|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Female Reproductive Tract |
a Institute of Molecular Animal Breeding, Ludwig Maximilians University, 81377 Munich, Germany
b Gene Center of the Ludwig Maximilians University, 81377 Munich, Germany
c Bavarian Research Center for Biology of Reproduction, 85764 Oberschleissheim, Germany
| ABSTRACT |
|---|
|
|
|---|
female reproductive tract, gene regulation, mechanisms of hormone action, oviduct, ovulatory cycle
| INTRODUCTION |
|---|
|
|
|---|
, and endothelin-1 were higher in the ipsilateral oviduct than those at the contralateral side [3]. Furthermore, transport of sperm is predominantly directed to the ipsilateral oviduct, as has been shown by a study of humans [4]. In this context, an investigation of motility patterns of bovine oviducts showed a higher level of activity in the oviduct ipsilateral to the active ovary [5]. In bovine, a single dominant follicle is selected among a cohort of similarly sized follicles and is ovulated [6, 7]. This condition provides a useful model for studying the local effects on oviduct epithelial functions of the ipsilateral ovary, or the ovulated cumulus-oocyte complex, or both, by comparing gene expression profiles of ipsilateral and contralateral oviduct epithelia of the same animal. In the present study, we used a combination of suppression subtractive hybridization (SSH) and cDNA array hybridization to identify genes that are regulated in the postovulation period. Our data show that a substantial number of genes are differentially expressed in the ipsilateral versus the contralateral oviduct, providing for the first time a systematic analysis of local regulation of oviduct epithelial cell mRNA expression profiles.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The following oligonucleotides were used for SSH: complementary DNA primer 1: AACTGCGGCCGCGTACAGCT20VN, complementary DNA primer 2: GAGAT20VN, adapter 1: 5'-GTAATACGACTCACTA-TAGGGCTCGAGCGCGCCG-CAGGGCAGTG-3', adapter 1 reverse: 3'-GGGCGTCCCGTCAC-5', adapter 2: 5'-GTAATACGACTCACTA-TAGGGCAGGGCGTGGTGC-GCGCTGCTGG-3', adapter 2 reverse: 3'-GACGCGCGACGACC-5', polymerase chain reaction (PCR) primer 1: 5'-GTAATACGACTCACTATAGGGC-3', nested primer 1: 5'-TCGAGCGCGCCGCAGGGCAGTG-3', and nested primer 2: 5'-AGGGCGTGGTGCGCGCTGCTGG-3'.
Synchronization of Sexual Cycle and Isolation of Oviduct Epithelial Cells
Four cyclic heifers (Simmental Fleckvieh) between 21 and 36 mo of age at diestrus received an intravaginal P4-release device (1.94 g P4; Eazi-Breed CIDR; Animal Reproductive Technologies Ltd., Leominster, U.K.) for 11 days. After the device was removed, a single i.m. dose of 500 µg of Cloprostenol (Estrumate; Essex Tierarznei, München, Germany) was injected. Animals were observed for sexual behavior (i.e., toleration, sweating, vaginal mucus) to determine when the animals entered standing heat, which occurred around 56 h after Estrumate injection. To confirm physiological ovulation and sexual cycling, animals were examined by ultrasound-guided follicle monitoring (starting 48 h after Estrumate injection at 7-h intervals). The animals were killed 84 ± 7 h after standing heat occurred, and blood samples were drawn just before slaughter to measure serum P4 levels. All four animals displayed low serum P4 levels (around 0.3 ng/ml) and showed they had recently ovulated, as indicated by the presence of a very early corpus luteum.
Within 10 min after death, oviducts were trimmed free of surrounding tissue and ligated at the infundibulum and at the isthmus-uterus junction. The complete organs were rinsed with PBS containing 100 IU/ml of penicillin (Seromed, Berlin, Germany) and 100 µg/ml of streptomycin (Pen/Strep; Seromed) and disinfected with 70% ethanol. Epithelial cells were isolated by opening the oviduct longitudinally and scraping the mucosal epithelial layer with a sterile glass slide [2, 8]. Cells were transferred into a labeled cryotube and immediately dropped into liquid nitrogen for transport, and were stored at -80°C until further processing.
Isolation of RNA and Synthesis of cDNA for Subtractive Hybridization
Total RNA from bovine oviduct epithelial cells was isolated using Trizol (Invitrogen, Karlsruhe, Germany) according to the manufacturer's instructions. Double-stranded cDNA was synthesized starting with 80 µg of total RNA using Superscript II (Invitrogen) for first-strand synthesis and cDNA primer 1. The second strand was synthesized with RNase H, Escherichia coli DNA ligase, and E. coli DNA polymerase I (Invitrogen) according to the manufacturer's instructions.
Generation of Subtracted cDNA Libraries
Suppression subtractive hybridization was performed according to the methods described by Diatchenko et al. [9] with minor modifications. In animal 529, double-stranded cDNA from ipsilateral and contralateral epithelial cells was digested with RsaI. Tester cDNA was ligated overnight at 16°C to adapter 1 or adapter 2 in two separate reactions. The first step of subtractive hybridization was performed in a volume of 4 µl for 10 h with a 45-fold excess of driver. The second hybridization was performed in a volume of 9 µl for 20 h.
Suppression PCR was performed with the following parameters for primary PCR reactions: 75°C for 5 min; 96°C for 60 sec; 27, 29, and 31 cycles at 94°C for 30 sec, 66°C for 30 sec, and 72°C for 1.5 min, respectively; and 72°C for 3 min. PCR products were diluted 10-fold, and 1 µl of the dilution was used as a template for secondary PCR. This reaction was performed using nested primers with the following parameters: 96°C for 1 min; 14 cycles at 94°C for 30 sec, 68°C for 30 sec, and 72 °C for 1.5 min, respectively; and 72°C for 3 min. All PCR reactions were performed in a Perkin Elmer (Norwalk, CT) Cetus thermal cycler using the Advantage2 DNA Polymerase Mix (BD Clontech, Heidelberg, Germany).
PCR products were digested with BssHII, purified by agarose gel electrophoresis, and ligated overnight with the AscI-digested and dephosphorylated vector DNA (a derivative of pBSIISK-; Stratagene, Amsterdam, The Netherlands). The ligation reaction was introduced directly into E. coli SURE (Stratagene) by electroporation. The subtracted libraries were stored as glycerol stocks at -80°C.
Preparation of cDNA Arrays and Hybridization with cDNA Probes
After plating a part of the subtracted libraries on agar plates, bacterial clones were chosen and grown overnight at 37°C in 100 µl of Luria broth medium in 96-well microtiter plates. Bacterial suspensions were diluted 20-fold in TE buffer pH 8.0, incubated at 96°C for 10 min, and stored at -20°C. One microliter of this dilution was used as a template to amplify cDNA insertions via PCR in 96-well cycle plates. Reactions were performed in 20 µl and contained diluted bacterial cells, PCR buffer (peQLab, Erlangen, Germany), 200 pmol/µl deoxynucleotide triphosphates, 0.3 pmol/µl of the respective primers, and 1 unit of Taq DNA polymerase (peQLab). All PCR products were analyzed by 0.8% agarose gel electrophoresis. Fifteen microliters of PCR reactions were transferred to 384-well microtiter plates (Nunc, Roskilde, Denmark) containing 5 µl of 4x spotting buffer (80 mmol/l Tris-HCl pH 8, 4 M NaCl, 4 mmol/l EDTA, and bromophenol blue). PCR products (1536 in number) were spotted onto amphoterous nylon membranes (Quiabrane; Qiagen, Hilden, Germany) within an area of 2 x 5 cm. For spotting we used an Omnigrid Accent microarrayer (GeneMachines, San Carlos, CA) and solid pins (0.015 inches in diameter, SSP015; Telechem International, Sunnyvale, CA). Spotting was performed five times for each PCR product in the same position for sufficient and equal application. Thirty arrays were produced simultaneously. Spotted DNA was denatured by 0.5 N NaOH for 20 min at room temperature, and filters were baked for 30 min at 80°C and UV-crosslinked (120 mJ/cm2).
33P-labeled probes were generated from double-stranded cDNA made from 7.5 to 15 µg of total RNA. The High Prime reaction mixture (Roche Molecular Biochemicals, Mannheim, Germany) was used for labeling reactions (in a final volume of 20 µl). In addition to the labeled deoxycytidine triphosphate (dCTP), the reaction mixtures included unlabeled deoxyadenosine triphosphate (final concentration, 15 pmol/µl), dATP, deoxyguanosine triphosphate, and deoxythymidine 5'-triphosphate (final concentration of each, 100 pmol/µl). The labeled cDNA was purified with MicroSpin G-25 Columns (Amersham Biosciences, Freiburg, Germany) to remove unincorporated nucleotides and to estimate labeling efficiency. Prehybridization was performed for up to six arrays together in one 15-cm glass hybridization bottle as follows: three times for 10 min in 10 ml of 1x PBS/10% SDS at 65°C, twice for 10 min in 10 ml of 0.1x PBS/1% SDS at 85°C, and three times for 10 min in 10 ml of 1x PBS/10% SDS at 65°C.
Hybridization was performed in self-made plastic hybridization vials in 2 ml of 1x PBS pH 7.5/10% SDS for 30 to 50 h at 65°C. After hybridization, arrays were placed together in one 15-cm glass hybridization bottle and washed as follows: three times for 5 min in 10 ml of 1x PBS/10% SDS at 65°C, three times for 10 min in 10 ml of 1x PBS/10% SDS at 65°C, three times for 10 min in 10 ml of 0.1x PBS/1% SDS at 65°C, and twice for 5 min in 10 ml of 1x PBS/1% SDS/2 mmol/l EDTA at room temperature.
Filters were dried by baking them at 80°C for 20 min and were then exposed to storage phosphor screens (Amersham Biosciences). Phosphor screens were scanned with a Storm 860 PhosphorImager (Amersham Biosciences). Array evaluation was performed using AIDA Array software (Raytest, Straubenhardt, Germany).
Sequencing of cDNAs with Differential Hybridization Signals and Data Analysis
Complementary DNA fragments showing differential hybridization signals were sequenced directly from spotting solutions by automated DNA sequencing using an ABI PRISM 377XL96 sequencer (Applied Biosystems, Langen, Germany). Resulting sequences were compared with those in public databases using the basic local alignment search tool at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/blast/blast.cgi). Data on functions of identified genes, cDNAs, or proteins were obtained from linked databases; for example, UniGene (www.ncbi.nlm.nih.gov/uniGene/), LocusLink (www.ncbi.nlm.nih.gov/locusLink/), OMIM (www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=OMIM), and PubMed (www.ncbi.nlm.nih.gov/entrez/query.fcgi).
| RESULTS |
|---|
|
|
|---|
The amplified cDNA fragments were used to prepare cDNA arrays containing 1536 PCR products. RNA of all eight cell samples was isolated and converted to cDNA. This cDNA was used to prepare radioactively 33P-labeled hybridization probes. For every animal, pairwise array hybridizations with ipsilateral and contralateral probes were performed. For animals 527 and 529, hybridization was performed twice, resulting altogether in 6 pairwise array hybridizations or 12 individual hybridizations (Fig. 1, top panel). One cDNA array hybridization is exemplarily shown in Figure 1 (middle panel). Relative gene expression levels in ipsilateral epithelial cells compared with contralateral cells were determined for each individual cDNA fragment by comparing signal intensities using array evaluation software. Fifty-five cDNA fragments showing consistent differential hybridization signals were analyzed by DNA sequencing. A comparison of the sequences with public databases revealed 35 different cDNAs or genes.
|
Figure 1 (bottom panel) shows illustrations of the hybridization results of four selected genes. Complementary DNA fragments of these genes were represented two to seven times on the array (ORF1, seven times; nonselenium glutathione phospholipid hydroperoxide peroxidase [PHGPx], three times; Thymosin beta 4, three times; transmembrane 4 superfamily member 2 [TM4SF2], twice). The corresponding spots on the array are marked by colored circles (Fig. 1, middle panel). The graphs show the signal ratios between the ipsilateral and contralateral hybridization probes per animal. The number of useful hybridization signals for each gene is shown in columns and the standard deviation is specified (number of signals >1). Deviations of signal ratios within the same animal were lower than deviations between different animals. Nevertheless, the small deviations of expression ratios between animals suggest consistent mechanisms of gene regulation between ipsilateral and contralateral oviducts.
Figures 2 and 3 show hybridization signals for some selected genes. Signal differences between ipsilateral-specific and contralateral-specific probes are clearly visible and demonstrate that these genes are up-regulated or down-regulated in ipsilateral oviduct epithelia. Signal intensity among the different genes shown in Figures 2 and 3 varied in a broad range. For example, the signal for ORF1 (contralateral) was about 100-fold stronger than that for calcium-binding protein in amniotic fluid (CAAF1) (ipsilateral).
|
|
To obtain more information about the function of the identified genes, we searched several databases such as UniGene, LocusLink, OMIM, and PubMed. The results of these analyses are summarized in Tables 1 and 2. Table 1 lists all 27 genes with elevated expression levels in ipsilateral oviduct epithelial cells in descending order according to their expression ratio (ipsilateral:contralateral). Genes with many different functions were identified. The functions of three genes are still unknown. In most cases, the bovine genes were not in the database, but human or other mammalian homologs were found. The expression ratios (mean values) were in the range of 4.6-fold to 1.4-fold. Standard deviations were in general very low, especially for expression ratios below 2.0. Up-regulated expression was detected for most genes in all four animals. Three genes were up-regulated in at least three animals, and three additional genes were up-regulated in only one animal (Table 1, Animals column). In the majority of these, expression in the other animals either was not detectable or signals were not precisely measurable. For example, Bos taurus CAAF1 was clearly up-regulated in the ipsilateral oviduct epithelium in animal 527 (Fig. 2). In all other animals, expression of this gene was not detectable. The number of useful hybridization ratios is also shown in Table 1. Ratios falsified by signals that were affected by background or neighboring strong signals, and signals that were not detectable, were excluded. Genes with a number of hybridization ratios greater than six were represented more than one time on the array.
|
|
Table 2 shows all eight genes that were down-regulated in ipsilateral cells compared with contralateral cells. Again, genes with different functions were found, and the functions of two genes are unknown. Expression ratios between contralateral and ipsilateral epithelial cells ranged from 2.4-fold to 1.4-fold. Down-regulated expression was detected for five genes in all four animals, for two genes in three animals, and for one gene in two animals (Table 2, Animals column).
| DISCUSSION |
|---|
|
|
|---|
The comparison of ipsilateral and contralateral epithelial cells holds the advantage that neither individual-specific differences in the sexual cycle nor the different genetic backgrounds of individuals influence the results of gene expression analysis. We performed our gene expression analysis at Day 3.5 after standing heat, a phase in which after successful fertilization an early embryo is present in the ipsilateral oviduct. The present study evaluated which genes are regulated by the presence of a nonfertilized oocyte and its surrounding cumulus cells or due to signals produced by the ipsilateral ovary. Thus, the data generated here will be the basis for future studies aiming at the analysis of early embryo-maternal communication.
Altogether, oviductal cells of four animals were analyzed to show that reproducible expression differences can be found. In order to identify differentially expressed genes, a combination of subtracted cDNA libraries and cDNA microarray analysis was used. Subtracted cDNA libraries allowed us to enrich genes of interest and to reduce the number of cDNA clones that had to be analyzed. For a first analysis of the subtracted libraries, expression of 1536 cDNA clones was monitored by microarray hybridization. For every animal, expression was compared in ipsilateral and contralateral epithelial cells.
We have identified gene expression differences of 1.4-fold to 4.6-fold between ipsilateral and contralateral oviduct epithelium for 35 genes. These differences seemed to be not very high, however, we saw that the weak signals in particular were sometimes affected by neighboring strong signals, which resulted in lower ratios. Furthermore, we must consider that epithelial cells of the entire oviduct were used for microarray analysis. It is likely that the difference in mRNA abundance is much greater in specific parts of the oviduct. This must be confirmed in future studies (e.g., by in situ hybridization).
Reproducibility of hybridization results is exemplarily shown in Figure 1 for four different genes that were represented by two to seven cDNA fragments on the microarray. The graphs indicate that deviations of the expression level ratios were smaller within one animal than between different animals. This may reflect individual differences in the sexual cycle or the individual genetic background. Nevertheless, the variation between animals was also surprisingly small. For most genes the coefficient of variation was in the range of 30% or below. Thus, the accuracy of our analysis was high enough for reproducible detection of even 1.4-fold differences in signal intensity.
Most of the genes showed differential expression in all four animals, but two genes showed this only in one animal. For example, differential expression of Bos taurus CAAF1 mRNA, which belongs to the family of calgranulins that are described as calcium- and zinc-binding proteins involved in the immune response to microbes and parasites [11], could reflect a local immune reaction rather than side-specific regulation in oviductal epithelium at Day 3.5 after standing heat. Expression of this gene was not detectable in the oviductal cells of the other animals.
Little is known about differential gene expression in bovine oviduct epithelial cells, and nearly nothing is known about differential expression between ipsilateral and contralateral oviduct epithelia. Thus, our experiments represent a real pilot study. However, data found in the literature indicate that the identified genes may be involved in oviduct-specific functions. Some genes are already described to be regulated during the sexual cycle. For example, thymosin beta 4 was found to be elevated in bovine plasma at estrus [12], and secretion of oviduct-specific glycoprotein is found to be highest around the time of ovulation [1]. It is interesting that the oviduct-specific glycoprotein mRNA was found to be slightly down-regulated at Day 3.5 after standing heat in the ipsilateral oviduct compared with that of the contralateral side. Similarly, B. taurus ORF1 mRNA was among the more abundant transcripts, but was expressed at a lower level in ipsilateral than in contralateral oviduct epithelial cells.
Furthermore, differential regulation of mRNA abundance was found for various enzymes. B. taurus PHGPx was found to be up-regulated in the ipsilateral oviduct. This enzyme shows antiperoxidant effects, modulates cyclooxygenase, and inhibits 15-lipoxygenase [13, 14]. PHGPx has been described as being important for development and fertilizing capacity of sperm cells [15]. A positive effect of PHGPx in the oviduct on oocytes and early stage embryos might be assumed. Another enzyme whose mRNA expression was up-regulated in the ipsilateral oviduct, the ornithine decarboxylasea critical enzyme in polyamine biosynthesis [16]was shown to be up-regulated by E2 in the chick oviduct [17].
The mRNAs for acetyl-coenzyme A acyltransferase 2 (ACAA2, 3-ketoacyl CoA thiolase), the last enzyme of the beta-oxidation of fatty acids [18], and 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR), which catalyzes the rate-limiting step in the biosynthesis of sterols and isoprenoids [19], were up-regulated in the ipsilateral oviduct. Similarly, the mRNA abundance for sterol carrier protein 2 (SCP-2), another protein involved in lipid metabolism, was higher in the ipsilateral than the contralateral oviduct epithelium. SCP-2 transfers a variety of lipids such as cholesterol between membranes. SCP-2 mRNA expression was found to be induced in corpora lutea of E2-treated rats [20]. It is interesting that SCP-x, a 58-kDa protein, contains the complete SCP-2 protein at the C-terminus and its N-terminus exhibits 3-ketoacyl coenzyme A thiolase activity [21].
We noticed that many genes for cell surface proteins or proteins that play a role in cell-cell interactions were differentially regulated between ipsilateral and contralateral oviduct epithelia. The mRNAs for tight junction protein 1/zona occludens 1, claudin 1, and TM4SF2 were found to be expressed at a higher level in the ipsilateral versus the contralateral oviduct epithelium. Tight junction protein 1 and claudin 1 show interaction in tight junctions of epithelia [22]. TM4SF2 is a member of the tetraspanin gene family that is probably involved in signal transduction and cell-cell interactions by the binding of integrins [23].
Further, some immune-related genes were identified, such as the polymeric immunoglobulin receptor and lactoferrin. The mRNA expression level of the polymeric immunoglobulin receptor was decreased 2.4-fold in the ipsilateral oviduct. Kaushic et al. [24] showed an E2-dependent expression of this gene with the highest levels at proestrus and estrus. Lactoferrin mRNA was up-regulated by
3-fold in the ipsilateral oviduct of three of the four heifers investigated. Lactoferrin expression was also shown in the oviduct of mice and is the major E2-inducible protein in the murine uterus, with highest expression at estrus [25, 26]. Singh et al. [27] showed that lactoferrin is a ubiquitous and abundant constituent of external secretions and represents a component of the innate immune system having antimicrobial activity by preventing bacterial biofilm development. The observation that nonspecific components of the immune system such as, in particular lactoferrin and LANCL1, a new member of the eukaryotic LanC-like protein family, which is involved in the synthesis of antimicrobial peptides [28], are up-regulated in the ipsilateral oviduct, deserves further investigation.
In summary, our findings show for the first time a way to study the complex regulation of mRNA abundance for multiple genes from different functional classes in the ipsilateral versus the contralateral oviduct in the postovulation period. These findings indicate important local regulatory mechanisms of oviduct epithelial function either by the ipsilateral ovary or by the ovulated cumulus-oocyte complex. Future studies will follow these candidates at the protein level. The transcriptomics approach used in the present study appears to be highly sensitive and reproducible, providing a promising tool for a holistic analysis of interactions of gametes and embryos with their maternal environment.
| FOOTNOTES |
|---|
2 Correspondence: Eckhard Wolf, Institute of Molecular Animal Breeding, Ludwig Maximilians University, Feodor-Lynen-Str. 25, 81377 Munich, Germany. FAX: 49 89 218076849; ewolf{at}lmb.uni-muenchen.de ![]()
3 Present address: Institute of Physiology, Technical University Munich-Weihenstephan, Weihenstephaner Berg 3, 85350 Freising, Germany ![]()
Received: 30 August 2002.
First decision: 25 September 2002.
Accepted: 11 October 2002.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. Fazeli and E. Pewsey Maternal communication with gametes and embryos: a complex interactome Brief Funct Genomic Proteomic, March 1, 2008; 7(2): 111 - 118. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Mitko, S. E Ulbrich, H. Wenigerkind, F. Sinowatz, H. Blum, E. Wolf, and S. Bauersachs Dynamic changes in messenger RNA profiles of bovine endometrium during the oestrous cycle Reproduction, February 1, 2008; 135(2): 225 - 240. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bauersachs, K. Mitko, H. Blum, and E. Wolf Technical Note: Bovine Oviduct and Endometrium Array Version 1: A Tailored Tool for Studying Bovine Endometrium Biology and Pathophysiology J Dairy Sci, September 1, 2007; 90(9): 4420 - 4423. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P Kodithuwakku, A. Miyamoto, and M. P B Wijayagunawardane Spermatozoa stimulate prostaglandin synthesis and secretion in bovine oviductal epithelial cells Reproduction, June 1, 2007; 133(6): 1087 - 1094. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Rottmayer, S. E Ulbrich, S. Kolle, K. Prelle, C. Neumueller, F. Sinowatz, H. H D Meyer, E. Wolf, and S. Hiendleder A bovine oviduct epithelial cell suspension culture system suitable for studying embryo-maternal interactions: morphological and functional characterization. Reproduction, October 1, 2006; 132(4): 637 - 648. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bauersachs, S. E Ulbrich, K. Gross, S. E M Schmidt, H. H D Meyer, H. Wenigerkind, M. Vermehren, F. Sinowatz, H. Blum, and E. Wolf Embryo-induced transcriptome changes in bovine endometrium reveal species-specific and common molecular markers of uterine receptivity. Reproduction, August 1, 2006; 132(2): 319 - 331. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Klein, S. Bauersachs, S. E. Ulbrich, R. Einspanier, H. H.D. Meyer, S. E.M. Schmidt, H.-D. Reichenbach, M. Vermehren, F. Sinowatz, H. Blum, et al. Monozygotic Twin Model Reveals Novel Embryo-Induced Transcriptome Changes of Bovine Endometrium in the Preattachment Period Biol Reprod, February 1, 2006; 74(2): 253 - 264. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-F. Lee, J.-S. Xu, Y.-L. Lee, and W. S. B. Yeung Demilune Cell and Parotid Protein from Murine Oviductal Epithelium Stimulates Preimplantation Embryo Development Endocrinology, January 1, 2006; 147(1): 79 - 87. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Georgiou, E. Sostaric, C. H. Wong, A. P. L. Snijders, P. C. Wright, H. D. Moore, and A. Fazeli Gametes Alter the Oviductal Secretory Proteome Mol. Cell. Proteomics, November 1, 2005; 4(11): 1785 - 1796. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Bauersachs, S E Ulbrich, K Gross, S E M Schmidt, H H D Meyer, R Einspanier, H Wenigerkind, M Vermehren, H Blum, F Sinowatz, et al. Gene expression profiling of bovine endometrium during the oestrous cycle: detection of molecular pathways involved in functional changes J. Mol. Endocrinol., June 1, 2005; 34(3): 889 - 908. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fazeli, N. A. Affara, M. Hubank, and W. V. Holt Sperm-Induced Modification of the Oviductal Gene Expression Profile After Natural Insemination in Mice Biol Reprod, July 1, 2004; 71(1): 60 - 65. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |