Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print October 30, 2002.
Biol Reprod 2002, 10.1095/biolreprod.102.010660
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
68/4/1170    most recent
biolreprod.102.010660v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bauersachs, S.
Right arrow Articles by Wolf, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bauersachs, S.
Right arrow Articles by Wolf, E.
Agricola
Right arrow Articles by Bauersachs, S.
Right arrow Articles by Wolf, E.
BIOLOGY OF REPRODUCTION 68, 1170–1177 (2003)
DOI: 10.1095/biolreprod.102.010660
© 2003 by the Society for the Study of Reproduction, Inc.


Female Reproductive Tract

Regulation of Ipsilateral and Contralateral Bovine Oviduct Epithelial Cell Function in the Postovulation Period: A Transcriptomics Approach1

Stefan Bauersachsa, Helmut Blumb, Sylvia Mallokb, Hendrik Wenigerkindc, Stephanie Rief3,a, Katja Prellea, and Eckhard Wolf2,a

a Institute of Molecular Animal Breeding, Ludwig Maximilians University, 81377 Munich, Germany b Gene Center of the Ludwig Maximilians University, 81377 Munich, Germany c Bavarian Research Center for Biology of Reproduction, 85764 Oberschleissheim, Germany


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We studied differential gene expression in ipsilateral and contralateral bovine oviduct epithelial cells using a combination of subtracted cDNA libraries and cDNA array hybridization. Four Simmental heifers were synchronized and slaughtered 3.5 days after they entered standing heat. Epithelial cells were isolated from ipsilateral and contralateral oviducts. To identify genes that are differentially regulated in ipsilateral and contralateral epithelium, subtracted cDNA libraries were produced by suppression subtractive hybridization and analyzed by cDNA array hybridization. Sequencing of cDNAs showing differential expression levels in ipsilateral and contralateral epithelium revealed 35 different cDNAs, 30 of which matched genes with known functions and 5 of which matched genes without a known function. The majority of genes (n = 27) were expressed at a higher level in the ipsilateral oviduct, but for some genes (n = 8), mRNA abundance was higher in the contralateral oviduct. The regulated genes or their products include a variety of functional classes such as cell-surface proteins, cell-cell interaction proteins, members of signal transduction pathways, immune-related proteins, and enzymes. Identification of genes differentially regulated in ipsilateral and contralateral oviduct epithelial cells is the first step toward a systematic analysis of local mechanisms that regulate the function of the bovine oviduct epithelium in the postovulation period.

female reproductive tract, gene regulation, mechanisms of hormone action, oviduct, ovulatory cycle


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The oviduct plays a central role in mammalian reproduction, providing the microenvironment for the final maturation of gametes, capacitation of spermatozoa, transport of gametes, fertilization, and early cleavage-stage embryonic development (for a review, see [1]). To fulfill these specialized tasks the oviduct epithelium undergoes marked morphological and functional changes during the estrous cycle (reviewed in [2]). A prominent example of endocrine-regulated stage-specific oviduct function is the secretion of oviduct-specific, estrogen-dependent glycoproteins that have been discovered in different species and have been shown to interact with spermatozoa, oocytes, and early embryos (for a review, see [1]). In addition to endocrine-induced functional changes of the oviduct epithelium, local regulatory mechanisms may be important as well. For example, a study of concentrations of different hormones in the bovine oviduct revealed that concentrations of progesterone (P4), estradiol 17ß (E2), prostaglandin E2, prostaglandin F2{alpha}, and endothelin-1 were higher in the ipsilateral oviduct than those at the contralateral side [3]. Furthermore, transport of sperm is predominantly directed to the ipsilateral oviduct, as has been shown by a study of humans [4]. In this context, an investigation of motility patterns of bovine oviducts showed a higher level of activity in the oviduct ipsilateral to the active ovary [5].

In bovine, a single dominant follicle is selected among a cohort of similarly sized follicles and is ovulated [6, 7]. This condition provides a useful model for studying the local effects on oviduct epithelial functions of the ipsilateral ovary, or the ovulated cumulus-oocyte complex, or both, by comparing gene expression profiles of ipsilateral and contralateral oviduct epithelia of the same animal. In the present study, we used a combination of suppression subtractive hybridization (SSH) and cDNA array hybridization to identify genes that are regulated in the postovulation period. Our data show that a substantial number of genes are differentially expressed in the ipsilateral versus the contralateral oviduct, providing for the first time a systematic analysis of local regulation of oviduct epithelial cell mRNA expression profiles.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Oligonucleotides for SSH

The following oligonucleotides were used for SSH: complementary DNA primer 1: AACTGCGGCCGCGTACAGCT20VN, complementary DNA primer 2: GAGAT20VN, adapter 1: 5'-GTAATACGACTCACTA-TAGGGCTCGAGCGCGCCG-CAGGGCAGTG-3', adapter 1 reverse: 3'-GGGCGTCCCGTCAC-5', adapter 2: 5'-GTAATACGACTCACTA-TAGGGCAGGGCGTGGTGC-GCGCTGCTGG-3', adapter 2 reverse: 3'-GACGCGCGACGACC-5', polymerase chain reaction (PCR) primer 1: 5'-GTAATACGACTCACTATAGGGC-3', nested primer 1: 5'-TCGAGCGCGCCGCAGGGCAGTG-3', and nested primer 2: 5'-AGGGCGTGGTGCGCGCTGCTGG-3'.

Synchronization of Sexual Cycle and Isolation of Oviduct Epithelial Cells

Four cyclic heifers (Simmental Fleckvieh) between 21 and 36 mo of age at diestrus received an intravaginal P4-release device (1.94 g P4; Eazi-Breed CIDR; Animal Reproductive Technologies Ltd., Leominster, U.K.) for 11 days. After the device was removed, a single i.m. dose of 500 µg of Cloprostenol (Estrumate; Essex Tierarznei, München, Germany) was injected. Animals were observed for sexual behavior (i.e., toleration, sweating, vaginal mucus) to determine when the animals entered standing heat, which occurred around 56 h after Estrumate injection. To confirm physiological ovulation and sexual cycling, animals were examined by ultrasound-guided follicle monitoring (starting 48 h after Estrumate injection at 7-h intervals). The animals were killed 84 ± 7 h after standing heat occurred, and blood samples were drawn just before slaughter to measure serum P4 levels. All four animals displayed low serum P4 levels (around 0.3 ng/ml) and showed they had recently ovulated, as indicated by the presence of a very early corpus luteum.

Within 10 min after death, oviducts were trimmed free of surrounding tissue and ligated at the infundibulum and at the isthmus-uterus junction. The complete organs were rinsed with PBS containing 100 IU/ml of penicillin (Seromed, Berlin, Germany) and 100 µg/ml of streptomycin (Pen/Strep; Seromed) and disinfected with 70% ethanol. Epithelial cells were isolated by opening the oviduct longitudinally and scraping the mucosal epithelial layer with a sterile glass slide [2, 8]. Cells were transferred into a labeled cryotube and immediately dropped into liquid nitrogen for transport, and were stored at -80°C until further processing.

Isolation of RNA and Synthesis of cDNA for Subtractive Hybridization

Total RNA from bovine oviduct epithelial cells was isolated using Trizol (Invitrogen, Karlsruhe, Germany) according to the manufacturer's instructions. Double-stranded cDNA was synthesized starting with 80 µg of total RNA using Superscript II (Invitrogen) for first-strand synthesis and cDNA primer 1. The second strand was synthesized with RNase H, Escherichia coli DNA ligase, and E. coli DNA polymerase I (Invitrogen) according to the manufacturer's instructions.

Generation of Subtracted cDNA Libraries

Suppression subtractive hybridization was performed according to the methods described by Diatchenko et al. [9] with minor modifications. In animal 529, double-stranded cDNA from ipsilateral and contralateral epithelial cells was digested with RsaI. Tester cDNA was ligated overnight at 16°C to adapter 1 or adapter 2 in two separate reactions. The first step of subtractive hybridization was performed in a volume of 4 µl for 10 h with a 45-fold excess of driver. The second hybridization was performed in a volume of 9 µl for 20 h.

Suppression PCR was performed with the following parameters for primary PCR reactions: 75°C for 5 min; 96°C for 60 sec; 27, 29, and 31 cycles at 94°C for 30 sec, 66°C for 30 sec, and 72°C for 1.5 min, respectively; and 72°C for 3 min. PCR products were diluted 10-fold, and 1 µl of the dilution was used as a template for secondary PCR. This reaction was performed using nested primers with the following parameters: 96°C for 1 min; 14 cycles at 94°C for 30 sec, 68°C for 30 sec, and 72 °C for 1.5 min, respectively; and 72°C for 3 min. All PCR reactions were performed in a Perkin Elmer (Norwalk, CT) Cetus thermal cycler using the Advantage2 DNA Polymerase Mix (BD Clontech, Heidelberg, Germany).

PCR products were digested with BssHII, purified by agarose gel electrophoresis, and ligated overnight with the AscI-digested and dephosphorylated vector DNA (a derivative of pBSIISK-; Stratagene, Amsterdam, The Netherlands). The ligation reaction was introduced directly into E. coli SURE (Stratagene) by electroporation. The subtracted libraries were stored as glycerol stocks at -80°C.

Preparation of cDNA Arrays and Hybridization with cDNA Probes

After plating a part of the subtracted libraries on agar plates, bacterial clones were chosen and grown overnight at 37°C in 100 µl of Luria broth medium in 96-well microtiter plates. Bacterial suspensions were diluted 20-fold in TE buffer pH 8.0, incubated at 96°C for 10 min, and stored at -20°C. One microliter of this dilution was used as a template to amplify cDNA insertions via PCR in 96-well cycle plates. Reactions were performed in 20 µl and contained diluted bacterial cells, PCR buffer (peQLab, Erlangen, Germany), 200 pmol/µl deoxynucleotide triphosphates, 0.3 pmol/µl of the respective primers, and 1 unit of Taq DNA polymerase (peQLab). All PCR products were analyzed by 0.8% agarose gel electrophoresis. Fifteen microliters of PCR reactions were transferred to 384-well microtiter plates (Nunc, Roskilde, Denmark) containing 5 µl of 4x spotting buffer (80 mmol/l Tris-HCl pH 8, 4 M NaCl, 4 mmol/l EDTA, and bromophenol blue). PCR products (1536 in number) were spotted onto amphoterous nylon membranes (Quiabrane; Qiagen, Hilden, Germany) within an area of 2 x 5 cm. For spotting we used an Omnigrid Accent microarrayer (GeneMachines, San Carlos, CA) and solid pins (0.015 inches in diameter, SSP015; Telechem International, Sunnyvale, CA). Spotting was performed five times for each PCR product in the same position for sufficient and equal application. Thirty arrays were produced simultaneously. Spotted DNA was denatured by 0.5 N NaOH for 20 min at room temperature, and filters were baked for 30 min at 80°C and UV-crosslinked (120 mJ/cm2).

33P-labeled probes were generated from double-stranded cDNA made from 7.5 to 15 µg of total RNA. The High Prime reaction mixture (Roche Molecular Biochemicals, Mannheim, Germany) was used for labeling reactions (in a final volume of 20 µl). In addition to the labeled deoxycytidine triphosphate (dCTP), the reaction mixtures included unlabeled deoxyadenosine triphosphate (final concentration, 15 pmol/µl), dATP, deoxyguanosine triphosphate, and deoxythymidine 5'-triphosphate (final concentration of each, 100 pmol/µl). The labeled cDNA was purified with MicroSpin G-25 Columns (Amersham Biosciences, Freiburg, Germany) to remove unincorporated nucleotides and to estimate labeling efficiency. Prehybridization was performed for up to six arrays together in one 15-cm glass hybridization bottle as follows: three times for 10 min in 10 ml of 1x PBS/10% SDS at 65°C, twice for 10 min in 10 ml of 0.1x PBS/1% SDS at 85°C, and three times for 10 min in 10 ml of 1x PBS/10% SDS at 65°C.

Hybridization was performed in self-made plastic hybridization vials in 2 ml of 1x PBS pH 7.5/10% SDS for 30 to 50 h at 65°C. After hybridization, arrays were placed together in one 15-cm glass hybridization bottle and washed as follows: three times for 5 min in 10 ml of 1x PBS/10% SDS at 65°C, three times for 10 min in 10 ml of 1x PBS/10% SDS at 65°C, three times for 10 min in 10 ml of 0.1x PBS/1% SDS at 65°C, and twice for 5 min in 10 ml of 1x PBS/1% SDS/2 mmol/l EDTA at room temperature.

Filters were dried by baking them at 80°C for 20 min and were then exposed to storage phosphor screens (Amersham Biosciences). Phosphor screens were scanned with a Storm 860 PhosphorImager (Amersham Biosciences). Array evaluation was performed using AIDA Array software (Raytest, Straubenhardt, Germany).

Sequencing of cDNAs with Differential Hybridization Signals and Data Analysis

Complementary DNA fragments showing differential hybridization signals were sequenced directly from spotting solutions by automated DNA sequencing using an ABI PRISM 377XL96 sequencer (Applied Biosystems, Langen, Germany). Resulting sequences were compared with those in public databases using the basic local alignment search tool at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/blast/blast.cgi). Data on functions of identified genes, cDNAs, or proteins were obtained from linked databases; for example, UniGene (www.ncbi.nlm.nih.gov/uniGene/), LocusLink (www.ncbi.nlm.nih.gov/locusLink/), OMIM (www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=OMIM), and PubMed (www.ncbi.nlm.nih.gov/entrez/query.fcgi).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Our comparison of gene expression at the transcriptional level between ipsilateral and contralateral oviduct epithelial cells at Day 3.5 after standing heat was based on the cell material of four different heifers. Cells of animal 529 were used to construct two subtracted cDNA libraries to enrich genes showing differential expression in ipsilateral and contralateral oviduct epithelial cells. Subtractive hybridization was performed using SSH [9, 10]. Subtracted cDNA fragments were used to generate subtracted libraries, resulting in about 185 000 (for the ipsilateral library) and 140 000 (for the contralateral library) independent cDNA clones. Eight-hundred sixty-four individual clones from the ipsilateral library and 672 from the contralateral library were chosen, their cDNA inserts were amplified by PCR, and analyzed by agarose gel electrophoresis. More than 95% of the clones yielded defined PCR products of their cDNA insertions. The average lengths of the DNA fragments were approximately 500 base pairs (bp) in a range of 200 to 2000 bp.

The amplified cDNA fragments were used to prepare cDNA arrays containing 1536 PCR products. RNA of all eight cell samples was isolated and converted to cDNA. This cDNA was used to prepare radioactively 33P-labeled hybridization probes. For every animal, pairwise array hybridizations with ipsilateral and contralateral probes were performed. For animals 527 and 529, hybridization was performed twice, resulting altogether in 6 pairwise array hybridizations or 12 individual hybridizations (Fig. 1, top panel). One cDNA array hybridization is exemplarily shown in Figure 1 (middle panel). Relative gene expression levels in ipsilateral epithelial cells compared with contralateral cells were determined for each individual cDNA fragment by comparing signal intensities using array evaluation software. Fifty-five cDNA fragments showing consistent differential hybridization signals were analyzed by DNA sequencing. A comparison of the sequences with public databases revealed 35 different cDNAs or genes.



View larger version (82K):
[in this window]
[in a new window]
 
FIG. 1. Complementary DNA array hybridization of ipsilateral and contralateral epithelial cells. Six pairwise array hybridizations were performed using radioactive 33P-labeled probes prepared from ipsilateral and contralateral epithelial cells of four animals (top). In the middle panel, one microarray image is enlarged. Signals of four selected genes (B. taurus ORF1, B. taurus PHGPx, thymosin beta 4, and TM4SF2) are marked by colored circles. The bottom panel illustrates ratios of ipsilateral and contralateral signals of these genes. Mean values and standard deviations are shown itemized for the four animals. The number of useful values for calculation appears in the columns

Figure 1 (bottom panel) shows illustrations of the hybridization results of four selected genes. Complementary DNA fragments of these genes were represented two to seven times on the array (ORF1, seven times; nonselenium glutathione phospholipid hydroperoxide peroxidase [PHGPx], three times; Thymosin beta 4, three times; transmembrane 4 superfamily member 2 [TM4SF2], twice). The corresponding spots on the array are marked by colored circles (Fig. 1, middle panel). The graphs show the signal ratios between the ipsilateral and contralateral hybridization probes per animal. The number of useful hybridization signals for each gene is shown in columns and the standard deviation is specified (number of signals >1). Deviations of signal ratios within the same animal were lower than deviations between different animals. Nevertheless, the small deviations of expression ratios between animals suggest consistent mechanisms of gene regulation between ipsilateral and contralateral oviducts.

Figures 2 and 3 show hybridization signals for some selected genes. Signal differences between ipsilateral-specific and contralateral-specific probes are clearly visible and demonstrate that these genes are up-regulated or down-regulated in ipsilateral oviduct epithelia. Signal intensity among the different genes shown in Figures 2 and 3 varied in a broad range. For example, the signal for ORF1 (contralateral) was about 100-fold stronger than that for calcium-binding protein in amniotic fluid (CAAF1) (ipsilateral).



View larger version (51K):
[in this window]
[in a new window]
 
FIG. 2. Hybridization signals of six selected genes up-regulated in ipsilateral epithelial cells. The hybridization signals of the genes for TM4SF2, membrane-associated protein 17 (MAP17), lactoferrin, SCP-2, Thy-1 glycoprotein, and Thy-1 cotranscribed protein, and B. taurus CAAF1 are enlarged for better illustration. The respective signals are marked with arrows



View larger version (59K):
[in this window]
[in a new window]
 
FIG. 3. Hybridization signals of five selected genes down-regulated in ipsilateral epithelial cells. The hybridization signals of the genes for B. taurus polymeric immunoglobulin receptor, B. taurus complement component C4, fibrillin 1, B. taurus ORF1, and one unknown gene are enlarged for better illustration. The respective signals are marked with arrows

To obtain more information about the function of the identified genes, we searched several databases such as UniGene, LocusLink, OMIM, and PubMed. The results of these analyses are summarized in Tables 1 and 2. Table 1 lists all 27 genes with elevated expression levels in ipsilateral oviduct epithelial cells in descending order according to their expression ratio (ipsilateral:contralateral). Genes with many different functions were identified. The functions of three genes are still unknown. In most cases, the bovine genes were not in the database, but human or other mammalian homologs were found. The expression ratios (mean values) were in the range of 4.6-fold to 1.4-fold. Standard deviations were in general very low, especially for expression ratios below 2.0. Up-regulated expression was detected for most genes in all four animals. Three genes were up-regulated in at least three animals, and three additional genes were up-regulated in only one animal (Table 1, Animals column). In the majority of these, expression in the other animals either was not detectable or signals were not precisely measurable. For example, Bos taurus CAAF1 was clearly up-regulated in the ipsilateral oviduct epithelium in animal 527 (Fig. 2). In all other animals, expression of this gene was not detectable. The number of useful hybridization ratios is also shown in Table 1. Ratios falsified by signals that were affected by background or neighboring strong signals, and signals that were not detectable, were excluded. Genes with a number of hybridization ratios greater than six were represented more than one time on the array.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Genes up-regulated in ipsilateral oviduct


View this table:
[in this window]
[in a new window]
 
TABLE 2. Genes down-regulated in ipsilateral oviduct

Table 2 shows all eight genes that were down-regulated in ipsilateral cells compared with contralateral cells. Again, genes with different functions were found, and the functions of two genes are unknown. Expression ratios between contralateral and ipsilateral epithelial cells ranged from 2.4-fold to 1.4-fold. Down-regulated expression was detected for five genes in all four animals, for two genes in three animals, and for one gene in two animals (Table 2, Animals column).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Our objective was to investigate the effects of local regulation mechanisms at the transcriptional level in bovine oviducts. For the first time we have identified differential gene expression between ipsilateral and contralateral bovine oviduct epithelial cells at Day 3.5 after standing heat.

The comparison of ipsilateral and contralateral epithelial cells holds the advantage that neither individual-specific differences in the sexual cycle nor the different genetic backgrounds of individuals influence the results of gene expression analysis. We performed our gene expression analysis at Day 3.5 after standing heat, a phase in which after successful fertilization an early embryo is present in the ipsilateral oviduct. The present study evaluated which genes are regulated by the presence of a nonfertilized oocyte and its surrounding cumulus cells or due to signals produced by the ipsilateral ovary. Thus, the data generated here will be the basis for future studies aiming at the analysis of early embryo-maternal communication.

Altogether, oviductal cells of four animals were analyzed to show that reproducible expression differences can be found. In order to identify differentially expressed genes, a combination of subtracted cDNA libraries and cDNA microarray analysis was used. Subtracted cDNA libraries allowed us to enrich genes of interest and to reduce the number of cDNA clones that had to be analyzed. For a first analysis of the subtracted libraries, expression of 1536 cDNA clones was monitored by microarray hybridization. For every animal, expression was compared in ipsilateral and contralateral epithelial cells.

We have identified gene expression differences of 1.4-fold to 4.6-fold between ipsilateral and contralateral oviduct epithelium for 35 genes. These differences seemed to be not very high, however, we saw that the weak signals in particular were sometimes affected by neighboring strong signals, which resulted in lower ratios. Furthermore, we must consider that epithelial cells of the entire oviduct were used for microarray analysis. It is likely that the difference in mRNA abundance is much greater in specific parts of the oviduct. This must be confirmed in future studies (e.g., by in situ hybridization).

Reproducibility of hybridization results is exemplarily shown in Figure 1 for four different genes that were represented by two to seven cDNA fragments on the microarray. The graphs indicate that deviations of the expression level ratios were smaller within one animal than between different animals. This may reflect individual differences in the sexual cycle or the individual genetic background. Nevertheless, the variation between animals was also surprisingly small. For most genes the coefficient of variation was in the range of 30% or below. Thus, the accuracy of our analysis was high enough for reproducible detection of even 1.4-fold differences in signal intensity.

Most of the genes showed differential expression in all four animals, but two genes showed this only in one animal. For example, differential expression of Bos taurus CAAF1 mRNA, which belongs to the family of calgranulins that are described as calcium- and zinc-binding proteins involved in the immune response to microbes and parasites [11], could reflect a local immune reaction rather than side-specific regulation in oviductal epithelium at Day 3.5 after standing heat. Expression of this gene was not detectable in the oviductal cells of the other animals.

Little is known about differential gene expression in bovine oviduct epithelial cells, and nearly nothing is known about differential expression between ipsilateral and contralateral oviduct epithelia. Thus, our experiments represent a real pilot study. However, data found in the literature indicate that the identified genes may be involved in oviduct-specific functions. Some genes are already described to be regulated during the sexual cycle. For example, thymosin beta 4 was found to be elevated in bovine plasma at estrus [12], and secretion of oviduct-specific glycoprotein is found to be highest around the time of ovulation [1]. It is interesting that the oviduct-specific glycoprotein mRNA was found to be slightly down-regulated at Day 3.5 after standing heat in the ipsilateral oviduct compared with that of the contralateral side. Similarly, B. taurus ORF1 mRNA was among the more abundant transcripts, but was expressed at a lower level in ipsilateral than in contralateral oviduct epithelial cells.

Furthermore, differential regulation of mRNA abundance was found for various enzymes. B. taurus PHGPx was found to be up-regulated in the ipsilateral oviduct. This enzyme shows antiperoxidant effects, modulates cyclooxygenase, and inhibits 15-lipoxygenase [13, 14]. PHGPx has been described as being important for development and fertilizing capacity of sperm cells [15]. A positive effect of PHGPx in the oviduct on oocytes and early stage embryos might be assumed. Another enzyme whose mRNA expression was up-regulated in the ipsilateral oviduct, the ornithine decarboxylase—a critical enzyme in polyamine biosynthesis [16]—was shown to be up-regulated by E2 in the chick oviduct [17].

The mRNAs for acetyl-coenzyme A acyltransferase 2 (ACAA2, 3-ketoacyl CoA thiolase), the last enzyme of the beta-oxidation of fatty acids [18], and 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR), which catalyzes the rate-limiting step in the biosynthesis of sterols and isoprenoids [19], were up-regulated in the ipsilateral oviduct. Similarly, the mRNA abundance for sterol carrier protein 2 (SCP-2), another protein involved in lipid metabolism, was higher in the ipsilateral than the contralateral oviduct epithelium. SCP-2 transfers a variety of lipids such as cholesterol between membranes. SCP-2 mRNA expression was found to be induced in corpora lutea of E2-treated rats [20]. It is interesting that SCP-x, a 58-kDa protein, contains the complete SCP-2 protein at the C-terminus and its N-terminus exhibits 3-ketoacyl coenzyme A thiolase activity [21].

We noticed that many genes for cell surface proteins or proteins that play a role in cell-cell interactions were differentially regulated between ipsilateral and contralateral oviduct epithelia. The mRNAs for tight junction protein 1/zona occludens 1, claudin 1, and TM4SF2 were found to be expressed at a higher level in the ipsilateral versus the contralateral oviduct epithelium. Tight junction protein 1 and claudin 1 show interaction in tight junctions of epithelia [22]. TM4SF2 is a member of the tetraspanin gene family that is probably involved in signal transduction and cell-cell interactions by the binding of integrins [23].

Further, some immune-related genes were identified, such as the polymeric immunoglobulin receptor and lactoferrin. The mRNA expression level of the polymeric immunoglobulin receptor was decreased 2.4-fold in the ipsilateral oviduct. Kaushic et al. [24] showed an E2-dependent expression of this gene with the highest levels at proestrus and estrus. Lactoferrin mRNA was up-regulated by ~3-fold in the ipsilateral oviduct of three of the four heifers investigated. Lactoferrin expression was also shown in the oviduct of mice and is the major E2-inducible protein in the murine uterus, with highest expression at estrus [25, 26]. Singh et al. [27] showed that lactoferrin is a ubiquitous and abundant constituent of external secretions and represents a component of the innate immune system having antimicrobial activity by preventing bacterial biofilm development. The observation that nonspecific components of the immune system such as, in particular lactoferrin and LANCL1, a new member of the eukaryotic LanC-like protein family, which is involved in the synthesis of antimicrobial peptides [28], are up-regulated in the ipsilateral oviduct, deserves further investigation.

In summary, our findings show for the first time a way to study the complex regulation of mRNA abundance for multiple genes from different functional classes in the ipsilateral versus the contralateral oviduct in the postovulation period. These findings indicate important local regulatory mechanisms of oviduct epithelial function either by the ipsilateral ovary or by the ovulated cumulus-oocyte complex. Future studies will follow these candidates at the protein level. The transcriptomics approach used in the present study appears to be highly sensitive and reproducible, providing a promising tool for a holistic analysis of interactions of gametes and embryos with their maternal environment.


    FOOTNOTES
 
1 This study was supported by the Deutsche Forschungsgemeinschaft (FOR 478/1). Equal contribution by S.B. and H.B. Back

2 Correspondence: Eckhard Wolf, Institute of Molecular Animal Breeding, Ludwig Maximilians University, Feodor-Lynen-Str. 25, 81377 Munich, Germany. FAX: 49 89 218076849; ewolf{at}lmb.uni-muenchen.de Back

3 Present address: Institute of Physiology, Technical University Munich-Weihenstephan, Weihenstephaner Berg 3, 85350 Freising, Germany Back

Received: 30 August 2002.

First decision: 25 September 2002.

Accepted: 11 October 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Buhi WC. Characterization and biological roles of oviduct-specific, oestrogen-dependent glycoprotein. Reproduction 2002 123:355-362[Abstract]
  2. Reischl J, Prelle K, Schol H, Neumuller C, Einspanier R, Sinowatz F, Wolf E. Factors affecting proliferation and dedifferentiation of primary bovine oviduct epithelial cells in vitro. Cell Tissue Res 1999 296:371-383[CrossRef][Medline]
  3. Wijayagunawardane MP, Miyamoto A, Cerbito WA, Acosta TJ, Takagi M, Sato K. Local distributions of oviductal estradiol, progesterone, prostaglandins, oxytocin and endothelin-1 in the cyclic cow. Theriogenology 1998 49:607-618[CrossRef][Medline]
  4. Wildt L, Kissler S, Licht P, Becker W. Sperm transport in the human female genital tract and its modulation by oxytocin as assessed by hysterosalpingoscintigraphy, hysterotonography, electrohysterography and Doppler sonography. Hum Reprod Update 1998 4:655-666[Abstract/Free Full Text]
  5. Bennett WA, Watts TL, Blair WD, Waldhalm SJ, Fuquay JW. Patterns of oviductal motility in the cow during the oestrous cycle. J Reprod Fertil 1988 83:537-543[Abstract/Free Full Text]
  6. Garcia A, van der Weijden GC, Colenbrander B, Bevers MM. Monitoring follicular development in cattle by real-time ultrasonography: a review. Vet Rec 1999 145:334-340[Abstract/Free Full Text]
  7. Fortune JE, Rivera GM, Evans AC, Turzillo AM. Differentiation of dominant versus subordinate follicles in cattle. Biol Reprod 2001 65:648-654[Abstract/Free Full Text]
  8. Rief S, Sinowatz F, Stojkovic M, Einspanier R, Wolf E, Prelle K. Effects of a novel co-culture system on development, metabolism and gene expression of bovine embryos produced in vitro. Reproduction 2002 124:543-556[Abstract]
  9. Diatchenko L, Lau YF, Campbell AP, Chenchik A, Moqadam F, Huang B, Lukyanov S, Lukyanov K, Gurskaya N, Sverdlov ED, Siebert PD. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci U S A 1996 93:6025-6030[Abstract/Free Full Text]
  10. Gurskaya NG, Diatchenko L, Chenchik A, Siebert PD, Khaspekov GL, Lukyanov KA, Vagner LL, Ermolaeva OD, Lukyanov SA, Sverdlov ED. Equalizing cDNA subtraction based on selective suppression of polymerase chain reaction: cloning of Jurkat cell transcripts induced by phytohemaglutinin and phorbol 12-myristate 13-acetate. Anal Biochem 1996 240:90-97[CrossRef][Medline]
  11. Gottsch JD, Eisinger SW, Liu SH, Scott AL. Calgranulin C has filariacidal and filariastatic activity. Infect Immunol 1999 67:6631-6636[Abstract/Free Full Text]
  12. Wolfe MW, Vakharia DD, Wise TH, Kinder JE. Characterization of secretion of thymosin alpha 1 and thymosin beta 4 during prepuberty, estrus and pregnancy in the bovine female. Domest Anim Endocrinol 1989 6:71-78[CrossRef][Medline]
  13. Ursini F, Maiorino M, Roveri A. Phospholipid hydroperoxide glutathione peroxidase (PHGPx): more than an antioxidant enzyme?. Biomed Environ Sci 1997 10:327-332[CrossRef][Medline]
  14. Fisher AB, Dodia C, Manevich Y, Chen JW, Feinstein SI. Phospholipid hydroperoxides are substrates for non-selenium glutathione peroxidase. J Biol Chem 1999 274:21326-21334[Abstract/Free Full Text]
  15. Tramer F, Micali F, Sandri G, Bertoni A, Lenzi A, Gandini L, Panfili E. Enzymatic and immunochemical evaluation of phospholipid hydroperoxide glutathione peroxidase (PHGPx) in testes and epididymal spermatozoa of rats of different ages. Int J Androl 2002 25:72-83[CrossRef][Medline]
  16. Hayashi S, Murakami Y, Matsufuji S. Ornithine decarboxylase antizyme: a novel type of regulatory protein. Trends Biochem Sci 1996 21:27-30[CrossRef][Medline]
  17. Levy C, Mester J, Baulieu EE. Early inhibition by progesterone of oestrogen-induced ornithine decarboxylase activity in the chick oviduct and rat uterus. J Endocrinol 1981 90:1-7[Abstract/Free Full Text]
  18. Latruffe N, Nicolas-Frances V, Dasari VK, Osumi T. Studies on regulation of the peroxisomal beta-oxidation at the 3-ketothiolase step. Dissection of the rat liver thiolase B gene promoter. Adv Exp Med Biol 1999 466:253-259[Medline]
  19. Istvan ES, Palnitkar M, Buchanan SK, Deisenhofer J. Crystal structure of the catalytic portion of human HMG-CoA reductase: insights into regulation of activity and catalysis. EMBO J 2000 19:819-830[CrossRef][Medline]
  20. McLean MP, Puryear TK, Khan I, Azhar S, Billheimer JT, Orly J, Gibori G. Estradiol regulation of sterol carrier protein-2 independent of cytochrome P450 side-chain cleavage expression in the rat corpus luteum. Endocrinology 1989 125:1337-1344[Abstract/Free Full Text]
  21. Stolowich NJ, Petrescu AD, Huang H, Martin GG, Scott AI, Schroeder F. Sterol carrier protein-2: structure reveals function. Cell Mol Life Sci 2002 59:193-212[CrossRef][Medline]
  22. Hamazaki Y, Itoh M, Sasaki H, Furuse M, Tsukita S. Multi-PDZ domain protein 1 (MUPP1) is concentrated at tight junctions through its possible interaction with claudin-1 and junctional adhesion molecule. J Biol Chem 2002 277:455-461[Abstract/Free Full Text]
  23. Berditchevski F. Complexes of tetraspanins with integrins: more than meets the eye. J Cell Sci 2001 114:4143-4151[Abstract/Free Full Text]
  24. Kaushic C, Richardson JM, Wira CR. Regulation of polymeric immunoglobulin A receptor messenger ribonucleic acid expression in rodent uteri: effect of sex hormones. Endocrinology 1995 136:2836-2844[Abstract]
  25. Dalton T, Kover K, Dey SK, Andrews GK. Analysis of the expression of growth factor, interleukin-1, and lactoferrin genes and the distribution of inflammatory leukocytes in the preimplantation mouse oviduct. Biol Reprod 1994 51:597-606[Abstract]
  26. Newbold RR, Teng CT, Beckman WC Jr, Jefferson WN, Hanson RB, Miller JV, McLachlan JA. Fluctuations of lactoferrin protein and messenger ribonucleic acid in the reproductive tract of the mouse during the estrous cycle. Biol Reprod 1992 47:903-915[Abstract]
  27. Singh PK, Parsek MR, Greenberg EP, Welsh MJ. A component of innate immunity prevents bacterial biofilm development. Nature 2002 417:552-555[CrossRef][Medline]
  28. Mayer H, Bauer H, Breuss J, Ziegler S, Prohaska R. Characterization of rat LANCL1, a novel member of the lanthionine synthetase C-like protein family, highly expressed in testis and brain. Gene 2001 269:73-80[CrossRef][Medline]



This article has been cited by other articles:


Home page
Brief Funct Genomic ProteomicHome page
A. Fazeli and E. Pewsey
Maternal communication with gametes and embryos: a complex interactome
Brief Funct Genomic Proteomic, March 1, 2008; 7(2): 111 - 118.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
K. Mitko, S. E Ulbrich, H. Wenigerkind, F. Sinowatz, H. Blum, E. Wolf, and S. Bauersachs
Dynamic changes in messenger RNA profiles of bovine endometrium during the oestrous cycle
Reproduction, February 1, 2008; 135(2): 225 - 240.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
S. Bauersachs, K. Mitko, H. Blum, and E. Wolf
Technical Note: Bovine Oviduct and Endometrium Array Version 1: A Tailored Tool for Studying Bovine Endometrium Biology and Pathophysiology
J Dairy Sci, September 1, 2007; 90(9): 4420 - 4423.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
S. P Kodithuwakku, A. Miyamoto, and M. P B Wijayagunawardane
Spermatozoa stimulate prostaglandin synthesis and secretion in bovine oviductal epithelial cells
Reproduction, June 1, 2007; 133(6): 1087 - 1094.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
R. Rottmayer, S. E Ulbrich, S. Kolle, K. Prelle, C. Neumueller, F. Sinowatz, H. H D Meyer, E. Wolf, and S. Hiendleder
A bovine oviduct epithelial cell suspension culture system suitable for studying embryo-maternal interactions: morphological and functional characterization.
Reproduction, October 1, 2006; 132(4): 637 - 648.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
S. Bauersachs, S. E Ulbrich, K. Gross, S. E M Schmidt, H. H D Meyer, H. Wenigerkind, M. Vermehren, F. Sinowatz, H. Blum, and E. Wolf
Embryo-induced transcriptome changes in bovine endometrium reveal species-specific and common molecular markers of uterine receptivity.
Reproduction, August 1, 2006; 132(2): 319 - 331.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
C. Klein, S. Bauersachs, S. E. Ulbrich, R. Einspanier, H. H.D. Meyer, S. E.M. Schmidt, H.-D. Reichenbach, M. Vermehren, F. Sinowatz, H. Blum, et al.
Monozygotic Twin Model Reveals Novel Embryo-Induced Transcriptome Changes of Bovine Endometrium in the Preattachment Period
Biol Reprod, February 1, 2006; 74(2): 253 - 264.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K.-F. Lee, J.-S. Xu, Y.-L. Lee, and W. S. B. Yeung
Demilune Cell and Parotid Protein from Murine Oviductal Epithelium Stimulates Preimplantation Embryo Development
Endocrinology, January 1, 2006; 147(1): 79 - 87.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
A. S. Georgiou, E. Sostaric, C. H. Wong, A. P. L. Snijders, P. C. Wright, H. D. Moore, and A. Fazeli
Gametes Alter the Oviductal Secretory Proteome
Mol. Cell. Proteomics, November 1, 2005; 4(11): 1785 - 1796.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
S Bauersachs, S E Ulbrich, K Gross, S E M Schmidt, H H D Meyer, R Einspanier, H Wenigerkind, M Vermehren, H Blum, F Sinowatz, et al.
Gene expression profiling of bovine endometrium during the oestrous cycle: detection of molecular pathways involved in functional changes
J. Mol. Endocrinol., June 1, 2005; 34(3): 889 - 908.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. Fazeli, N. A. Affara, M. Hubank, and W. V. Holt
Sperm-Induced Modification of the Oviductal Gene Expression Profile After Natural Insemination in Mice
Biol Reprod, July 1, 2004; 71(1): 60 - 65.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
68/4/1170    most recent
biolreprod.102.010660v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bauersachs, S.
Right arrow Articles by Wolf, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bauersachs, S.
Right arrow Articles by Wolf, E.
Agricola
Right arrow Articles by Bauersachs, S.
Right arrow Articles by Wolf, E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS