine and pregnancy maintenance in hamsters. Proc Soc Exp Biol Med 1975; 150:425-427[Abstract]
  4. Christenson LK, Stouffer RL. Proliferation of microvascular endothelial cells in the primate corpus luteum during the menstrual cycle and simulated early pregnancy. Endocrinology 1996; 137:367-374[Abstract]
  5. Reynolds LP, Killilea SD, Redmer DA. Angiogenesis in the female reproductive system. FASEB J 1992; 6:886-892[Abstract]
  6. Augustin HG, Braun K, Telemenakis I, Modlich U, Kuhn W. Ovarian angiogenesis: phenotypic characterization of endothelial cells in a physiological model of blood vessel growth and regression. Am J Pathol 1995; 147:339-351[Abstract]
  7. Meyer GT, Bruce NW. Quantitative cell changes and vascularisation in the early corpus luteum of the pregnant rat. Anat Rec 1980; 197::369-374[CrossRef][Medline]
  8. Reynolds LP, Grazul-Bilska AT, Redmer DA. Angiogenesis in the corpus luteum. Endocr J 2000; 12:1-9
  9. Diaz-Flores L, Gutierrez R, Varela H. Behavior of postcapillary venule pericytes during postnatal angiogenesis. J Morphol 1992; 213::33-45[CrossRef][Medline]
  10. Bukovsky A, Caudle MR, Keenan JA, Wimalasena J, Upadhyaya NB, Van Meter SE. Is corpus luteum regression an immune-mediated event? Localization of immune system components and luteinizing hormone receptor in human corpora lutea. Biol Reprod 1995; 53::1373-1384[Abstract]
  11. Sridaran R, Hisheh S, Dharmarajan AM. Induction of apoptosis by a gonadotropin-releasing hormone agonist during early pregnancy in the rat. Apoptosis 1998; 3:51-57
  12. Matsuyama S, Chang KT, Kanuka H, Ohnishi M, Ikeda A, Nishihara M, Takahashi M. Occurrence of deoxyribonucleic acid fragmentation during prolactin-induced structural luteolysis in cycling rats. Biol Reprod 1996; 54:1245-1251[Abstract]
  13. McCormack JT, Friederichs MG, Limback SD, Greenwald GS. Apoptosis during spontaneous luteolysis in the cyclic golden hamster: biochemical and morphological evidence. Biol Reprod 1998; 58:255-260[Abstract/Free Full Text]
  14. Yonehara S, Nishimura Y, Kishil S, Yonehara M, Takazawa K, Tamatani T, Ishii A. Involvement of apoptosis antigen Fas in clonal deletion of human thymocytes. Int Immunol 1994; 6:1849-1856[Abstract/Free Full Text]
  15. Ju ST, Panka DJ, Cui H, Ettinger R, el-Khatib M, Sherr DH, Stanger BZ, Marshak-Rothstein A. Fas(CD95)/FasL interactions required for programmed cell death after T-cell activation. Nature 1995; 373:444-448[CrossRef][Medline]
  16. Nagata S, Golstein P. The Fas death factor. Science 1995; 267:1449-1456[Abstract/Free Full Text]
  17. Bellgrau D, Gold D, Selawry H, Moore J, Franzusoff A, Duke RC. A role for CD95 ligand in preventing graft rejection. Nature 1995; 377:630-632[CrossRef][Medline]
  18. Griffith TS, Brunner T, Fletcher SM, Green DR, Ferguson TA. Fas ligand-induced apoptosis as a mechanism of immune privilege. Science 1995; 270:1189-1192[Abstract/Free Full Text]
  19. Hakuno N, Koji T, Yano T, Kobayashi N, Tsutsumi O, Taketani Y, Nakane PK. Fas/APO-1/CD95 system as a mediator of granulosa cell apoptosis in ovarian follicle atresia. Endocrinology 1996; 137:1938-1948[Abstract]
  20. Kuranaga E, Kanuka H, Furuhata Y, Yonezawa T, Suzuki M, Nishihara M, Takahashi M. Requirement of the Fas ligand-expressing luteal immune cells for regression of corpus luteum. FEBS Lett 2000; 472::137-142[CrossRef][Medline]
  21. Kuranaga E, Kanuka H, Bannai M, Suzuki M, Nishihara M, Takahashi M. Fas/Fas ligand system in prolactin-induced apoptosis in rat corpus luteum: possible role of luteal immune cells. Biochem Biophys Res Commun 1999; 260:167-173[CrossRef][Medline]
  22. Kuranaga E, Kanuka H, Hirabayashi K, Suzuki M, Nishihara M, Takahashi M. Progesterone is a cell death suppressor that downregulates Fas expression in rat corpus luteum. FEBS Lett 2000; 466:279-282[CrossRef][Medline]
  23. Roughton SA, Lareu RR, Bittles AH, Dharmarajan AM. Fas and Fas ligand messenger ribonucleic acid and protein expression in the rat corpus luteum during apoptosis-mediated luteolysis. Biol Reprod 1999; 60:797-804[Abstract/Free Full Text]
  24. O'Connell J, O'Sullivan GC, Collins JK, Shanahan F. The Fas counterattack: Fas-mediated T cell killing by colon cancer cells expressing Fas ligand. J Exp Med 1996; 184:1075-1082[Abstract/Free Full Text]
  25. Takahashi T, Tanaka M, Inazawa J, Abe T, Suda T, Nagata S. Human Fas ligand: gene structure, chromosomal location and species specificity. Int Immunol 1994; 6:1567-1574[Abstract/Free Full Text]
  26. Springer TA. Traffic signals on endothelium for lymphocyte recirculation and leukocyte emigration. Annu Rev Physiol 1995; 57:827-872[CrossRef][Medline]
  27. Muller WA, Randolph GJ. Migration of leukocytes across endothelium and beyond: molecules involved in the transmigration and fate of monocytes. J Leukoc Biol 1999; 66:698-704[Abstract]
  28. Walsh K, Sata M. Is extravasation a Fas-regulated process?. Mol Med Today 1999; 5:61-67[CrossRef][Medline]
  29. Friedman A, Weiss S, Levy N, Meidan R. Role of tumor necrosis factor alpha and its type I receptor in luteal regression: induction of programmed cell death in bovine corpus luteum-derived endothelial cells. Biol Reprod 2000; 63:1905-1912[Abstract/Free Full Text]
  30. Rueda BR, Hendry IR, Hendry IW, Stormshak F, Slayden OD, Davis JS. Decreased progesterone levels and progesterone receptor antagonists promote apoptotic cell death in bovine luteal cells. Biol Reprod 2000; 62:269-276[Abstract/Free Full Text]
  31. Murphy WJ, Durum SK, Longo DL. Differential effects of growth hormone and prolactin on murine T cell development and function. J Exp Med 1993; 178:231-236[Abstract/Free Full Text]
  32. Richards SM, Garman RD, Keyes L, Kavanagh B, McPherson JM. Prolactin is an antagonist of TGF-beta activity and promotes proliferation of murine B cell hybridomas. Cell Immunol 1998; 184:85-91[CrossRef][Medline]
  33. French LE, Hahne M, Viard I, Radlgruber G, Zanone R, Becker K, Muller C, Tschopp J. Fas and Fas ligand in embryos and adult mice: ligand expression in several immune-privileged tissues and coexpression in adult tissues characterized by apoptotic cell turnover. J Cell Biol 1996; 133:335-343[Abstract/Free Full Text]
  34. O'Connell J, Bennett MW, O'Sullivan GC, Roche D, Kelly J, Collins JK, Shanahan F. Fas ligand expression in primary colon adenocarcinomas: evidence that the Fas counterattack is a prevalent mechanism of immune evasion in human colon cancer. J Pathol 1998; 186:240-246[CrossRef][Medline]
  35. Bennett MW, O'Connell J, Houston A, Kelly J, O'Sullivan GC, Collins JK, Shanahan F. Fas ligand upregulation is an early event in colonic carcinogenesis. J Clin Pathol 2001; 54:598-604[Abstract/Free Full Text]
  36. O'Connell J, Houston A, Bennett MW, O'Sullivan GC, Shanahan F. Immune privilege or inflammation? Insights into the Fas ligand enigma. Nat Med 2001; 7:271-274[CrossRef][Medline]
  37. Mottolese M, Buglioni S, Bracalenti C, Cardarelli MA, Ciabocco L, Giannarelli D, Botti C, Natali PG, Concetti A, Venanzi FM. Prognostic relevance of altered Fas (CD95)-system in human breast cancer. Int J Cancer 2000; 89:127-132[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, J. C.
Right arrow Articles by Chen, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, J. C.
Right arrow Articles by Chen, T. J.
Agricola
Right arrow Articles by Chen, J. C.
Right arrow Articles by Chen, T. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS