Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print November 13, 2002.
Biol Reprod 2002, 10.1095/biolreprod.102.009787
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
68/3/1044    most recent
biolreprod.102.009787v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oyhenart, J.
Right arrow Articles by Raich, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oyhenart, J.
Right arrow Articles by Raich, N.
Agricola
Right arrow Articles by Oyhenart, J.
Right arrow Articles by Raich, N.
BIOLOGY OF REPRODUCTION 68, 1044–1053 (2003)
DOI: 10.1095/biolreprod.102.009787
© 2003 by the Society for the Study of Reproduction, Inc.


Gamete Biology

Phtf1 Is an Integral Membrane Protein Localized in an Endoplasmic Reticulum Domain in Maturing Male Germ Cells1

J. Oyhenarta, R. Le Gofficb, M. Samsonb, B. Jégoub, and N. Raich2,a

a INSERM U.567 CNRS-UMR 8104, Institut Cochin, Departement d'Hematologie, Maternité de Port-Royal, Université Rene Descartes, 75014 Paris, France b GERM-INSERM U. 435, Université de Rennes I, Campus de Beaulieu, 35042 Rennes cedex, Bretagne, France


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Phtf1 is a gene evolutionarily conserved from Drosophila to human that is abundantly expressed in testis. In adult rat, transcripts were abundant in germinal meiotic and postmeiotic cells. Phtf1-specific antibodies revealed weak activity in a juxtanuclear region of early pachytene spermatocytes. Labeling progressively extended to the entire cytoplasm of step 2–3 spermatids, became intense from step 4, and persisted until the end of spermiogenesis, when it was eliminated in the residual bodies. Phtf1 displayed the properties of an integral membrane protein. In transfected cells and haploid cells of rat seminiferous epithelium, it colocalized with ER markers (calnexin and calmegin, respectively). By using both ER and Golgi markers (TGN-38, p58), we were able to show that, in pachytene spermatocytes and in Golgi phase spermatids, phtf1 labeled a region neighboring the cis-Golgi that probably corresponded to the peripheral Golgi region. Phtf1 staining was not related to ß-COP, AP1, or AP2 aptamers, indicating that it was not transported between Golgi saccules or between the Golgi complex and plasma membrane. However, aptamer labeling showed that chlatrin vesicles could be engaged in a new traffic route, raising the possibility of a meiotic proacrosomal vesicle origin. Colocalization between phtf1 and calmegin decreased during the acrosomal phase. During the maturation phase, phtf1 was able to identify different ER domains, as described previously for the peripheral Golgi region. Phtf1 provides a potential new marker for Golgi modifications as well as for many of the obscure transformations undergone by the endoplasmic reticulum. It could help to elucidate the morphogenic events connected with the transformation of spermatogenic cells.

gamete biology, meiosis, testis


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Putative homeodomain transcriptional factor (PHTF) was first described as a novel gene family encoding putative homeodomains conserved from Drosophila to mammals [1, 2]. The human PHTF1 gene, located at band 1p11–13, encodes a 761-amino acid protein. The conservation between human (PHTF1) and mouse (phtf1) protein extends over the entire protein and is remarkably high (98% similarity) [1]. We reported previously the cloning of the Drosophila ortholog (d-phtf) that displays 56% similarity with phtf1 over its entire length. The highest identities between PHTF1 and d-phtf were localized at the NH2- and COOH-terminal regions and included a putative homeodomain region. However, 7–8 stretches of hydrophobic amino acid residues could indicate that phtf1 is a membrane-spanning protein [1]. No functional studies have established the nature of this protein.

Human and mouse PHTF1 mRNAs were detected in all the tissues analyzed, but their levels were remarkably high in the testis [1]. Spermatogenesis is a complex differentiation program leading to development of highly specialized haploid male gametes from primordial diploid cells. This differentiation program starts with the formation of spermatogonia from germ line stem cells followed by mitotic divisions to produce primary spermatocytes. Primary spermatocytes then undergo meiotic division to give rise eventually to haploid spermatid cells. Spermatids undergo extensive morphological changes, a phenomenon known as spermiogenesis, to produce spermatozoa. The essential morphological events consistently described during spermiogenesis are the condensation of the nucleus, the construction of the acrosome and flagellum, and the elimination of the residual cytoplasm [3]. These changes, which lead to profound modifications of preexistent structures or accompany the formation of new organelles, have been clearly characterized at the electron microscopy level, but their biochemistry still remains largely obscure.

The endoplasmic reticulum undergoes noticeable transformations during spermiogenesis and becomes closely associated with several components of the cell as they are formed or being transformed [3, 4]. These de novo structures include a network of tubular cisternae located along the convex surface of the Golgi apparatus, a fenestrated sleeve in association with the manchete, another closely associated to the flagellum, an extensive and conspicuous network located close to the plasma membrane, and a radial body. [3, 5].

The Golgi apparatus also undergoes singular transformations, the best known of which are related to the acrosomic system [6]. During the formation of the acrosome, the Golgi changes its orientation and adopts a cis-trans configuration facing the nucleus. This new configuration puts the trans-Golgi in close proximity to the nucleus and could permit direct vesicular flow from the Golgi to the acrosomal vesicle. [7, 8]. When the addition of material to the acrosomic system terminates, the Golgi apparatus migrates toward the opposite pole of the cell. Most of the Golgi stacks are seen in the residual body eliminated by the mature spermatid [6], but some remnants are still present in the cytoplasmic droplet of spermatozoa during epididymal maturation [7].

We report here the first attempt to investigate phtf1 expression. The protein identifies specific ER domains in meiotic and postmeiotic germinal cells. Its localization is intimately linked to the changes undergone by the Golgi apparatus and the endoplasmic reticulum. Phtf1 could help us to understand the process of germ cell maturation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Preparation of Testicular Purified Cells

Animals used in these studies were maintained and killed according to the guidelines for the approval for animal experimentation. Sertoli cells and peritubular cells were isolated from 20-day-old Sprague Dawley rats as described previously with degrees of purity of 98% and >96%, respectively, [9, 10]. The isolation of Leydig cells and of testicular resident macrophages from 90-day-old rats was carried out during the same preparation as described previously [11], and the purity was >98% and >94%, respectively. Spermatogonia (purity >=94%) were prepared from 9-day-old Sprague Dawley rats using a protocol described by Bellve et al. [5]. Germ cells with a purity of greater than 90% were prepared from adult rat testes as described before [12] except that enzymatic dissociation of cells was replaced by a mechanical dispersion. Pachytene spermatocytes, round spermatids, and cytoplasmic fragments of elongated spermatids plus residual bodies (CES/RB) were prepared by centrifugal elutriation with a purity >90%.

RNA Analyses

For reverse transcription-polymerase chain reaction (RT-PCR) analyses, 5 µg of RNA were reverse transcribed as described in Cudicini et al. [13] and the reaction mixture brought to 100 µl. Each PCR was performed using 1 µl as follows: 94°C for 30 sec, 54°C (phtf1) or 57°C (actin) for 30 sec, and 72°C for 2 min and 35 cycles. The rat phtf1 oligonucleotides are reported on legends of figures, and the actin oligonucleotides were previously described [14]. Amplified products (289 base pairs [bp] for phtf1 and 1020-bp products for actin) were analyzed on agarose gels.

Plasmids and Transient Transfection of Cell Lines

A NotI-ScaI fragment comprising the entire coding sequence from the mouse phtf1 cDNA (EMBL/GENBANK AJ133721 and AJ242864) was cloned between the NotI-EcoR V sites of the pCDNA3-1 expression vector (Invitrogen). To generate the N-terminal myc-tagged protein (myc-phtf1), we mutated the first amino acid position of the protein from GC (ATG corresponds to the first Met) to GC, obtaining an EcoRV site. The six myc tags (BamHI-EcoRI blunted fragment from the pCS3-MT vector) were inserted at this site. The C-terminal tagged protein (phtf1-myc) was obtained by deleting the phtf1 sequence from the plasmid myc-phtf1 with EcoRI (by blunting this site, we created a stop codon after the 6-myc tag). The entire phtf1 sequence was then inserted at the ClaI site in the 5' sequence of the tag sequence.

Cell lines were maintained in Dulbecco modified minimal essential medium supplemented with 10% fetal calf serum. NIH3T3 and COS7 cells were transfected with 1 µg of plasmid per 10 mm well by using the Fugene reagent as recommended by suppliers (Roche, France).

Coupled Transcription-Translation and In Vitro Membrane Association

Coupled transcription-translation was performed in rabbit reticulate lysate (Promega) by using the plasmid phtf1-myc, with or without canine microsomal membranes (Promega). For membrane experiences, after translation, volume was adjusted to 750 µl with TBS (NaCl 150 mM, Tris 10 mM, pH 7.4), and microsomes were pelleted by centrifugation for 30 min at 150 000 x g in a TL80.4 rotor. For carbonate extraction, pellets were suspended in ice-cold 0.1 M sodium carbonate, pH 11 [15]. For Triton X-114 extraction [16], membranes were solubilized in 1% Triton X-114 for 60 min at 4°C, phase separation was induced at 37°C, and centrifugation was done for 5 min at 13 000 rpm in a microfuge. TBS and carbonate pellets were washed three times and Triton phase five times. All the corresponding supernatant fractions were pooled and acetone precipitated.

Subcellular Fractionation of Germ Cells

The different fractions of cells (spermatogonia, spermatocytes, round spermatids, and CES/RB) were prepared as described by Goodwin [17]. Briefly, cells were suspended at a cell density of 10–30 x 106 in 1 ml of buffer A containing 20 mM HEPES, pH 7.5, 1 mM EDTA, 0.5 mM DTT, 1 mM phenylmethylsulfonyl fluoride (25 µg/ml), aprotinin (1 µg/ml), and leupeptin (10 µg/ml), and 10 µM E-64. The cell suspension was homogenized in a glass Dounce homogenizer and then centrifuged at 2000 x g to pellet the nuclei. The postnuclear supernatant was further centrifuged at 105 000 x g to pellet the microsomal membranes while the supernatant was collected for the cytosolic fraction. The whole cells and pellets of microsomal membranes were suspended in buffer A (1 ml). Fifty micrograms of total protein was then mixed in 2x Laemly buffer, boiled, and loaded in an 8% SDS-PAGE gel.

Antibodies

The region between amino acid residues 351 and 454 of the predicted mouse phtf1 protein was inserted into a pRSET-derived (Invitrogen) his-tagged vector. The corresponding recombinant protein was expressed in bacteria and was affinity purified (Xpress system protein expression pRSET; Invitrogen) to raise a polyclonal antiserum, mp71, in rabbit (Eurogentec).

Dr. Bunick (University of Pennsylvania) generously donated the monoclonal 1C9 anti-calmegin antibody [18]. Antibodies against ß-cop, TGN 38, {gamma}-adaptin, and ß-adaptin were a gift of Dr. Benichou (Institut Cochin, Paris, France) and were purchased from Affinity Bioreagents. Antibodies against p58 were purchased from Sigma (France).

Western Blot Analyses

Protein extracts were separated on 8% acrylamide gels and transferred onto polyvinylidene fluoride (PVDF) membranes (Amersham). Membranes were incubated in 10 mM Tris-Hcl, pH 7.4; 150 mM NaCl, 20% Tween-20 (TBST), and 2% BSA at room temperature for 2 h. The rabbit polyclonal mp71 antiserum was diluted 1/500 and peroxidase conjugated donkey anti-rabbit IgG (or the donkey anti-mouse) (Promega) diluted 1/2500 in TBST-BSA. The commercial monoclonal antibody 9E10 (Roche) was diluted 1/2500 and peroxidase conjugated donkey anti-mouse IgG (Promega) diluted 1/2500 in TBST-BSA. Membranes were subjected to chemiluminescent detection using an enhanced chemiluminescence Western blotting detection kit (Amersham). Blocking mp71 antiserum was achieved using 5 µg of the purified mouse phtf1 corresponding to amino acids 351–454 protein. Bound antibodies were subsequently removed using 10 µl Ni-NTA magnetic agarose beads (Qiagen, France).

Immunohistochemistry

For the immunohistochemical analysis, paraffin sections of Bouin-fixed rat testis were mounted on glass slides. Sections were deparaffinized, rehydrated, and antigens unmasked by using a pressure cooker (2 min in 0.01 M sodium citrate buffer, pH 6, at high pressure and 15 min of cooling under tap water). Sections were incubated for 60 min with a 2% blocking solution goat serum, 1% BSA in PBS, followed by incubation with mp71 at 1:100 dilution for 60 min. For peroxidase staining, we used an anti-rabbit avidin and biotinylated horseradish peroxidase (ABC) staining kit (Vector Laboratories, Santa Cruz, CA) and diamino benzidine (DAB) (Sigma).

For immunofluorescence analysis, testicular sections were processed as previously described except that the secondary antibody was replaced by commercially anti-rabbit tetramethyl rhodamine isothiocyanate (TRITC)-conjugated or anti-mouse fluorescein isothiocyanate (FITC)-conjugated. Anti-ß-cop was used at 1:50, anti-TGN 38 and {gamma}- or ß-adaptin were used at 1:100 dilution, and anti-p-58 was used at 1:200. Confocal images were acquired with a MRC-1000 confocal microscope (Bio-Rad) and processed in Adobe Photoshop.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Expression of Phtf1 mRNA Is Confined to the Germinal Cells

Northern blot studies have previously shown that phtf1 mRNA is abundantly present in testicular tissues [1]. We extended our analysis to identify the cells expressing phtf1. Because of the possibility of obtaining large and pure populations of testicular cells from rat, we performed these experiments on this model. The high phtf1 conservation (98% human-mouse) [1, 2] permitted generating a partial rat phtf1 cDNA (AJ 437403) and designing rat-specific primers. This phtf1 fragment represents the rat ortholog, as it harbors 97% sequence homology and 100% amino acid identity. The seminiferous epithelium of mammalian testis undergoes extensive postnatal development in a characterized sequence of germ differentiation that continues cyclically throughout adulthood. The first wave of spermatogenesis in the rat involves the appearance of pachytene spermatocytes at 15–18 days postpartum (dpp), of haploid spermatids at about 22 dpp, and the first release of mature spermatozoa around 45 dpp; the rat is considered to be adult after about 70 days. The onset of gene expression during this period can be used to predict the pattern of type-specific germ cell expression [19, 20]. RT-PCR analysis detected a specific 289 bp in RNA from all testis samples, but a marked rise in its expression occurred about 20 days after birth (Fig. 1A) that correlated with the onset of meiosis. The presence of a faint band at 9 days old indicated that there was some level of expression in other testicular cells.



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 1. High phtf1 expression in meiotic and postmeiotic male germ cells. A) Expression of phtf1 mRNA in the testes of rats at different postnatal ages. RNA was isolated from the testes of 9-, 20-, and 90-day-old rats and analyzed for phtf1 expression by RT-PCR. As rat phtf1 cDNA had not previously been described, we first generated a partial rat phtf1 cDNA (GenBank AJ 437403) to design specific primers (CACTCTCTGGCTGGAGAGACAGATGG and ACTGCTGAATAATGGGAAAAACACC as the sense and the antisense primers, respectively). The expected size of band amplimers was 289 bp for phtf1 and 1020 bp for the actin control. B) Cell-specific expression of phtf1 mRNA in isolated rat testicular cells. RT-PCR analysis was performed using RNA extracted from Leydig cells (Lc), peritubular cells (Pc), Sertoli cells (Sc), testicular and peritoneal macrophages (Mt and Mp, respectively), spermatogonia (Sg), pachytene spermatocytes (Pc), and round spermatids (Rs). Actin amplification was used as control

To identify exactly which testicular cells were expressing phtf1, RNA from myoid peritubular cells, Leydig cells, Sertoli cells, testicular macrophages, spermatogonia, spermatocytes, and spermatids were subjected to RT-PCR. Using this technique in three independent experiments, the specific phtf1 band appeared more abundant (at least 20-fold greater when quantified by a PhosphorImager) in pachytene spermatocytes and round spermatids than in the somatic cell populations (Fig. 1B). No signal was visible in the spermatogonia (Fig. 1B). These findings suggest that phtf1 gene expression is associated with germinal cell maturation. The presence of a very faint signal in the somatic cells probably explains the low levels of phtf1 mRNA detected in 9-day-old rats (Fig. 1A).

Phtf1 Is an Integral Membrane Protein Present from Meiotic Spermatocytes to the End of Spermiogenesis

To extend our RNA analysis at the protein level, we raised a rabbit polyclonal antiserum against a specific phtf1 region (see Materials and Methods). The specificity of the phtf1 antibody, mp71, was established by Western blot analysis of the total proteins extracted from COS cells transfected with a myc-mouse phtf1 expression vector. As expected, the 9E10 anti-myc monoclonal antibody revealed an 89-kDa immunoreactive band in protein extracts (Fig. 2A). The same band was observed in extracts from transfected cells when using the mp71 antibody (Fig. 2A). The 89-kDa band was specific because it was blocked when the mp71 antibody was preincubated with the purified protein preparation used as immunogen. Because the region used to raise the polyclonal antibody was highly conserved (96% amino acids identity between mouse and human), we used it to reveal phtf1 in rat.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 2. Phtf1 is a membrane protein present in meiotic and postmeiotic cells. A) Specificity of the polyclonal mp71 antiserum. An expression vector containing an N-terminal myc epitope in phase with the mouse phtf1 cDNA was transfected into COS cells. After culturing for 24 h, the total proteins were extracted and resolved by SDS-PAGE on an 8% polyacrylamide gel and then transferred onto PVDF membranes. The membranes were probed with a 1:2500 dilution of the 9E10 myc antiserum ({alpha}-myc), a 1:500 dilution of the mp71 antiserum (mp71), or a blocked mp71 antiserum (blocked mp71). Finally, they were incubated with a 1:2500 dilution of anti-mouse ({alpha}-myc) or anti-rabbit (mp71) HRP-conjugated antibodies and subjected to chemiluminescent detection. B) Western blot analyses of endogenous phtf1 protein in isolated cell populations of rat testis. Whole cell proteins (Wcl) from Sertoli cells (Sc), peritubular (Pc) cells, spermatogonia, spermatocytes, and spermatids and late spermatid cytoplasmic lobes/residual bodies (CES/RB) were extracted. Purified spermatogonia, spermatocytes, spermatids, and CES/RB were fractionated into a high-speed pellet (CM) and a soluble fraction (Cy), as described in Materials and Methods. Protein extracts (20 µg) of the various samples were separated on a 10% SDS-PAGE and transferred onto a PVDF membrane and then detected using mp71 antibody. C) Membrane association of the in vitro-translated phtf1. Coupled rabbit reticulocyte transcription-translation was performed in the presence of canine membrane microsomes. After diluting in TBS buffer, the membranes were separated by centrifuging at 150 000 x g for 30 min. Pellets were washed three times in TBS buffer (TBS) or in carbonate buffer (Na2CO3) or extracted with 1% Triton X-114 (TX-114). S and P refer to the recovered supernatant and pellet fractions, respectively. Ho and Hi refer to the Triton X-114-soluble (hydrophobic) and -insoluble (hydrophilic) fractions, respectively

In order to correlate the RT-PCR data with protein expression, we prepared extracts from somatic cells (peritubular and Sertoli cells), germ cells (spermatogonia, spermatocytes, and spermatids), and CES/RB and analyzed them by Western blot with the mp71 antiserum. No immunoreactive band was present in Sertoli or peritubular cells (Fig. 2B). In germ cells, the 83-kDa phtf1 band was observed in pachytene spermatocytes, and it was dramatically increased (>70-fold) in spermatids. It was still present at very high levels in CES/RB (Fig. 2B). Two further lower bands (70 and 51 kDa) were detected in CES/RB and could correspond to protein degradation.

Cell fractionation was then used to assess the cellular compartmentalization of phtf1 in germ cells. Spermatogonia, spermatocytes, early spermatids, and CES/RB were fractionated by Dounce homogenization and, after separation of the nuclei and unbroken cells, centrifuged to obtain a high-speed pellet consisting mainly of membranes (CM, microsomal fraction) and a cytosolic fraction (CY). Most of the phtf1 was found in the microsomal fraction (Fig. 2B), indicating that it was associated with a cell membrane. As the predicted primary sequence did not contain a signal peptide, we wanted to find out whether phtf1 was simply associated with the membrane or was actually incorporated into it. Rabbit reticulocyte coupled transcription/translation was performed with a plasmid coding for a fusion mouse phtf1-myc in the presence of canine microsomal membranes. Microsomes were then isolated by centrifuging, and phtf1 was found in the pellet, indicating that it was associated with the lipid membrane fraction (Fig. 2C). When the membrane fraction was extracted using alkaline carbonate buffer (0.1 M, pH 11), phtf1 remained in the pellet (Fig. 2C). When microsomes were solubilized by using the detergent Triton X-114, phtf1 partitioned with the detergent phase (Fig. 2C). Taken together, these findings indicate phtf1 is an integral membrane protein.

Developmental Stage-Specific Expression of Phtf1

To identify the stage at which the cells express phtf1, immunohistochemical studies of adult rat testicular sections were performed using mp71 antibody and horseradish peroxidase. Typical sections after immunocytochemical staining of phtf1 with the mp71 antibody are shown in Figure 3. Somatic cells (peritubular, Leydig, and Sertoli cells) did not exhibit any detectable signal, whereas some germ cell categories were strongly stained in every seminiferous tubule (Fig. 3b). No reactivity was ever found in the spermatogonia. Specific immunolabeling was first detected in primary spermatocytes as a very faint signal close to the nuclei at all stages where this germ cell category is present (Fig. 3, c to f, and the enlargement in the inner figures). Such labeled vesicles were also observed in step 1–2 spermatids (Fig. 3c). The labeling progressively extended to the cytoplasm of early spermatids (Fig. 3d) and then gained in intensity (Fig. 3e). It was intense from step 4 spermatid to the end of spermiogenesis (Fig. 3, b and d). Staining was finally associated with the CES/RB (Fig. 3b). The specificity of this labeling was ascertained by using blocked serum (Fig. 3a). Figure 3g summarizes phtf1 expression in germ cells during the development cycle of the rat seminiferous epithelium.



View larger version (126K):
[in this window]
[in a new window]
 
FIG. 3. Sections of adult rat testis were immunostained with 1:100 diluted (bf) or blocked mp71 antiserum (a). Complexes were revealed by DAB, as described in the experimental procedures, and the sections were counterstained with hematoxylin. Roman numerals indicate the stages of the seminiferous tubule cycle according to [30]. Reactivity was first observed in early spermatocytes as a faint signal close to the nucleus (c, f). Staining intensity rose dramatically in step 2–3 spermatids, persisted during cap and elongation phases, and was eventually concentrated in the residual bodies; (cf) illustrate this progression. c) Stage II–III; d) stage III–IV; e) stage VIII; f) stage XIII tubules. Inner figures show a diplotene spermatocyte (c, bottom), a zygotene spermatocyte (f, bottom), a pachytene spermatocyte (f, top), a step 2 spermatid (d, top), a step 3–4 spermatid (c), a step 8 spermatid (e). g) Summary of the expression of phtf1 (shown in red) as spermatogenesis progresses. The diagram has been adapted from Blaise et al. [31]. Bar = 100 µm in a and b and 10 µm in cf

Phtf1 Localizes at the Endoplasmic Reticulum and the Peripheral cis Face of the Golgi

To assess the subcellular localization of phtf1, an expression vector containing myc-tagged phtf1 was transfected into NIH 3T3 cells. The protein appeared as a fine reticular network extending throughout the cytoplasm (Fig. 4a), and as it was reminiscent of that displayed by endoplasmic reticulum (ER) markers, we checked for possible colocalization with the ER resident chaperone calnexin. Both proteins displayed the same localization (Fig. 4, a to c), indicating that phtf1 was synthesized in the ER.



View larger version (70K):
[in this window]
[in a new window]
 
FIG. 4. Colocalization experiments of phtf1 and ER markers. ac) NIH 3T3 cells transfected with a myc-tagged phtf1 plasmid were probed by using the 9E10 anti-myc antibody (green in a and c) and an anti-calnexin antibody (red in b and c). They were revealed with FITC-conjugated anti-mouse and TRITC-conjugated anti-rabbit, respectively. Colocalization of phtf1 and calnexin is revealed as a yellowish color where they overlap (c). dl) Localization of phtf1 and calmegin in adult rat. Testis sections were immunostained with rabbit polyclonal mp71 antibody and mouse 1C9 anti-calmegin antibody. TRITC-conjugated anti-rabbit (red) and FITC-conjugated anti-mouse (green) were used as secondary antibodies. Sections of stage VIII–IX (df), stage XIII (gj), and stage I–II (km) of the seminiferous epithelium cycle are presented. Inside bottom in f shows a horseshoe-like phtf1-positive structure visible in a pachytene spermatocyte. Phtf1 staining is faintly yellowed by where it overlaps the calmegin staining. Inside bottom in m shows a similar pattern in an early Golgi-phase spermatid. Arrowheads in gi point to radial body neighboring structures where calmegin is concentrated by the end of the acrosomic phase [29]; j shows in detail the structures framed in i. cl, Cytoplasmic lobe; p, pachytene spermatocyte. Bars = 10 µm

Because the mp71 antibody was not suitable for electron microscopy studies, we performed double-labeling experiments in rat testis sections using antibodies recognizing phtf1 and the testis ER chaperone calmegin [18]. Figure 4, d to m, shows the results obtained after confocal microscopy examination. Phtf1 labeling exactly matched that of calmegin in step 3–8 spermatids (Fig. 4, d to f) and early elongating spermatids (Fig. 4, g to i). However, the presence of phtf1 was not always restricted to the regions where calmegin was located. Phtf1 described a horseshoe-like region at one pole of the nucleus in pachytene spermatocytes (Fig. 4f, inner figure) and step 1–2 spermatids (Fig. 4m, inner figure), whereas calmegin covered the entire cell. Distribution of both proteins was the same during steps 3–9 of spermiogenesis, but calmegin appeared to be more concentrated in the region neighboring the nuclear membrane. By step 13–14, both calmegin and phtf1 intensively stained the late spermatid cytoplasmic lobe (Fig. 4, g to i). Calmegin-positive structures, putatively corresponding to condensing ER regions in proximity to the radial body [18, 21], also stained intensely for phtf1 (arrowheads in Fig. 4, g to j). Nevertheless, phtf1 evidenced a network throughout the cytoplasm that persisted in the cytoplasmic lobe of step 15–19 spermatids, whereas calmegin was no longer observed after step 14 (Fig. 4, k to m).

The position and structure of the perinuclear labeling observed in pachytene spermatocytes was suspected of corresponding to the Golgi apparatus. In order to check this, testis sections were double labeled with antibodies against TGN38 and against phtf1 (Fig. 5, a to f). Phtf1 did indeed predict the location of the Golgi apparatus, but it was evident that phtf1 and Golgi markers were identifying different structures. The mp71 antibody labeled structures situated between the nucleus and TGN of pachytene spermatocytes from stage III to XII (Fig. 5f, inside top). During the following stages and up to the end of the Golgi phase, the TGN38 labeling was superimposed over the phtf1 labeling. This pointed out the profound reorganizing process that culminated by the inversion of the position of the organelle. At this time, phtf1 occupied the cis elements position (Fig. 5f, inside bottom). The cytoplasmic lobes of the elongating spermatids did not exhibit any significant phtf1-TGN38 overlaps (Fig. 5c, inside top).



View larger version (78K):
[in this window]
[in a new window]
 
FIG. 5. Localization of Golgi markers (green) and phtf1 (red) in adult rat testis sections. Testis sections were probed with mouse monoclonal anti-TGN-38 (a, c, d, and f) or mouse p58 (g, i, j, and l) and rabbit polyclonal mp71 antibodies (b, c, e, f, and h, i, k, I). Then they were stained with secondary anti-mouse FITC-conjugated and anti-rabbit TRITC-conjugated antibodies. af) The Golgi marker used was TGN38. Representative sections in stage I (ac) and in stage II–III (df) tubules are shown. Inside figures show magnification of representative cells. Note the adjacent position of both markers throughout the spermatogenic cycle. Top inside f shows a primary spermatocyte, bottom of c an early Golgi phase spermatid, and bottom of f a Golgi cap-phase spermatid. They all show the persistent vicinity of both markers. The inside top figure in c shows that this situation extends to the cytoplasmic lobe of elongating spermatids. gl) the Golgi marker utilized was p58. Stages VIII–IX of the cycle in gi show both markers converging on the cis-Golgi region. High-intensity phtf1 labeling in haploid cells shows yellowing of p58-positive cis-Golgi structures (inside right i) whenever two different intermingled structures are revealed (see inside bottom in gi). jl) A 0.3-µm path-length image obtained from a stage II–III tubule. Note in the inside figures that phtf1 labeling interrupts the continuity of the bracket described by the Golgi marker and goes through it to reach the medulla. See also (arrowheads in jl) that cytoplasmic lobe Golgi structures are virtually devoid of phtf1. Scale bars = 10 µm

To reveal a situation consistent with the cis-Golgi saccules, we stained the entire Golgi apparatus with antibodies against p58, a soluble protein that links the cytoskeleton to Golgi membranes (Fig. 5, g to l). Spermatids strongly expressing phtf1 showed significant overlapping with both phtf1 and p58 (Fig. 5i, inside right). Nevertheless, high magnification and thinner sections (0.15 µm) revealed that phtf1 labeling of pachytene spermatocytes and step 1–3 spermatids could be distinct from p58-positive structures. Phtf1 was mainly located at the cis side and sometimes seemed to be going through the bracket described by the Golgi marker (see arrowheads in Fig. 5l, inside).

To ascertain if phtf1 location corresponded to vesicles in transit between the Golgi elements, we probed rat testis slides with mp71 and anti-ß-COP antibodies. As described previously by Moreno et al. [8] and Hermo et al. [7], ß-COP vesicles were abundant between the Golgi apparatus and the expected acrosome region, and phtf1 labeling did not show any correspondence with this signal (data not shown). We addressed the possibility that phtf1 labeling in pachytene spermatocytes and Golgi phase spermatids could identify elements in transit between the Golgi system and the plasma membrane. Clathrin-coated vesicles are the most well-known carrier vesicles connecting both membranes. Clathrin associates with the membranes through aptamer complexes. AP1 complex is associated with Golgi-endosome clathrin-coated vesicles, and AP2 with endosome-plasma membrane [22]. We used an anti-ß-adaptin antibody to recognize both complexes. Aptamers labeling became stronger with meiosis progression, suggesting changes in transport activity. No significant overlapping between ß-adaptin and phtf1 was observed (Fig. 6, a to i). Phtf1 was generally observed as a cage-like structure surrounding aptamers (see Discussion). ß-Adaptin labeling reinforces the idea that phtf1 resides in a restricted ER or ER-Golgi membrane.



View larger version (87K):
[in this window]
[in a new window]
 
FIG. 6. Phtf1 is not related with clathrin (AP1 and AP2) transport. Testis sections were probed with mouse monoclonal anti-ß-adaptin antibodies and rabbit polyclonal anti-phtf1 antibodies and stained with secondary antibodies anti-mouse FITC-conjugated and anti-rabbit TRITC-conjugated. ac) A stage XI–XII tubule section. Phtf1 labeling denotes an almost lamellar structure surrounding high concentration levels of AP1 or AP2 clathrin-coated vesicles (see arrowhead in b, inside). di) Magnifications of a stage XIV tubule section (df) and a stage I–II tubule (gi) show in detail the relationship between phtf1 and ß-adaptin-positive structures. Only the Golgi apparatus of secondary spermatocytes (2Sy in df) revealed a faint overlapping whenever it revealed lower Golgi organization than in early spermatids (Sd in gh), as supposed from the transition between divisions, and sometimes a bipartite structure (see arrowheads in df). During transition, clathrin transport does not diminish, indicating an active transport. CL in h is a section of a cytoplasmic lobe. Scale bar = 100 µm


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The present study has established that phtf1 is expressed in the germinal cells. In the rat, the transcripts accumulated at similar high levels in spermatocytes and spermatids. The protein first appeared in meiotic spermatocytes and became abundant in spermatids around stage III–IV. This difference in the accumulation of RNA and of protein could be accounted for by the specific degradation and/or a delayed translation of phtf1 mRNA, something typical of many genes in spermiogenesis [23, 24]. The mouse testis phtf1 mRNAs contain two alternative 5'untranslated region (5'UTRs) [1] that could have different effects on the stability of the messages or their translation efficiency. It should be noted that one of the two 5'UTRs harbors a high G+C content (75% over 600 bp) and could form secondary structures that could interfere with translation by blocking ribosome scanning, a mechanism already described [25, 26]. Unequal distribution and/or differing translation efficiencies of these two 5'UTRs could account for the differences in protein concentration in spermatocytes and spermatids.

The findings of a previous homology analysis had suggested that phtf1 could belong to the homeobox gene family [1]. However, on the basis of the presence of 6–8 stretches of hydrophobic amino acid residues, phtf1 could also be a transmembrane protein [1]. We demonstrate here that phtf1 indeed has some of the characteristic properties of a membrane protein. First, most of it fractionated with the high-speed membrane pellet subcellular fraction of germinal cells, and in vitro-translated protein was translocated into the microsomal fraction when translation was performed in the presence of canine microsomal membranes. Furthermore, when microsomes were washed with an alkaline carbonate buffer, the protein remained in the pellet, indicating that phtf1 was not associated with a membrane component but rather inserted into the lipid bilayer. Finally, Triton X-114 extraction demonstrated that phtf1 partitioned as a hydrophobic integral membrane protein. Because phtf1 contains 6–8 stretches of hydrophobic amino acid residues, it could be a multipass transmembrane protein (class III). Immunostaining of phtf1-transfected cells was consistent with this conclusion, as the protein could be synthesized in the endoplasmic reticulum (see below).

In adult rat testicular sections, antibodies revealed that phtf1 first appeared in early rat pachytene spermatocytes in which the protein was restricted to a juxtanuclear region. By step 2–3 of spermiogenesis, the concentration of the protein had risen considerably and the reactivity extended to the entire cytoplasm. Phtf1 colocalized with the ER chaperone calmegin in step 3–8 spermatids and early elongating spermatids. However, we noticed also phtf1 in or in close proximity to the Golgi apparatus in meiotic and early spermatids. By using conjoint labeling of phtf1 with the Golgi-associated protein p58 and the TGN-resident protein TGN38, we deduced that phtf1 was linked to the cis face but was not part of the cis saccules of Golgi. Phtf1 was clearly not transported between Golgi saccules or between the Golgi and plasma membrane because its labeling was not related to ß-COP or aptamer-coated vesicles. Furthermore, phtf1 sometimes looked as if it was going through the bracket described by the Golgi complex. The cisternae of the ER have been shown to be closely applied to the convex outer surface of the Golgi, where they were found to be separated from the stacks of saccules by a region called the peripheral region [4]. This structural continuity between ER and Golgi was observed only on the cis face of the Golgi apparatus, but peripheral tubules have been shown crossing the gaps between the stacks of Golgi saccules in noncompact zones [4, 7]. As phtf1 labeling is reminiscent of these structures, we suggest that it may identify the peripheral Golgi region (Fig. 7A).



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 7. Schematic relationship between phtf1-positive structures and the Golgi apparatus. A) Diagram modified with permission from Clermont and Hermo [32]. ER-derived regions intimately related with the Golgi apparatus where the first phtf1 positive membranes are depicted in red here. NCZ, Noncondensed zones of the Golgi system; S, saccules; ER, endoplasmic reticulum; M, medullae. B) Illustration of the position of phtf1 relative to the morphologic changes undergone by the Golgi complex. Aptamer labeling revealed that, during prophase of meiosis (stage IV–VI), transport increases dramatically. This enhanced activity could lengthen the organelle and induce a curvature (2). The acquisition of the circular shape could arise from the convergence of the transport to a nucleation center or from an external source that supports the organization of the cis-face of the organelle (3). If the formation of preacrosomal structures starts during meiosis [33], the haploid cell could take advantage of an equitable division of both the Golgi and the acrosomal precursor (4). After the meiotic divisions, the preacrosomal vesicles fuse in higher order, visible granules and migrate to reach the nuclear envelope (5). The Golgi apparatus now adopts an adjacent and inverted position (6)

Phtf1 in combination with several markers revealed the transformations undergone by the Golgi complex, changing from the typical flat-shaped organelle through the spherical form of meiotic spermatocytes to the final flattened but inverted Golgi of the cap-phase spermatids. It was proposed that the increased size of the Golgi apparatus of pachytene spermatocytes could be predominantly due to heightened secretory activity and/or to a mechanism of partitioning the Golgi complex [27]. We observed a remarkably high level of chlatrin AP1-AP2 transport in pachytene cells that argued in favor of enhanced secretory activity. Interestingly, the transporters were always found in the circular region delimited by phtf1. These findings suggest that the chlatrin vesicles could be engaged in a new traffic route. These transport changes in pachytene cells, together with the previous evidence of acrosin synthesis in spermatocytes [28], raise the possibility of a meiotic proacrosomal vesicle origin. A schematic representation of the relationship between phtf1 and the rough changes suffered by the Golgi apparatus is presented in Figure 7B. An increase in the concentration of phtf1 was concomitant with its extension over the entire ER, perfectly matching the calmegin labeling. This colocalization decreased during the acrosomal phase, when calmegin was concentrated in a specific region, probably around the radial body [29]. Both proteins strongly stained this region, but whereas calmegin had vanished by step 15–16, phtf1 continued to reveal a network in the cytoplasmic lobe of step 15–19 spermatids. Because protein synthesis has stopped by step 13–14 of spermiogenesis, chaperoning would no longer be necessary and the usual rough-ER apparatus would disappear. Phtf1 could identify a different ER domain or be addressed to another membranous organelle, as we have already described in the ER-Golgi region. Electron microscopy has shown that most of the ER has disappeared by step 15 [3, 4], but little information has emerged about the smooth ER or about the lamellar organelles present in the cytoplasmic lobe. Phtf1 would provide a new marker for following many of these obscure transformations undergone by the endoplasmic reticulum.

Phtf1 possesses an evolutionarily-conserved structure and also displays a conserved pattern of expression even in Drosophila (data not shown), which strongly suggests that this protein may play an important role in the differentiation of germinal cells. Its expression accompanies many still unknown transformations undergone by the Golgi apparatus and the endoplasmic reticulum. Thus, phtf1 would probably be of interest in investigating the origin, nature, and function of many of the de novo issued organelles during the transformation of the spermatic cell.


    ACKNOWLEDGMENTS
 
We would like particularly to thank C. Yanicostas for his generosity with advice. We would like to thank D. Bunick for the monoclonal 1C9 calmegin antibody and S. Benichou (Institut Cochin, Paris) for the TGN 38, ß-cop, and {alpha}- and ß-adaptin antibodies. Special thanks are addressed to Florence Heutte for her assistance with the confocal microscopy. We acknowledge helpful discussions with P.H. Roméo.


    FOOTNOTES
 
1 This work was supported by INSERM and by a CONICET grant to J.O. Back

2 Correspondence: Natacha Raich, INSERM U 567-UMR 8104, 123 Boulevard de Port-Royal, 75014 Paris, France. FAX: 33 0 1 43 25 11 67; e-mail: raich{at}infobiogen.fr Back

Received: 25 July 2002.

First decision: 20 August 2002.

Accepted: 3 October 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Manuel A, Beaupain D, Romeo PH, Raich N. Molecular characterization of a novel gene family (PHTF) conserved from Drosophila to mammals. Genomics 2000 64:216-220[CrossRef][Medline]
  2. Raich N, Mattei MG, Romeo PH, Beaupain D. PHTF, a novel atypical homeobox gene on chromosome 1p13, is evolutionarily conserved. Genomics 1999 59:108-109[CrossRef][Medline]
  3. Clermont Y, Rambourg A. Evolution of the endoplasmic reticulum during rat spermiogenesis. Am J Anat 1978 151:191-211[CrossRef][Medline]
  4. Hermo L, Clermont Y, Rambourg A. Endoplasmic reticulum-Golgi apparatus relationships in the rat spermatid. Anat Rec 1979 193:243-255[CrossRef][Medline]
  5. Bellve AR, Millette CF, Bhatnagar YM, O'Brien DA. Dissociation of the mouse testis and characterization of isolated spermatogenic cells. J Histochem Cytochem 1977 25:480-494[Medline]
  6. Susi FR, Leblond CP, Clermont Y. Changes in the Golgi apparatus during spermiogenesis in the rat. Am J Anat 1971 130:251-267[CrossRef][Medline]
  7. Hermo L, Rambourg A, Clermont Y. Three-dimensional architecture of the cortical region of the Golgi apparatus in rat spermatids. Am J Anat 1980 157:357-373[CrossRef][Medline]
  8. Moreno RD, Ramalho-Santos J, Sutovsky P, Chan EK, Schatten G. Vesicular traffic and Golgi apparatus dynamics during mammalian spermatogenesis: implications for acrosome architecture. Biol Reprod 2000 63:89-98[Abstract/Free Full Text]
  9. Toebosch AM, Robertson DM, Klaij IA, de Jong FH, Grootegoed JA. Effects of FSH and testosterone on highly purified rat Sertoli cells: inhibin alpha-subunit mRNA expression and inhibin secretion are enhanced by FSH but not by testosterone. J Endocrinol 1989 122:757-762[Abstract]
  10. Skinner MK, Fritz IB. Testicular peritubular cells secrete a protein under androgen control that modulates Sertoli cell functions. Proc Natl Acad Sci U S A 1985 82:114-118[Abstract/Free Full Text]
  11. Klinefelter GR, Hall PF, Ewing LL. Effect of luteinizing hormone deprivation in situ on steroidogenesis of rat Leydig cells purified by a multistep procedure. Biol Reprod 1987 36:769-783[Abstract]
  12. Pineau C, Syed V, Bardin CW, Jegou B, Cheng CY. Germ cell-conditioned medium contains multiple factors that modulate the secretion of testins, clusterin, and transferrin by Sertoli cells. J Androl 1993 14:87-98[Abstract/Free Full Text]
  13. Cudicini C, Lejeune H, Gomez E, Bosmans E, Ballet F, Saez J, Jegou B. Human Leydig cells and Sertoli cells are producers of interleukins-1 and -6. J Clin Endocrinol Metab 1997 82:1426-1433[Abstract/Free Full Text]
  14. Aubry F, Habasque C, Satie AP, Jegou B, Samson M. Expression and regulation of the CC-chemokine monocyte chemoattractant protein-1 in rat testicular cells in primary culture. Biol Reprod 2000 62:1427-1435[Abstract/Free Full Text]
  15. Fujiki YHA, Fowler S, Lazarow PB. Isolation of intracellular membranes by means of sodium carbonate treatment: application to endoplasmic reticulum. J Cell Biol 1982 93:97-102[Abstract/Free Full Text]
  16. Bordier C. Phase separation of integral membrane proteins in Triton X-114 solution. J Biol Chem 1981 256:1604-1607[Abstract/Free Full Text]
  17. Goodwin GH. Protein purification methods: a practical approach. Oxford, UK: Oxford University Press. 1989.
  18. Ohsako S, Janulis L, Hayashi Y, Bunick D. Characterization of domains in mice of calnexin-t, a putative molecular chaperone required in sperm fertility, with use of glutathione S-transferase-fusion proteins. Biol Reprod 1998 59:1214-1223[Abstract/Free Full Text]
  19. McCarrey JR. Development in the germ cell. In: Desjardins C, Ewing LL (eds.), Cell and Molecular Biology of the Testis. Oxford, UK: Oxford University Press; 1993: 58–89.
  20. Leblond CP, Clermont Y. Definition of the stages of the cycle of the seminiferous epithelium in the rat. Ann N Y Acad Sci 1952 55:548-573
  21. Watanabe D, Yamada K, Nishina Y, Tajima Y, Koshimizu U, Nagata A, Nishimune Y. Molecular cloning of a novel Ca(2+)-binding protein (calmegin) specifically expressed during male meiotic germ cell development. J Biol Chem 1994 269:7744-7749[Abstract/Free Full Text]
  22. Robinson MS, Bonifacino JS. Adaptor-related proteins. Curr Opin Cell Biol 2001 13:444-453[CrossRef][Medline]
  23. Schafer M, Nayernia K, Engel W, Schafer U. Translational control in spermatogenesis. Dev Biol 1995 172:344-352[CrossRef][Medline]
  24. Kleene KC. Poly(A) shortening accompanies the activation of translation of five mRNAs during spermiogenesis in the mouse. Development 1989 106:367-373[Abstract]
  25. Kozak M. Do the 5' untranslated domains of human cDNAs challenge the rules for initiation of translation (or is it vice versa)?. Genomics 2000 70:396-406[CrossRef][Medline]
  26. Kozak M. Interpreting cDNA sequences: some insights from studies on translation. Mamm Genome 1996 7:563-574[CrossRef][Medline]
  27. Suarez-Quian C, An Q, Jelesoff N, Dym M. The Golgi apparatus of rat pachytene spermatocytes during spermatogenesis. Anat Rec 1991 229:16-26[CrossRef][Medline]
  28. Moreno RD, Ramalho-Santos J, Chan EK, Wessel GM, Schatten G. The Golgi apparatus segregates from the lysosomal/acrosomal vesicle during rhesus spermiogenesis: structural alterations. Dev Biol 2000 219:334-349[CrossRef][Medline]
  29. Yoshinaga K, Tanii I, Toshimori K. Molecular chaperone calmegin localization to the endoplasmic reticulum of meiotic and post-meiotic germ cells in the mouse testis. Arch Histol Cytol 1999 62:283-293[CrossRef][Medline]
  30. Perey BCY, Leblond CP. The wave of the seminiferous epithelium in the rat. Am J Anat 1961 108:47-48[CrossRef]
  31. Blaise RGT, Tavernier G, Daegelen D, Evrard B, Mairal A, Holm C, Jegou B, Langin D. Testis hormone-sensitive lipase expression in spermatids is governed by a short promoter in transgenic mice. J Biol Chem 2001 276:75109-5115[Abstract/Free Full Text]
  32. Clermont YOR, Hermo L. Development in the germ cell. In: Desjardins C, Ewing LL (eds.), Cell and Molecular Biology of the Testis. Oxford, UK: Oxford University Press; 1993: 332–375.
  33. Ventela SOH, Parvinen M, Nishimune Y. Development of the stages of the cycle in mouse seminiferous epithelium after transplantation of green fluorescent protein-labeled spermatogonial stem cells. Biol Reprod 2002 66:51422-1429[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
J. Oyhenart, S. Benichou, and N. Raich
Putative Homeodomain Transcription Factor 1 Interacts with the Feminization Factor Homolog Fem1b in Male Germ Cells
Biol Reprod, April 1, 2005; 72(4): 780 - 787.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. Oyhenart, J.L. Dacheux, F. Dacheux, B. Jegou, and N. Raich
Expression, Regulation, and Immunolocalization of Putative Homeodomain Transcription Factor 1 (PHTF1) in Rodent Epididymis: Evidence for a Novel Form Resulting from Proteolytic Cleavage
Biol Reprod, January 1, 2005; 72(1): 50 - 57.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
68/3/1044    most recent
biolreprod.102.009787v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oyhenart, J.
Right arrow Articles by Raich, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oyhenart, J.
Right arrow Articles by Raich, N.
Agricola
Right arrow Articles by Oyhenart, J.
Right arrow Articles by Raich, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS