Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print October 4, 2002.
Biol Reprod 2002, 10.1095/biolreprod.102.005488
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
67/6/1708    most recent
biolreprod.102.005488v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thompson, A.
Right arrow Articles by Yang, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thompson, A.
Right arrow Articles by Yang, K.
Agricola
Right arrow Articles by Thompson, A.
Right arrow Articles by Yang, K.
Biology of Reproduction 67, 1708-1718 (2002)
DOI: 10.1095/biolreprod.102.005488 © 2002 Society for the Study of Reproduction, Inc.

Pregnancy

Spatial and Temporal Patterns of Expression of 11ß-Hydroxysteroid Dehydrogenase Types 1 and 2 Messenger RNA and Glucocorticoid Receptor Protein in the Murine Placenta and Uterus During Late Pregnancy1

A. Thompsona,b, V.K.M. Hana,c,d,e, and K. Yang2,a,b

a Departments of Obstetrics and Gynaecology, b Physiology, c Pediatrics, d Biochemistry, e Anatomy and Cell Biology, CIHR Group in Fetal and Neonatal Health and Development, Child Health Research Institute, and Lawson Health Research Institute, University of Western Ontario, London, Ontario, Canada N6A 4V2


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To gain insight into the role of 11ß-hydroxysteroid dehydrogenase (11ß-HSD) enzymes and actions of glucocorticoids in the murine placenta and uterus, the expression pattern of the mRNA for 11ß-HSD1 and 11ß-HSD2 and the glucocorticoid receptor (GR) protein were determined from Embryonic Day 12.5 (E12.5, term = E19) to E18.5 by in situ hybridization and immunohistochemistry, respectively. Consistent with its putative role in regulating the transplacental passage of maternal glucocorticoid to the fetus, 11ß-HSD2 mRNA was highly expressed in the labyrinthine zone (the major site of maternal/fetal exchange) at E12.5, and its level decreased dramatically at E16.5, when it became barely detectable. Remarkably, the silencing of 11ß-HSD2 gene expression coincided with the onset of 11ß-HSD1 gene expression in the labyrinth at E16.5 when moderate levels of 11ß-HSD1 mRNA were detected and maintained to E18.5. By contrast, neither 11ß-HSD1 mRNA nor 11ß-HSD2 mRNA were detected in any cell types within the basal zone from E12.5 to E18.5. Moreover, the expression of 11ß-HSD1 and 11ß-HSD2 in the decidua exhibited a high degree of cell specificity in that the mRNA for both 11ß-HSD1 and 11ß-HSD2 was detected in the decidua-stroma but not in the compact decidua. A distinct pattern was also observed within the endometrium where the mRNA for 11ß-HSD1 was expressed in the epithelium, whereas that for 11ß-HSD2 was confined strictly to the stroma. By comparison, the expression of GR in the placenta and uterus was ubiquitous and unremarkable throughout late pregnancy. In conclusion, the present study demonstrates for the first time remarkable spatial and temporal patterns of expression of 11ß-HSD1 and 11ß-HSD2 and GR in the murine placenta and uterus and highlights the intricate control of not only transplacental passage of maternal glucocorticoid to the fetus but also local glucocorticoid action during late pregnancy.

glucocorticoid receptor, mechanisms of hormone action, placenta, pregnancy


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In target tissues, the actions of glucocorticoids are critically regulated by the intracellular enzyme 11ß-hydroxysteroid dehydrogenase (11ß-HSD), which catalyzes the interconversion of active glucocorticoids (cortisol and corticosterone) and their inactive metabolites (cortisone and 11-dehydrocorticosterone) [1, 2]. To date, two distinct isozymes of 11ß-HSD have been identified and characterized. Although it possesses bidirectional activities, 11ß-HSD1 is thought to function predominantly as a reductase in vivo, thereby increasing local active glucocorticoid levels in target tissues [3, 4]. The expression of 11ß-HSD1 is widespread, with liver being the major site [5, 6]. By contrast, 11ß-HSD2 catalyzes the unidirectional inactivation of glucocorticoids, and its expression is restricted to mineralocorticoid target tissues and the placenta [7].

In the placenta, 11ß-HSD activity is thought to regulate the transplacental passage of maternal glucocorticoid to the fetus [8], a strategic role given both excessive [9–11] and inadequate glucocorticoid exposure in utero are detrimental to fetal development. It has also been proposed that placental 11ß-HSD may be an important determinant of local glucocorticoid action within the placenta by regulating the access of glucocorticoids to their intracellular receptors [12]. Both 11ß-HSD1 and 11ß-HSD2 are expressed in the rat placenta in a zonal-specific and developmentally programmed manner during late pregnancy [13, 14]. In the mouse placenta, the expression of 11ß-HSD2 mRNA has been examined and was found to be exclusively in the labyrinthine zone [15], the major site of maternal-fetal exchange, which is consistent with its putative role in fetal development. However, the relative expression of 11ß-HSD1 mRNA has never been determined. Furthermore, it is unknown if the glucocorticoid receptor (GR) is coexpressed with 11ß-HSD1 and/or 11ß-HSD2 in the mouse placenta, a potentially important question in view of its proposed role in regulating local glucocorticoid action.

Given the putative role of placental 11ß-HSD in the control of not only transplacental passage of maternal glucocorticoid to the fetus but also local glucocorticoid action [12], coupled with the tremendous utility of the mouse model in unraveling the precise role of 11ß-HSD1 and 11ß-HSD2 in normal physiology [16, 17] and disease processes [18], information about the relative localization of these enzymes in the mouse placenta is essential for our complete understanding of the distinct roles they may play during fetal development. Therefore, the objectives of the current study were to determine and contrast the cellular localization of 11ß-HSD1 and 11ß-HSD2 mRNA by in situ hybridization in the mouse placenta and uterus from Embryonic Day 12.5 (E12.5) to E18.5. In parallel, we also utilized immunohistochemistry to examine the distribution of GR protein over the same gestational period in order to gain insight into the intricate relationship between 11ß-HSD enzymes and GR in the control of glucocorticoid action within the murine placenta and uterus.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Animals and Materials

Pregnant BALB/c mice from Day 5 of gestation were housed under standard conditions and provided with food and water ad libitum. Animals were killed by cervical dislocation as approved by the Animal Care Committee of the University of Western Ontario. Placentae were collected at E12.5, E14.5, E16.5, and E18.5. A total of 4–5 mice per gestational age and 4–6 placentae per mouse were studied/analyzed. Unless stated otherwise, restriction enzymes and other molecular biological reagents were obtained from Gibco BRL (Burlington, ON, Canada) or Pharmacia Canada, Inc. (Baie d'Urfe, PQ, Canada). All solvents used were OmniSolve grade from BDH, Inc. (Toronto, ON, Canada). All other chemicals were purchased from Sigma-Aldrich Canada Limited (Oakville, ON, Canada). Slides and other histology supplies were from Fisher Scientific, Ltd. (Unionville, ON, Canada). Oligonucleotides were synthesized using a Pharmacia Gene Assembler and purified using NAP-50 columns (Pharmacia) according to the manufacturer's instructions.

Immunohistochemistry

Placentae were fixed by immersion with 4% (w/v) paraformaldehyde in 70 mM phosphate buffer, pH 7.0, at 4°C for 24 h. They were then embedded in paraffin, and 5 µm sections were prepared by standard methods and mounted onto superfrost slides. After deparaffinization and rehydration, tissues sections were incubated sequentially in 1% (v/v) hydrogen peroxide for 10 min to quench endogenous peroxidase activity and then in 10% (v/v) normal swine serum for 30 min. Tissue sections were incubated in rabbit anti-GR antiserum (1:300; Santa Cruz Biotech, Inc., Santa Cruz, CA) at 4°C overnight. Sections were immunostained using an avidin-biotin-peroxidase method (LSAB plus-kit; DAKO Corporation, Carpinteria, CA), with 3,3-diaminobenzidine as the chromogen. Slides were counterstained with methyl green (DAKO) and mounted with Permount.

Generation of Mouse 11ß-HSD1 and 11ß-HSD2 cDNAs

The mouse 11ß-HSD1 and 11ß-HSD2 cDNAs were generated by a standard RT-PCR protocol using adult mouse kidney total RNA as the template. The two primers used for generating 11ß-HSD1 cDNA were two oligonucleotides corresponding to nucleotides 40 to 57 (5'-GG GGATCCTGTTTGATGGCAGTTATG) and 948 to 956 (5'-GG TCTAGAAGGGGCTCAGGAGTTCCTA) of the published mouse 11ß-HSD1 cDNA [19] and containing BamHI and XbaI (underlined), respectively. The two primers used for generating 11ß-HSD2 cDNA were two oligonucleotides corresponding to nucleotides 597 to 616 (5'-GG GGATCC GGAAGTGCATGGAGGTGAAC) and 1139 to 1162 (5'-GG TCTAGATCGGGGCAGAAGGTGATTGATAAA) of the published mouse 11ß-HSD2 cDNA [20] and containing BamHI and XbaI (underlined), respectively. The RT-PCR products were cloned into pBluescript KS. For both 11ß-HSD1 and 11ß-HSD2 cDNA clones, double-stranded DNA was prepared and sequenced by a standard automated sequencing protocol at the John P. Robarts Research Institute DNA Sequencing Facility (London, ON, Canada).

In Situ Hybridization

Sense and antisense mouse 11ß-HSD1 and 11ß-HSD2 riboprobes were labeled with [35S]UTP (Du Pont Canada, Inc.; Markham, ON, Canada) by in vitro transcription from the 900-base pair (bp) and 580-bp mouse 11ß-HSD1 and 11ß-HSD2 cDNA, respectively, in pBluescript KS+ (described above) using commercially available reagents (Promega Riboprobe Gemini II system; Promega, Madison, WI). Although 11ß-HSD1 riboprobes of 150–200 bp were obtained by limited alkaline hydrolysis in 0.2 M bicarbonate buffer, pH 10.2 at 60°C for 51 min, 11ß-HSD2 riboprobes were not subjected to alkaline lysis because of their short length.

In situ hybridization was performed as previously described [21]. Briefly, tissue sections were treated sequentially in PBS containing 0.2% (v/v) Triton-X100 at room temperature for 1 h; 0.2 units proteinase-K/ml in 100 mM Tris-HCl (pH 8.0), and 50 mM EDTA at 37°C for 30 min; and 0.1 M triethanolamine containing 25 mM acetic anhydride at room temperature for 10 min. They were then dehydrated through ascending ethanols (70%–100%) and air dried. Sections were prehybridized in a hybridization buffer containing 50% (v/v) formamide, 0.3M NaCl, 20 mM Tris-HCl, pH 8.0, 1 mM EDTA, 1x Denhardt solution, 500 µg/ml yeast transfer RNA, 100 µg/ml salmon sperm DNA (Loftstrand Labs, Gaithersburg, MD), 0.1% (w/v) SDS, and 100 mM DTT in a humidified chamber at 45°C for 2 h. Sections were then hybridized with the same hybridization buffer, except this also included 10% (w/v) dextran sulphate at 55°C overnight. The solution containing the riboprobes was removed and sections were incubated for an additional 10 min in prehybridization buffer at 55°C, followed by incubation in 40 µg RNase-A/ml 10 mM Tris-HCl, pH 8.0, 0.5 M NaCl, and 1 mM EDTA at 37°C for 30 min. Slides were then taken through the following series of washes: three washes at 10 min each in 2x SSC (1x = 0.15 m NaCl and 0.015 M sodium citrate) at room temperature, four 15 minute washes in 2x SSC at 55°C, and two washes in 0.1x SSC at 55°C for 10 min each. Sections were then dehydrated in ascending ethanols (70%–100%), air dried, and exposed to XAR5 film (Eastman Kodak, Rochester, NY) overnight to determine the intensity of the signal. They were coated with NTB3 photoemulsion (Kodak) and exposed at 4°C in light-tight boxes for 1–2 weeks. Slides were developed in D19 developer (Kodak), fixed in Kodafix (Kodak), stained with Harris hematoxylin and eosin, dehydrated, and mounted with Permount.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Chorioallantoic Placenta

The chorioallantoic placenta consists of two distinct zones: the labyrinthine zone, the major site of maternal-fetal exchange, and the basal zone, the primary site of placental steroid and peptide hormone synthesis. The mRNA for 11ß-HSD1 was absent from the labyrinthine zone until E16.5 when moderate levels were detected and maintained to E18.5 (Table 1; Fig. 1). By contrast, the mRNA for 11ß-HSD2 was abundantly expressed in the labyrinthine zone at E12.5, at particularly high levels in the trophoblast cells surrounding the maternal blood vessels (Table 2; Fig. 1). The level of 11ß-HSD2 mRNA in the labyrinth decreased dramatically at E16.5, when the mRNA became barely detectable, and was completely absent at E18.5 (Table 2; Fig. 1). Strong and relatively unchanged immunoreactive GR was observed in the labyrinthine zone from E12.5 to E18.5 (Table 3; Fig. 1).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Distribution of 11ß-HSD1 mRNA in the mouse placenta and uterus at E12.5, E14.5, E16.5, and E18.5.a



View larger version (140K):
[in this window]
[in a new window]
  		FIG. 1. Localization of 11ß-HSD1 and 11ß-HSD2 mRNA and GR immunoreactivity in the mouse placenta at E12.5 and E16.5. A–D) Dark field photomicrographs of in situ hybridization of mouse placenta to show localization of mRNA (white dots) for 11ß-HSD1 and 11ß-HSD2. E and F) Bright field photomicrographs of immunohistochemistry to show localization of GR protein (brown staining). A) At E12.5, 11ß-HSD1 mRNA is absent from both the labyrinthine trophoblast and spongiotrophoblast. B) At E16.5, 11ß-HSD1 mRNA is expressed only in the labyrinthine trophoblast. C) At E12.5, 11ß-HSD2 mRNA is highly expressed only in the labyrinthine trophoblast. D) At E16.5, 11ß-HSD2 mRNA is barely detectable in the labyrinthine layer except for isolated cells of unknown identity. E and F) GR immunoreactivity is localized in both the labyrinthine trophoblast and spongiotrophoblast at both E12.5 and E16.5, indicating that unlike 11ß-HSD1 and 11ß-HSD2 mRNA, GR immunoreactivity is unchanged with gestation. LAB, Labyrinthine layer; ST, spongiotrophoblast layer; MV, maternal blood vessels. Arrows = positive signals for in situ hybridization and immunohistochemistry. Original magnification x20


View this table:
[in this window]
[in a new window]
  		TABLE 2. Distribution of 11ß-HSD2 mRNA in the mouse placenta and uterus at E12.5, E14.5, E16.5, and E18.5.a


View this table:
[in this window]
[in a new window]
  		TABLE 3. Distribution of GR immunoreactivity in the mouse placenta and uterus at E12.5, E14.5, E16.5, and E18.5.a

Remarkably, both 11ß-HSD1 mRNA and 11ß-HSD2 mRNA were undetectable in any of the cell types within the basal zone of the chorioallantoic placenta, including the spongiotrophoblast, giant, and glycogen cells at all the gestational ages studied (Tables 1 and 2; Fig. 1). However, GR protein was expressed at increasing levels in the spongiotrophoblast and giant cells, but not in the glycogen cells, from E12.5 to E18.5 (Table 3; Fig. 1).

Yolk Sac Placenta

The yolk sac placenta is composed of parietal yolk sac and visceral yolk sac, the second site for maternal-fetal exchange. The mRNA for 11ß-HSD1 remained undetectable in all the cell types of the yolk sac placenta throughout late gestation (Table 1). However, relatively low but detectable levels of 11ß-HSD2 mRNA were expressed only in the yolk sac stroma, but not in the yolk epithelium and parietal yolk sac endoderm from E12.5 to E14.5 (Table 2). From E16.5 to E18.5, 11ß-HSD2 mRNA ceased to be expressed in the yolk sac stroma and remained absent from all the cell types within the yolk sac placenta (Table 2). By contrast, strong and relatively constant immunoreactive GR was detected in all the cell types but the fetal mesenchyme of the yolk sac placenta from E12.5 to E18.5 (Table 3).

Maternal Tissues

The decidua, endometrium, and myometrium are the three principle intrauterine maternal tissues. The mRNA for 11ß-HSD1 was highly expressed in the decidua-stroma both above and below the compact decidua from E12.5 to E18.5 (Table 1; Fig. 2). Although high levels of 11ß-HSD2 mRNA were also detected in the decidua-stroma throughout late gestation, they were confined to the region below but not that above the compact decidua (Table 2; Fig. 2). The mRNA for both 11ß-HSD1 and 11ß-HSD2 was undetectable in the compact decidua at all the gestational ages studied. Similar to 11ß-HSD1, intense immunoreactive GR was localized to the decidua-stroma both above and below the compact decidua where it was absent from E12.5 to E18.5 (Table 3; Fig. 2).



View larger version (125K):
[in this window]
[in a new window]
  		FIG. 2. Localization of 11ß-HSD1 and 11ß-HSD2 mRNA and GR immunoreactivity in the mouse decidua at E12.5 and E16.5. A–D) are dark field photomicrographs of in situ hybridization to show localization of mRNA (white dots) for 11ß-HSD1 and 11ß-HSD2, and E and F are bright field photomicrographs of immunohistochemistry to show localization of GR protein (brown staining). A) At E12.5, 11ß-HSD1 mRNA is expressed moderately in the decidua-stroma both above and below the compact deciduas where it is absent. B) At E16.5, the pattern of 11ß-HSD1 mRNA expression in the decidua remains the same but at an increased level when compared with E12.5. C) At E12.5, 11ß-HSD2 mRNA is localized to a population of decidual cells below the compact decidua but not above. D) At E16.5, the pattern of 11ß-HSD2 mRNA in the decidua remains the same but in a greater number of cells when compared with E12.5. E and F) At E12.5 and E16.5, GR immunoreactivity is localized in the decidua-stroma both above and below the compact decidua, but is absent from the compact decidua. DS, Decidua-stroma; CD, compact decidua; MYO, myometrium; MV, maternal blood vessels. Arrows = positive signals for in situ hybridization and immunohistochemistry. Original magnification x20

Within the endometrium, the expression of mRNA for 11ß-HSD1 and 11ß-HSD2 was highly cell-specific in that particularly high levels of 11ß-HSD1 mRNA were expressed only in the epithelium (Table 1; Figs. 3 and 4), whereas those of 11ß-HSD2 mRNA were strictly confined to the stroma (Table 2; Figs. 3 and 4). This pattern of expression for both 11ß-HSD1 mRNA and 11ß-HSD2 mRNA was maintained throughout late gestation (Tables 1 and 2). The expression of GR protein followed the same pattern to that of 11ß-HSD1 mRNA; intense immunoreactive GR was detected in the endometrial epithelium but not in the endometrial stroma (Table 3; Fig. 3).



View larger version (117K):
[in this window]
[in a new window]
  		FIG. 3. Localization of 11ß-HSD1 and 11ß-HSD2 mRNA and GR immunoreactivity in the mouse uterus at E12.5 and E16.5. A–D) Dark field photomicrographs of in situ hybridization to show localization of mRNA (white dots) for 11ß-HSD1 and 11ß-HSD2, and E and F are bright field photomicrographs of immunohistochemistry to show localization of GR protein (brown staining). A) At E12.5, 11ß-HSD1 mRNA is highly expressed in the endometrial epithelium but not in the endometrial stroma. B) At E16.5, the pattern of 11ß-HSD1 mRNA in the endometrium remains the same with no detectable mRNA in the myometrium. C) At E12.5, 11ß-HSD2 mRNA is expressed at high abundance in the endometrial stroma but not in the endometrial epithelium. D) At E16.5, the pattern of 11ß-HSD2 mRNA in the endometrium remains the same with high levels of the mRNA also in the myometrium. E and F) At E12.5 and E16.5, GR immunoreactivity is localized in both endometrium (primarily in the epithelium) and myometrium. EE, Endometrial epithelium; ES, endometrial stroma; MYO, myometrium; DS, decidua-stroma; CD, compact decidua. Arrows indicate positive signals for in situ hybridization and immunohistochemistry. Original magnification x20



View larger version (136K):
[in this window]
[in a new window]
  		FIG. 4. Bright field photomicrographs of in situ hybridization to show cell-specific localization of mRNA (black dots) for 11ß-HSD1 (A and C) and 11ß-HSD2 (B and D–F) in the mouse placenta and uterus. A) 11ß-HSD1 mRNA is absent in the yolk sac. B) 11ß-HSD2 mRNA is detectable in the yolk sac stroma but not in the yolk sac epithelium. C) 11ß-HSD1 mRNA is highly expressed in the endometrial epithelium but not in the endometrial stroma. D) 11ß-HSD2 mRNA is highly expressed in the endometrial stroma but not in the endometrial epithelium. E) 11ß-HSD2 mRNA is highly expressed in the labyrinthine trophoblast. F) 11ß-HSD2 mRNA is specifically expressed in the decidua-metrial gland epithelium. YSS, Yolk sac stroma; YSE, yolk sac epithelium; EE, endometrial epithelium; ES, endometrial stroma; DS, decidua-stroma; DMG, decidua-metrial gland. Arrows = positive signals for in situ hybridization. Panels A–E are from E12.5 and F is from E16.5. Original magnification x100

The mRNA for 11ß-HSD1 was absent from the myometrium at all the gestational ages studied (Table 1; Fig. 3). By contrast, 11ß-HSD2 mRNA was expressed in the myometrium with apparently higher levels in the inner region from E12.5 to E18.5 (Table 2; Fig. 3). Intense immunoreactive GR was also detected in the myometrium throughout late gestation (Table 3; Fig. 3). Levels of both 11ß-HSD2 mRNA and GR protein remained relatively unchanged in the myometrium from E12.5 to E18.5 (Tables 2 and 3).

Sense 11ß-HSD1 and 11ß-HSD2 in situ hybridizations showed very low nonspecific background only (Fig. 5).



View larger version (129K):
[in this window]
[in a new window]
  		FIG. 5. Dark field photomicrographs of in situ hybridization to show antisense (A and C) and sense controls (B and D) for 11ß-HSD1 and 11ß-HSD2 mRNA in the mouse uterus at E12.5. A) The same photomicrograph as shown in Figure 3A to show specific 11ß-HSD1 antisense hybridization signals (white dots), and B is the corresponding sense control. C) The same photomicrograph as shown in Figure 3C to show specific 11ß-HSD2 antisense hybridization signals (white dots), and D is the corresponding sense control. EE, Endometrial epithelium; ES, endometrial stroma; DS, decidua-stroma; CD, compact decidua. Arrows = positive signals for in situ hybridization. Original magnification x20


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The present study demonstrates, for the first time, the spatial and temporal localization patterns of GR protein in relation to mRNA for 11ß-HSD1 and 11ß-HSD2 in the mouse placenta and uterus, highlighting the potential importance of these enzymes as regulators of local glucocorticoid action. In particular, whereas the expression of GR protein was widespread and remained relatively constant in various zones of the mouse placenta and maternal tissues during late pregnancy, expression of the mRNA for 11ß-HSD1 and 11ß-HSD2 exhibited remarkable developmental stage- and region/cell-specific, as well as isozyme-specific, changes. These remarkable changes may be indicative of the distinct regulatory roles of these enzymes in the murine placenta and uterus.

Exposure of the developing fetus to excess glucocorticoids results in intrauterine growth restriction (IUGR) [9–11] and may potentially lead to the development of diseases in adult life [22]. Conversely, during fetal life both the complete lack of glucocorticoid actions [23] and glucocorticoid deficiency [24] result in severe abnormalities of vital organ systems in the mouse. Hence the precise regulation of fetal glucocorticoid exposure is critical to normal fetal organ growth and maturation, and as such, the placental 11ß-HSD2 may play a strategic role in fetal development by regulating the transplacental passage of maternal glucocorticoid to the fetus [8]. Indeed, placental 11ß-HSD2 expression and activity are attenuated in human pregnancies complicated with IUGR [25, 26]. Moreover, IUGR is a characteristic feature of the syndrome of apparent mineralocorticoid excess in which point mutations of the 11ß-HSD2 gene render the enzyme inactive [27]. However, 11ß-HSD2 deficient mice exhibited inconclusive phenotype with respect to fetal development in that 11ß-HSD2 null pups had apparently normal birth weight, but 50% died of undetermined causes within the first 48 h after birth [17].

In the mouse placenta, the labyrinthine zone is the major site of maternal/fetal exchange [28], and as such, it represents one crucial area of our study. Consistent with its putative role in regulating the transplacental passage of maternal glucocorticoid to the fetus [8], the mRNA for 11ß-HSD2 was highly expressed, whereas that for 11ß-HSD1 was absent, between E12.5 and E14.5. Given that 11ß-HSD2 inactivates but 11ß-HSD1 reactivates glucocorticoids, the selective expression of 11ß-HSD2 in the labyrinthine layer likely serves to ensure that a maximal amount of maternal glucocorticoid is inactivated at the maternal/fetal interface during this sensitive period of fetal development. Moreover, within the labyrinthine zone, 11ß-HSD2 mRNA expression was the highest in trophoblast cells associated with the maternal blood vessels; thus 11ß-HSD2 is ideally located for its proposed role in regulating the transplacental passage of maternal glucocorticoid to the fetus. This view is also corroborated by the findings that the second site of maternal/fetal exchange in the murine placenta, the yolk sac stroma, also expressed 11ß-HSD2 mRNA from E12.5 to E14.5.

However, 11ß-HSD2 expression in both the labyrinth trophoblast and yolk sac stroma was silenced from E16.5, an intriguing observation in view of its putative role in fetal development. Although the silencing of 11ß-HSD2 mRNA in the murine placenta has been documented before [15], the present study provides further insights into the role of 11ß-HSD2 in the labyrinth and yolk sac by determining the precise cellular localization of 11ß-HSD2 mRNA in these two important sites of maternal-fetal exchange. Moreover, we have demonstrated for the first time that the 11ß-HSD1 mRNA was expressed at high levels in the labyrinth trophoblast from E16.5 to E18.5, a critical stage during murine development when the final maturation of vital fetal organs, such as the lungs, occurs [29]. It is noteworthy that the onset of 11ß-HSD1 expression in the placenta coincides well with not only the silencing of 11ß-HSD2 gene expression but also the known time course of the corticosterone surge during late gestation, which peaks at E16.5 [30]. Therefore, the remarkable co-occurrence of these events suggests that the coordinated switching from 11ß-HSD2 to 11ß-HSD1 expression in the murine placenta at E16.5 may play a permissive role in allowing for increased fetal exposure to maternal glucocorticoid, which is essential for the final critical glucocorticoid-dependent maturation of fetal organs systems [31]. Obviously, this contention requires substantiation from future studies.

Although GR binding sites in murine placental tissue homogenates were described a few decades ago [32], this is the first study demonstrating the temporal and spatial localization of GR in the murine placenta. High levels of GR protein were detected in both the labyrinth layer and yolk sac placenta, indicating that these two important sites of the murine maternal-fetal exchange are glucocorticoid target sites. Therefore, the coexpression of 11ß-HSD1 mRNA and 11ß-HSD2 mRNA with GR protein in the labyrinthine trophoblast (at distinct times during late gestation) and of 11ß-HSD2 mRNA with GR in the yolk sac stroma suggest that 11ß-HSD activity may function in an autocrine fashion to regulate local glucocorticoid-mediated placental growth and function, such as synthesis of glucose transporters [33], growth factors, and their binding proteins [34].

In marked contrast to the labyrinthine zone, the basal zone of the murine placenta did not express either 11ß-HSD1 mRNA or 11ß-HSD2 mRNA during late gestation. However, GR was abundantly expressed in the spongiotrophoblast and giant cells, but not in the glycogen cells. Given that glucocorticoids are known to regulate placental synthesis of both steroid and peptide hormones, the conspicuous absence of the two glucocorticoid metabolizing enzymes from the basal zone suggests that, contrary to other glucocorticoid target tissues, the access of glucocorticoids to GR in these endocrine cells of the murine placenta may not be subject to local regulation. Moreover, the apparent lack of GR in the glycogen cells also suggests that glucocorticoid regulation of glycogen deposition in the murine placenta may be mediated by a paracrine mechanism. Although it is similar in the labyrinthine layer, the pattern of relative expression of 11ß-HSD1 mRNA and 11ß-HSD2 mRNA is distinct in the basal zone between the mouse and rat [14, 15]. In the rat basal zone, the mRNA for both 11ß-HSD1 and 11ß-HSD2 was present with levels of the former decreasing while those of the latter increased with advancing gestational age from Day 16 to term [14]. By marked contrast, neither 11ß-HSD1 mRNA nor 11ß-HSD2 mRNA were detectable in the basal zone of the mouse placenta, as shown in the present study, suggesting that the glucocorticoid-mediated regulatory mechanisms in the basal zone have been diverged between the two closely related rodent species.

In the murine decidua and endometrium, a remarkable degree of cell-specificity in expression of the mRNA for 11ß-HSD1 and 11ß-HSD2 was observed. For example, the mRNA for both 11ß-HSD1 and 11ß-HSD2 was expressed in the decidua-stroma but not in the compact decidua. Within the endometrium, 11ß-HSD1 mRNA was expressed only in the epithelium, whereas 11ß-HSD2 mRNA was strictly confined to the stroma. Although GR was colocalized with both 11ß-HSD1 and 11ß-HSD2 in the decidua-stroma, GR was coexpressed only with 11ß-HSD1 in the endometrial epithelium. These distinct patterns of GR and 11ß-HSD coexpression suggest that local glucocorticoid action is regulated by both 11ß-HSD enzymes in the decidua, but is regulated only by 11ß-HSD1 in the endometrium. Given that glucocorticoids can affect a number of highly dynamic functions in the rodent uterus, generally in an inhibitory fashion including eosinophil infiltration [35] and stromal cell prostaglandin synthesis [36], the colocalization of GR and 11ß-HSD enzymes in the decidua and endometrium may have important implications for local glucocorticoid signaling. To our knowledge, the present study provides the first demonstration of GR cellular localization within the rodent uterus, although its presence has been predicted from previous studies of GR antagonists on uterine function in mice [37]. Furthermore, very high GR expression was observed in the myometrium at all gestational ages studied, consistent with a role for glucocorticoids in the rodent uterus. However, 11ß-HSD1 was never coexpressed with GR in this region of the uterus. In contrast, 11ß-HSD2 mRNA was present, particularly in the inner region of the myometrium where its levels increased with gestational age, suggesting a role for 11ß-HSD2 in regulating local glucocorticoid actions.

The contrasting developmental stage- and region-specific changes in 11ß-HSD1 and 11ß-HSD2 mRNA expression suggest distinct regulatory signals operating in the different zones of the mouse placenta. One potential regulator of placental 11ß-HSD is estrogen. In the baboon, experimental elevation of placental estrogen synthesis at midgestation has been shown to alter cortisol/cortisone metabolism in vivo [38] and 11ß-HSD activity in cultured baboon syncytiotrophoblasts [39], indicating that estrogen is the primary regulator of placental 11ß-HSD in the baboon. Whether estrogen has a similar regulatory role in the mouse placenta is unknown, although estrogen levels are known to increase progressively toward term in the rodent [40]. In addition, it has been demonstrated previously that progesterone decreases placental 11ß-HSD2 mRNA and activity in both the human [41] and baboon [42]. Thus it is conceivable that estrogen and progesterone may act in an autocrine/paracrine fashion to regulate the zonal-specific expression of 11ß-HSD1 and 11ß-HSD2 in the mouse placenta.

In conclusion, the present study highlights the developmentally programmed synchronization of 11ß-HSD1 and 11ß-HSD2 expression in the labyrinthine layer of mouse placenta during late gestation, which may serve to ensure the precise fetal exposure to maternal glucocorticoid and consequent normal fetal organ growth and maturation. Moreover, the cell-specific colocalization of GR with 11ß-HSD1 and 11ß-HSD2 in the murine placenta and uterus suggests that these enzymes may be important determinants of local glucocorticoid actions.


   ACKNOWLEDGMENTS
 
We are indebted to Karen Nygard for her excellent technical assistance and to Dr. Anthony Carter for his expert advice on the anatomy and histology of the mouse placenta.


   FOOTNOTES
 
1 Supported by the Canadian Institutes of Health Research. V.K.M.H. is a Canada Research Chair in Perinatal Research, and K.Y. is an Ontario Ministry of Health Career Scientist. Back

2 Correspondence: K. Yang, Lawson Health Research Institute, 268 Grosvenor Street, London, ON, Canada N6A 4V2. FAX: 519 646 6110; kyang{at}uwo.ca Back

Received: 13 March 2002.

First decision: 8 April 2002.

Accepted: 24 May 2002.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. White PC, Mune T, Agarwal AK. 11 beta-Hydroxysteroid dehydrogenase and the syndrome of apparent mineralocorticoid excess. Endocr Rev 1997 18:135-156[Abstract/Free Full Text]
  2. Stewart PM, Krozowski ZS. 11 beta-Hydroxysteroid dehydrogenase. Vitam Horm 1999 57:249-324[Medline]
  3. Low SC, Chapman KE, Edwards CR, Seckl JR. ‘Liver-type’ 11 beta-hydroxysteroid dehydrogenase cDNA encodes reductase but not dehydrogenase activity in intact mammalian COS-7 cells. J Mol Endocrinol 1994 13:167-174[Abstract/Free Full Text]
  4. Jamieson PM, Chapman KE, Edwards CR, Seckl JR. 11 beta-hydroxysteroid dehydrogenase is an exclusive 11 beta-reductase in primary cultures of rat hepatocytes: effect of physicochemical and hormonal manipulations. Endocrinology 1995 136:4754-4761[Abstract]
  5. Agarwal AK, Monder C, Eckstein B, White PC. Cloning and expression of rat cDNA encoding corticosteroid 11 beta-dehydrogenase. J Biol Chem 1989 264:18939-18943[Abstract/Free Full Text]
  6. Yang K, Smith CL, Dales D, Hammond GL, Challis JR. Cloning of an ovine 11 beta-hydroxysteroid dehydrogenase complementary deoxyribonucleic acid: tissue and temporal distribution of its messenger ribonucleic acid during fetal and neonatal development. Endocrinology 1992 131:2120-2126[Abstract/Free Full Text]
  7. Albiston AL, Obeyesekere VR, Smith RE, Krozowski ZS. Cloning and tissue distribution of the human 11 beta-hydroxysteroid dehydrogenase type 2 enzyme. Mol Cell Endocrinol 1994 105:R11-R17[CrossRef][Medline]
  8. Yang K. Placental 11 beta-hydroxysteroid dehydrogenase: barrier to maternal glucocorticoids. Rev Reprod 1997 2:129-132[Abstract]
  9. Reinisch JM, Simon NG, Karow WG, Gandelman R. Prenatal exposure to prednisone in humans and animals retards intrauterine growth. Science 1978 202:436-438[Abstract/Free Full Text]
  10. Mosier HD Jr, Dearden LC, Jansons RA, Roberts RC, Biggs CS. Disproportionate growth of organs and body weight following glucocorticoid treatment of the rat fetus. Dev Pharmacol Ther 1982 4:89-105[Medline]
  11. Novy MJ, Walsh SW. Dexamethasone and estradiol treatment in pregnant rhesus macaques: effects on gestational length, maternal plasma hormones, and fetal growth. Am J Obstet Gynecol 1983 145:920-931[Medline]
  12. Burton PJ, Waddell BJ. Dual function of 11beta-hydroxysteroid dehydrogenase in placenta: modulating placental glucocorticoid passage and local steroid action. Biol Reprod 1999 60:234-240[Abstract/Free Full Text]
  13. Burton PJ, Smith RE, Krozowski ZS, Waddell BJ. Zonal distribution of 11 beta-hydroxysteroid dehydrogenase types 1 and 2 messenger ribonucleic acid expression in the rat placenta and decidua during late pregnancy. Biol Reprod 1996 55:1023-1028[Abstract]
  14. Waddell BJ, Benediktsson R, Brown RW, Seckl JR. Tissue-specific messenger ribonucleic acid expression of 11beta-hydroxysteroid dehydrogenase types 1 and 2 and the glucocorticoid receptor within rat placenta suggests exquisite local control of glucocorticoid action. Endocrinology 1998 139:1517-1523[Abstract/Free Full Text]
  15. Brown RW, Diaz R, Robson AC, Kotelevtsev YV, Mullins JJ, Kaufman MH, Seckl JR. The ontogeny of 11 beta-hydroxysteroid dehydrogenase type 2 and mineralocorticoid receptor gene expression reveal intricate control of glucocorticoid action in development. Endocrinology 1996 137:794-797[Abstract]
  16. Kotelevtsev Y, Holmes MC, Burchell A, Houston PM, Schmoll D, Jamieson P, Best R, Brown R, Edwards CR, Seckl JR, Mullins JJ. 11beta-hydroxysteroid dehydrogenase type 1 knockout mice show attenuated glucocorticoid-inducible responses and resist hyperglycemia on obesity or stress. Proc Natl Acad Sci U S A 1997 94:14924-14929[Abstract/Free Full Text]
  17. Kotelevtsev Y, Brown RW, Fleming S, Kenyon C, Edwards CR, Seckl JR, Mullins JJ. Hypertension in mice lacking 11beta-hydroxysteroid dehydrogenase type 2. J Clin Invest 1999 103:683-689[Medline]
  18. Masuzaki H, Paterson J, Shinyama H, Morton NM, Mullins JJ, Seckl JR, Flier JS. A transgenic model of visceral obesity and the metabolic syndrome. Science 2001 294:2166-2170[Abstract/Free Full Text]
  19. Rajan V, Chapman KE, Lyons V, Jamieson P, Mullins JJ, Edwards CR, Seckl JR. Cloning, sequencing and tissue-distribution of mouse 11 beta-hydroxysteroid dehydrogenase-1 cDNA. J Steroid Biochem Mol Biol 1995 52:141-147[CrossRef][Medline]
  20. Cole TJ. Cloning of the mouse 11 beta-hydroxysteroid dehydrogenase type 2 gene: tissue specific expression and localization in distal convoluted tubules and collecting ducts of the kidney. Endocrinology 1995 136:4693-4696[Abstract]
  21. Han VKM, Lu F, Bassett N, Yang K, Delhanty PJD, Challis JRG. IGF-II mRNA is expressed in steroidogenic cells of the developing ovine adrenal gland: evidence of an autocrine/paracrine role for IGF-II. Endocrinology 1992 131:3100-3109[Abstract/Free Full Text]
  22. Edwards CR, Benediktsson R, Lindsay RS, Seckl JR. Dysfunction of placental glucocorticoid barrier: link between fetal environment and adult hypertension?. Lancet 1993; 341:355–357
  23. Cole TJ, Blendy JA, Monaghan AP, Krieglstein K, Schmid W, Aguzzi A, Fantuzzi G, Hummler E, Unsicker K, Schutz G. Targeted disruption of the glucocorticoid receptor gene blocks adrenergic chromaffin cell development and severely retards lung maturation. Genes Dev 1995 9:1608-1621[Abstract/Free Full Text]
  24. Muglia L, Jacobson L, Dikkes P, Majzoub JA. Corticotropin-releasing hormone deficiency reveals major fetal but not adult glucocorticoid need. Nature 1995 373:427-432[CrossRef][Medline]
  25. Shams M, Kilby MD, Somerset DA, Howie AJ, Gupta A, Wood PJ, Afnan M, Stewart PM. 11Beta-hydroxysteroid dehydrogenase type 2 in human pregnancy and reduced expression in intrauterine growth restriction. Hum Reprod 1998 13:799-804[Abstract/Free Full Text]
  26. McTernan CL, Draper N, Nicholson H, Chalder SM, Driver P, Hewison M, Kilby MD, Stewart PM. Reduced placental 11beta-hydroxysteroid dehydrogenase type 2 mRNA levels in human pregnancies complicated by intrauterine growth restriction: an analysis of possible mechanisms. J Clin Endocrinol Metab 2001 86:4979-4983[Abstract/Free Full Text]
  27. Kitanaka S, Tanae A, Hibi I. Apparent mineralocorticoid excess due to 11 beta-hydroxysteroid dehydrogenase deficiency: a possible cause of intrauterine growth retardation. Clin Endocrinol (Oxf) 1996 44:353-359[CrossRef][Medline]
  28. Cross JC. Genetic insights into trophoblast differentiation and placental morphogenesis. Semin Cell Dev Biol 2000 11:105-113[CrossRef][Medline]
  29. Muglia LJ, Bae DS, Brown TT, Vogt SK, Alvarez JG, Sunday ME, Majzoub JA. Proliferation and differentiation defects during lung development in corticotropin-releasing hormone-deficient mice. Am J Respir Cell Mol Biol 1999 20:181-188[Abstract/Free Full Text]
  30. Barlow SM, Morrison PJ, Sullivan FM. Plasma corticosterone levels during pregnancy in the mouse: the relative contributions of the adrenal glands and foeto-placental units. J Endocrinol 1974 60:473-483[Abstract/Free Full Text]
  31. Venihaki M, Carrigan A, Dikkes P, Majzoub JA. Circadian rise in maternal glucocorticoid prevents pulmonary dysplasia in fetal mice with adrenal insufficiency. Proc Natl Acad Sci U S A 2000 97:7336-7341[Abstract/Free Full Text]
  32. Wong MD, Burton AF. Studies on corticosterone-receptor complexes from mouse placenta. Can J Biochem 1974 52:190-195[Medline]
  33. Shin BC, Fujikura K, Suzuki T, Tanaka S, Takata K. Glucose transporter GLUT3 in the rat placental barrier: a possible machinery for the transplacental transfer of glucose. Endocrinology 1997 138:3997-4004[Abstract/Free Full Text]
  34. Han VK, Carter AM. Spatial and temporal patterns of expression of messenger RNA for insulin-like growth factors and their binding proteins in the placenta of man and laboratory animals. Placenta 2000 21:289-305[CrossRef][Medline]
  35. Tchernitchin A, Rooryck J, Tchernitchin X, Vandenhende J, Galand P. Effects of cortisol on uterine eosinophilia and other oestrogenic responses. Mol Cell Endocrinol 1975 2:331-337[CrossRef][Medline]
  36. Jacobs AL, Hwang D, Julian J, Carson DD. Regulated expression of prostaglandin endoperoxide synthase-2 by uterine stroma. Endocrinology 1994 135:1807-1815[Abstract]
  37. Bigsby RM, Young PC. Progesterone and dexamethasone inhibition of uterine epithelial cell proliferation: studies with antiprogesterone compounds in the neonatal mouse. J Steroid Biochem Mol Biol 1993 46:253-257[CrossRef][Medline]
  38. Pepe GJ, Waddell BJ, Stahl SJ, Albrecht ED. The regulation of transplacental cortisol-cortisone metabolism by estrogen in pregnant baboons. Endocrinology 1988 122:78-83[Abstract/Free Full Text]
  39. Baggia S, Albrecht ED, Pepe GJ. Regulation of 11 beta-hydroxysteroid dehydrogenase activity in the baboon placenta by estrogen. Endocrinology 1990 126:2742-2748[Abstract/Free Full Text]
  40. Taya K, Greenwald GS. In vivo and in vitro ovarian steroidogenesis in the pregnant rat. Biol Reprod 1981 25:683-691[Abstract]
  41. Sun K, Yang K, Challis JR. Regulation of 11beta-hydroxysteroid dehydrogenase type 2 by progesterone, estrogen, and the cyclic adenosine 5'-monophosphate pathway in cultured human placental and chorionic trophoblasts. Biol Reprod 1998 58:1379-1384[Abstract/Free Full Text]
  42. Pepe GJ, Albrecht ED. Comparison of cortisol-cortisone interconversion in vitro by the human and baboon placenta. Steroids 1984 44:229-240[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Reproductive SciencesHome page
K. Vagnerova, Z. Vackova, P. Klusonova, F. Staud, M. Kopecky, P. Ergang, I. Miksik, and J. Pacha
Reciprocal Changes in Maternal and Fetal Metabolism of Corticosterone in Rat During Gestation
Reproductive Sciences, November 1, 2008; 15(9): 921 - 931.
[Abstract] [PDF]

Home page
 Hum Reprod UpdateHome page
A. E. Michael and A. T. Papageorghiou
Potential significance of physiological and pharmacological glucocorticoids in early pregnancy
Hum. Reprod. Update, September 1, 2008; 14(5): 497 - 517.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
T. Umekawa, T. Sugiyama, T. Kihira, N. Murabayashi, L. Zhang, K. Nagao, Y. Kamimoto, N. Ma, J. Yodoi, and N. Sagawa
Overexpression of Thioredoxin-1 Reduces Oxidative Stress in the Placenta of Transgenic Mice and Promotes Fetal Growth via Glucose Metabolism
Endocrinology, August 1, 2008; 149(8): 3980 - 3988.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
G. M. Kalabis, A. Kostaki, M. H. Andrews, S. Petropoulos, W. Gibb, and S. G. Matthews
Multidrug Resistance Phosphoglycoprotein (ABCB1) in the Mouse Placenta: Fetal Protection
Biol Reprod, October 1, 2005; 73(4): 591 - 597.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. M. Paterson, J. R. Seckl, and J. J. Mullins
Genetic manipulation of 11{beta}-hydroxysteroid dehydrogenases in mice
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2005; 289(3): R642 - R652.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
J. W. Tomlinson, E. A. Walker, I. J. Bujalska, N. Draper, G. G. Lavery, M. S. Cooper, M. Hewison, and P. M. Stewart
11{beta}-Hydroxysteroid Dehydrogenase Type 1: A Tissue-Specific Regulator of Glucocorticoid Response
Endocr. Rev., October 1, 2004; 25(5): 831 - 866.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
67/6/1708    most recent
biolreprod.102.005488v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thompson, A.
Right arrow Articles by Yang, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thompson, A.
Right arrow Articles by Yang, K.
Agricola
Right arrow Articles by Thompson, A.
Right arrow Articles by Yang, K.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS