| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gamete Biology |
a Departments of Zoology
b Obstetrics and Gynaecology, University of Melbourne, Victoria 3010 Australia
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
developmental biology, immunology, male reproductive tract, spermatogenesis, testis
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The testis has traditionally been regarded as an immunologically privileged site [11, 12], attributable to the tight junctions between adjacent Sertoli cells that form a blood-testis barrier [13], as well as to the growth factors, Fas and Fas-L [14, 15]. Thus, even though germ cells undergoing spermatogenesis in the lumen of the seminiferous tubule may be antigenic, they are protected from immunorejection. Stem spermatogonia, which lie outside this barrier and do not express major histocompatibility complex antigens [16], are anatomically protected by the myoid cell layer of the basement membrane [13]. It has therefore been assumed that within a species, immunorejection of transplanted germ cells is not likely to be an important factor in their survival [8]. However, there are no reports of successful germ cell transplantation resulting in progeny between different strains of rats, so we hypothesized that immunosuppression would improve the success of germ cell transplantation.
Cyclosporin is a cyclic endecapeptide of fungal origin that selectively inhibits T lymphocyte production and has greatly improved human graft survival rates since its introduction in the early 1980s [17]. We therefore used cyclosporin in rats to determine whether it would help prevent rejection after intraspecific and interspecific germ cell transplantation. We also used cryptorchid donors to increase the yield of stem spermatogonia, and treated the recipients with FSH to increase the number of Sertoli cells in the recipient testes, and testosterone to stimulate the recovery of spermatogenesis of the transplanted germ cells. These procedures have enabled us to increase the success rate of intraspecies and interspecies germ cell transplantation in rats.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Black and white Long-Evans male rats and H253 LacZ transgenic male mice (background: F1 of C57/b x DBA2) were used as germ cell donors, and white male Sprague-Dawley rats were used as germ cell recipients. All animals were maintained at 21 ± 1°C in a 14L:10D regime with food and water available ad libitum. Experimental procedures followed the National Health and Medical Research Council guidelines and approval was obtained from the University of Melbourne Animal Ethics Committees.
Proportion of Donor Cells
To enrich the population of stem spermatogonia in donor rat and mouse testes, surgery under sterile conditions was performed on some animals to imitate cryptorchidism. Nembutal anesthesia (sodium pentobarbitone 50 mg/kg; Boehringer Ingelheim, Australia) was used for rats, and a Rompun/Ketavet mixture (1 mg/ml Rompun, 10 mg/ml; Ketavet, 1.5 ml/10 g; Bayer AG, Germany; Delta Veterinary Laboratories P/L, Sydney, Australia) was used for mice. After opening the lower abdominal cavity, the gubernaculum was cut and the upper pole of the testis was sutured to the abdominal wall. Rat germ cell preparations were obtained from the testes of 2-wk-old Long-Evans animals, or 7- to 8-wk-old Long-Evans animals on which cryptorchid surgery had been performed 2–4 wk earlier. Mouse germ cells were obtained from adult LacZ transgenic animals on which cryptochid surgery had been performed 2.5–8 wk earlier. Ubiquitous expression of an X-linked LacZ transgene that encodes beta-galactosidase was observed in all cells of the donor male transgenic mice after X-gal staining [18].
A two-step enzymatic digestion [9] was used to harvest male germ cells. Briefly, 12–33 testes were digested with 0.05% collagenase (Sigma, St. Louis, MO) in Dulbecco PBS (DPBS) for 15 min at 35°C. The dispersed testicular tissue was allowed to sediment three times in DPBS-free Ca2+/Mg2+, then digested with 0.0625% trypsin (Sigma) in DPBS containing 50–100 µg/ml DNase I (Sigma) for 15 min under similar conditions. The tissue was aspirated several times and rinsed with an equal volume of DPBS containing 10% rat serum by gentle centrifugation (500 x g for 5 min) to inactivate the trypsin. The cell pellet was resuspended in McCoy 5A medium (Trace Biosciences Pty Ltd, Victoria, Australia) containing 0.1% BSA, 5 mM L-lactate sodium salt (ICN Biochemicals, Aurora, OH), 1 mM pyruvate sodium salt (Sigma), 100 IU per 100 µg/ml of PNC/streptomycin (Trace Biosciences) and 100 µg/ml DNase I, filtered through a 73-µm mesh screen, and centrifuged at 400 x g for 5 min. The final cell pellet was resuspended in the McCoy 5A medium with 90%–99% cell viability as determined by trypan blue (British Drug Houses Ltd., London, U.K.) exclusion to give a concentration of 57–390 x 106cells/ml. The suspension was stored on ice and used within 4 h of collection.
Recipient Rat Preparation and Transplantation Procedure
Male recipient Sprague-Dawley rats were treated with one or two i.p. injections of 10–20 mg/kg busulfan (ICN Biochemicals) between 15 and 50 days of age to destroy most of the endogenous germ cells as previously described [9, 10]. Under sterile surgical conditions, 50–400 µl of the donor germ cell suspension with 0.05% trypan blue or a small air bubble as a marker was injected into the recipient rats' vasa efferentia 25–35 days after busulfan injection, using a 30-gauge dental needle connected by 15 cm polyethylene tubing (inside diameter 0.28 mm, outside diameter 0.61 mm; Dural Plastics & Engineering, NSW, Australia) to a 1-ml syringe. The blue dye or air bubbles could be seen in the seminiferous tubules when the injection was successful.
Treatment of Recipients
Rat to rat Rat-to-rat germ cell transplantation was investigated in the first part of the study. The adult male recipients were divided into six groups after the initial treatment with busulfan. The number of rats in each treatment is shown in Table 1.
|
Controls Recipient rats received no further treatment other than busulfan, either before or after transplantation. Two additional control rats were killed immediately after transplantation to record the histological appearance of the testes.
Testosterone treatment Recipient rats were injected s.c. with either 8 mg/kg testosterone enanthate (Bayonne and Denville, NJ) 1–14 days before germ cell transfer, then once every 2–3 wk; or with 10 mg/kg testosterone propionate (Jurox, NSW Australia), repeated every third day. The total testosterone treatment time was 8–10 wk.
Cyclosporin treatment Cyclosporin (Novartis Pharma AG, Basel, Switzerland) was initially dissolved in absolute ethanol, then redissolved in olive oil to a final concentration of 15 mg/ml (4% ethanol). The recipient rats were injected s.c. with 15–20 mg/kg cyclosporin on the day of germ cell transfer, followed by 10 mg/kg daily for 7 days, then 10 mg/kg every second day for 2 wk, followed by 10 mg/kg once a week for another 1–2 mo.
Cyclosporin plus testosterone treatment Recipient rats were treated with a combination of cyclosporin and testosterone as described above.
Cyclosporin plus FSH treatment Recipient rats were treated with cyclosporin as described above, plus s.c. injections of 50 IU/kg of recombinant FSH (Organon, Sydney, Australia) daily for the first week after transplantation.
Cyclosporin plus FSH and testosterone treatment Neonatal male recipient rats were given 100 IU/kg of FSH daily from Day 1 to Day 7 after birth (Day 0), before they received their busulfan treatment. As adults they were injected with cyclosporin plus testosterone after germ cell transfer as described above.
Mouse to rat Mouse-to-rat germ cell transplantation was investigated in the second part of the study. The recipient rats were divided into five groups after the initial treatment with busulfan. The number of rats in each treatment is shown in Table 2.
|
Controls Recipient rats received no further treatment
Testosterone treatment Recipient rats were treated with testosterone similar to its use in the rat-to-rat transfers, but treatment was given for 6 wk only.
Cyclosporin treatment Cyclosporin treatment was similar to that used in the rat-to-rat transplants but it was given for 3–4 wk only.
Cyclosporin plus testosterone treatment Recipient rats were treated with a combination of cyclosporin and testosterone as described above.
Cyclosporin plus FSH treatment Recipient rats were given cyclosporin for 3–4 wk and FSH as in the rat-to-rat transplants.
Assessment of Recipients
Rat-to-rat germ cell transplantation There are no available intracellular markers for identifying donor rat germ cells within a recipient rat's testis, so the coat color of the progeny was recorded for evidence of successful germ cell transplantation. Any black and white offspring produced after test mating of the white Sprague-Dawley recipient male to a white Sprague-Dawley female must have been sired by donor black and white Long-Evans spermatozoa. Test mating was started 50–90 days after transplantation, and it continued for 50–325 days. Microsatellite analysis was used to confirm the Long-Evans haplotype of any black and white offspring with polymerase chain reaction and with the primers used by Otsen et al. [19] for D10MIT14 (forward, CCATGGCCTATAACCACACA; reverse, TGAAGAACTGATTCAGGGC).
Mouse-to-rat germ cell transplantation Recipient male rats were killed 63–95 days after mouse germ cell transplantation with an overdose of sodium pentobarbitone. Their testes were prepared for staining Escherichia coli ß-galactosidase with 5-bromo-4-chloro-3-indolyl ß-D-galactoside (X-gal) after fixing in 10% neutral-buffered formalin for 1 h. We used the staining procedure described by Tam and Tan [18]. A semiquantitative criterion was used to judge the extent of mouse germ cell colonization in the recipient rat's testis by recording the blue X-gal staining when viewed with a dissecting microscope. The degree of staining was given a score in which 1 = no visible blue staining, 2 = pale blue staining in some seminiferous tubules, 3 = less than six discrete blue dots in some seminiferous tubules, 4 = six or more discrete blue dots in some tubules or a blue section in at least one seminiferous tubule, and 5 = more than one blue section in several seminiferous tubules (Fig. 3a).
|
Histological control Eight donor cryptorchid mouse testes were used to check the effects of the operation on the germ cells. Two additional recipient rats were killed and one testis from each was taken 1 h after mouse germ cell transfer. These testes were fixed in Bouins solution, embedded in paraffin, and sectioned at 5 µm. They were stained with germ cell nuclear antibody (GCNA1; donated by Dr. G. Enders, University of Kansas) using his published method [20]. All the X-gal stained testes were embedded in paraffin, serially sectioned at 7 µm, and counterstained with neutral fast red or hematoxylin and eosin.
Statistics
Data were analyzed with SYSTAT by one-way ANOVA.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Donor germ cells from black and white Long-Evans rats were successfully transferred into 80 testes of 42 recipient white Sprague-Dawley rats. Three of the successfully transplanted rats had atrophic testes by 2 mo after the operation. The remaining 39 recipients were mated to white Sprague-Dawley females, 15 of which recovered fertility after transplantation. Four of the 15 (26.6%) recipient males sired young with black eyes and black and white skin, which must have been produced by donor-derived sperm (Fig. 1). All these male rats were from the FSH + cyclosporin + testosterone treatment group (Fig. 2); all four animals with this treatment produced some black and white offspring (Table 1) in the proportion of 220:17 pure white:black and white (Fig. 1a). To confirm paternity unequivocally, the haplotype of 12 of the 17 black and white offspring was identified by genetic analysis of DNA using simple sequence length polymorphisms (microsatellites). In every case, the microsatellite bands confirmed that the offspring must have been derived from the Long-Evans donor germ cells (Fig. 1b). Seven of the black and white F1 heterozygote males were mated with 7 of the black and white F1 heterozygote females, and 295 F2 generation progeny were produced, of which 78 (26.4%) were albino and 217 (73.6%) were black and white. This ratio was not statistically different from the expected 1:3 Mendelian ratio, and confirmed that the donor-derived offspring transmitted the donor genotype.
|
|
Cyclosporin treatment did not affect testicular or accessory organ weights, but animals treated with cyclosporin showed a decrease in body weight compared with animals that received no cyclosporin treatment (P < 0.05) (Table 1). Testicular size was reduced with testosterone treatment, so the volume of injected donor cells had to be lower (Table 1). No rats in the group treated with cyclosporin alone were fertile, but 23%–71% of the recipient rats in other groups recovered their fertility (Table 1).
Mouse Germ Cells Transplanted Into Recipient Rat Testes Develop Into Spermatozoa
Donor mouse germ cells were successfully transferred into 60 testes of 31 rats (Table 2). Mouse germ cells stained with X-gal had the greatest survival rate in the group treated with cyclosporin + testosterone; the mean X-gal staining score was significantly higher than in the control or single treatment groups (P < 0.05–0.01). The next highest survival rate was in the rats treated with cyclosporin plus FSH, which was significantly greater than in the controls (P < 0.05). All the nine testes with X-gal staining scores of 5 (Fig. 3a) were in the cyclosporin + testosterone (six) or cyclosporin + FSH (three) treatment groups.
Endogenous spermatogenesis recovered in many seminiferous tubules of untreated control rats, but there were only a few clumped degenerating LacZ positive (blue) mouse germ cells in one or two tubules. These blue cells were enclosed by the cytoplasm of the host's Sertoli cells. Occasionally, an entire necrotic seminiferous tubule containing degenerating mouse germ cells was surrounded by a generalized inflammatory response with many lymphocytes. Most testes in the group treated with testosterone only showed a good recovery of endogenous spermatogenesis, but very few blue germ cells were present. In the group treated with cyclosporin only with an X-gal score of 3–4, many tubules contained only Sertoli cells, but a few tubules had blue mouse spermatogonia that had colonized the basement membrane, and some had proliferated to 8–16 cells, but failed to undergo further spermatogenesis (Fig. 3b). The testes with an X-gal staining score of 5 showed endogenous spermatogenesis in most of the tubules and mouse spermatogonia had colonized the basement membrane of a few tubules and were undergoing spermatogenesis (Fig. 3c). In a longitudinal section of one tubule, interdigitating mouse and rat spermatogonia were present on the basement membrane, and all were undergoing spermatogenesis (Fig. 3d). Morphologically normal and motile mouse sperm were also found in the epididymis and vas deferens of one of these animals (Fig. 3e).
Cryptorchidism Increases the Proportion of Stem Spermatogonia in Donor Testes
Most spermatocytes and spermatids had disappeared from the testes of rats and mice 2 wk after experimental cryptorchidism, leaving a layer of spermatogonia and spermatocytes on the basement membrane or adjacent to the lumen. The germ cells in the testes of cryptorchid mice stained with GCNA1 (Fig. 3f). A total of 1084 donor mouse cells were counted in the lumen of the seminiferous tubules of a recipient rat testis 1 h after transplantation and 74.5% of them were GCNA1 positive (Fig. 3g).
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
After germ cell transplantation, the spermatogonial stem cells must enter a vacant niche in the recipient's Sertoli cells in order to carry out their dual functions of renewal and differentiation [22]. The administration of FSH neonatally to the future recipients is one possible way of increasing the number of Sertoli cells with their associated niches. Recent evidence has shown that Sertoli cells regulate spermatogonial stem cell replication and differentiation by producing glial cell line-derived neurotrophic factor (GDNF) [23]. Stem spermatogonia are located in niches on the basement membrane of the seminiferous tubule, enclosed by the basal lamina and the Sertoli cells [13]. The number of these niches is a critical determinant of stem germ cell number and function [5, 24–27]. When a stem germ cell divides, only one daughter cell remains in the niche as a stem cell, and the other must differentiate unless another niche is available [22, 25]. Because it is the Sertoli cells that provide the niches for the germ cells, the number of Sertoli cells is the key factor that decides the rate of sperm production because each Sertoli cell can support only a finite number of germ cells [28, 29]. Sertoli cell proliferation stops 2 wk after birth in rats [30], and FSH plays a key role in Sertoli cell proliferation in perinatal life [31]. Administration of FSH to neonatal rats greatly increases Sertoli cell number [32], and hence stem cell niches. The niches in the recipient testis need to be maximally vacated by depleting their endogenous germ cells for better donor stem cell colonization, otherwise the scale of donor cell colonization in an endogenous germ cell nonablated testis would be greatly reduced [33]. Our results and those of Shinohara et al. [33] suggest that the greater the germ cell depletion in the recipient testis, the higher the success rate of the transplantation procedure. Our results also showed that those recipient rats that had been treated with FSH neonatally were able to produce enough donor-derived spermatozoa to fertilize eggs, suggesting that neonatal FSH administration significantly improved the success of rat-to-rat germ cell transplantation.
Another possible way of improving the success rate of the transplantation procedure is to enrich the percentage of stem spermatogonia in the inoculum. Several studies have shown that of the potential stages of germ cell development—embryonic stem cells, primordial germ cells, gonocytes, or stem spermatogonia—the latter are the most likely to establish spermatogenesis in the recipient [4, 34]. It is well known that it is the later stages of spermatogenesis that are most sensitive to the increase in testicular temperature after experimental cryptorchidism, with spermatocytes and spermatids starting to undergo apoptosis 6 days after cryptorchidism [35], so that eventually, only undifferentiated type A spermatogonia remain [36, 37]. Therefore, experimental cryptorchidism is an effective method for enriching the population of stem spermatogonia in the testis, by increasing the stem spermatogonial yield 25-fold to 50-fold without adversely affecting their function in the mouse [36, 38]. One in 200 cells harvested from a cryptorchid testis is a stem germ cell [39], but only 1 in 5000 cells from a normal testis is a stem cell [40, 41]. However, the effects of cryptorchidism are different in rats and mice. In adult rats, 28 days of cryptorchidism permanently impaired the regeneration of spermatogenesis [42]. In contrast, 19 mo of cryptorchidism in mice did not prevent mouse stem spermatogonia from reinitiating spermatogenesis [43]. This might explain why donor germ cells in rats that had been cryptorchid for 2 mo failed to undergo spermatogenesis following rat-to-mouse germ cell transplantation [44]. Our results show that nearly 75% of the cryptorchid mouse testicular cells injected into the recipient testis are germ cells, and many of them would be stem spermatogonia.
Exogenous testosterone can stimulate spermatogenesis by inhibiting intratesticular testosterone concentrations [10, 45], and this seems to minimize the potential toxicity of cyclosporin [46, 47]. Our results also suggest that systemic testosterone administration improves the success of the transplantation procedure. Administration of exogenous testosterone to recipients would inhibit endogenous testicular testosterone production with atrophy of Leydig cells and reduction of Sertoli cell and myoid cell testosterone-dependent fluid secretion [48, 49], causing a decrease in testicular size after testosterone treatment.
The best results in this study were obtained when the donors were made surgically cryptorchid to enrich the number of stem spermatogonia being transferred, and the recipients were pretreated with FSH to increase the number of Sertoli cells. The combination of cyclosporin to suppress immunorejection and testosterone to enhance spermatogenesis in the donor cells further increased the success rate.
Spermatogenesis is a complex and precise process that is ultimately dependent on Sertoli cells for physical support, nutrient supply, and hormonal control. The length of the spermatogenic cycle varies greatly between species, but it is fixed within a species and cannot be experimentally altered [50]. Mice and rats diverged 10–11 million years ago, and they differ significantly in the length of their spermatogenic cycles: 35 days in mice and 52 days in rats [51]. It is the genotype of the germ cell, not the Sertoli cell environment, that controls the length of the spermatogenic cycle [50], because rat germ cells retain their 52-day cycle after transfer to the mouse testis [52]. In this study, we observed complete rat and mouse spermatogenesis within the same cross-sections of a rat seminiferous tubule, showing that rat Sertoli cells can support normal mouse spermatogenesis, which is in agreement with early reports [10, 50, 52, 53]. However, mouse Sertoli cells have failed to support spermatogenesis in any species other than rodents [54–57]. Rat and hamster sperm have been produced in the testes of immunodeficient nude mice, but these spermatozoa, as well as their precursor spermatids, were evidently abnormal [53, 58]. Attempts to induce rabbit, dog [54], boar, bull, stallion [55], monkey [56], or human [57] spermatogenesis in the testes of nude or SCID mice failed completely. It will be interesting to see whether the new procedures outlined in this paper increase the range of species in which it is possible to carry out successful interspecific germ cell transplantation.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Correspondence. FAX: 61 3 9348 1719; e-mail: m.renfree{at}zoology.unimelb.edu.au
Received: 1 August 2002.
First decision: 6 September 2002.
Accepted: 1 October 2002.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  M. Kanatsu-Shinohara, M. Kato, M. Takehashi, H. Morimoto, S. Takashima, S. Chuma, N. Nakatsuji, M. Hirabayashi, and T. Shinohara Production of Transgenic Rats via Lentiviral Transduction and Xenogeneic Transplantation of Spermatogonial Stem Cells Biol Reprod, December 1, 2008; 79(6): 1121 - 1128. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Zhang, J. Hill, M. Holland, Y. Kurihara, and K. L. Loveland Bovine Sertoli Cells Colonize and Form Tubules in Murine Hosts Following Transplantation and Grafting Procedures J Androl, July 1, 2008; 29(4): 418 - 430. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. E. Orwig, B.-Y. Ryu, S. R. Master, B. T. Phillips, M. Mack, M. R. Avarbock, L. Chodosh, and R. L. Brinster Genes Involved in Post-Transcriptional Regulation Are Overrepresented in Stem/Progenitor Spermatogonia of Cryptorchid Mouse Testes Stem Cells, April 1, 2008; 26(4): 927 - 938. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.P. Milazzo, L. Vaudreuil, B. Cauliez, E. Gruel, L. Masse, N. Mousset-Simeon, B. Mace, and N. Rives Comparison of conditions for cryopreservation of testicular tissue from immature mice Hum. Reprod., January 1, 2008; 23(1): 17 - 28. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Herrid, S. Vignarajan, R. Davey, I. Dobrinski, and J. R Hill Successful transplantation of bovine testicular cells to heterologous recipients. Reproduction, October 1, 2006; 132(4): 617 - 624. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Zhang, S. Shao, and M. L. Meistrich Irradiated Mouse Testes Efficiently Support Spermatogenesis Derived From Donor Germ Cells of Mice and Rats J Androl, May 1, 2006; 27(3): 365 - 375. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Tournaye, E. Goossens, G. Verheyen, V. Frederickx, G. De Block, P. Devroey, and A. Van Steirteghem Preserving the reproductive potential of men and boys with cancer: current concepts and future prospects Hum. Reprod. Update, November 1, 2004; 10(6): 525 - 532. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Zhang, R.V. Short, T. Meehan, D.M. de Kretser, M.B. Renfree, and K.L. Loveland Functional Analysis of the Cooled Rat Testis J Androl, January 1, 2004; 25(1): 57 - 68. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kanatsu-Shinohara, S. Toyokuni, and T. Shinohara CD9 Is a Surface Marker on Mouse and Rat Male Germline Stem Cells Biol Reprod, January 1, 2004; 70(1): 70 - 75. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kanatsu-Shinohara, N. Ogonuki, K. Inoue, A. Ogura, S. Toyokuni, and T. Shinohara Restoration of fertility in infertile mice by transplantation of cryopreserved male germline stem cells Hum. Reprod., December 1, 2003; 18(12): 2660 - 2667. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Honaramooz, E. Behboodi, S. O. Megee, S. A. Overton, H. Galantino-Homer, Y. Echelard, and I. Dobrinski Fertility and Germline Transmission of Donor Haplotype Following Germ Cell Transplantation in Immunocompetent Goats Biol Reprod, October 1, 2003; 69(4): 1260 - 1264. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
