Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print November 27, 2002.
Biol Reprod 2002, 10.1095/biolreprod.102.007708
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
68/4/1318    most recent
biolreprod.102.007708v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kumar, S.
Right arrow Articles by Bagchi, I. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kumar, S.
Right arrow Articles by Bagchi, I. C.
Agricola
Right arrow Articles by Kumar, S.
Right arrow Articles by Bagchi, I. C.
BIOLOGY OF REPRODUCTION 68, 1318–1323 (2003)
DOI: 10.1095/biolreprod.102.007708
© 2003 by the Society for the Study of Reproduction, Inc.


Female Reproductive Tract

Progesterone Induces Calcitonin Expression in the Baboon Endometrium Within the Window of Uterine Receptivity1

Sushma Kumarb, Allison Brudneyc, Yong-Pil Cheona, Asgerally T. Fazleabasc, and Indrani C. Bagchi2,a

a Department of Veterinary Biosciences, University of Illinois at Urbana-Champaign, Urbana, Illinois 61802 b Population Council, New York, New York 10021 c Department of Obstetrics and Gynecology, University of Illinois at Chicago, Chicago, Illinois 60612


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The mammalian uterus can accept a developing blastocyst for implantation only within a limited period of time, termed the receptive phase. Our previous studies showed that the expression of calcitonin, a peptide hormone that regulates calcium homeostasis, is induced by progesterone immediately preceding implantation, and is required for the generation of a receptive rat uterus. In this study, we investigated the expression and hormonal regulation of calcitonin in the baboon endometrium during the window of implantation. We monitored the spatio-temporal expression of calcitonin at various days of the menstrual cycle. Reverse transcriptase-polymerase chain reaction analysis of the baboon endometrium on Days 9 and 10 postovulation revealed stage-specific expression of calcitonin mRNA, which overlapped with the window of uterine receptivity. Immunocytochemical analysis of baboon endometrium sections localized calcitonin expression in the glandular epithelial and stromal cells. Treatment of animals with the antiprogestin ZK 137.316 dramatically reduced calcitonin expression, indicating that calcitonin expression in the baboon endometrium is under progesterone regulation. Collectively, these findings strongly suggest that the appearance of calcitonin in progesterone-dominated endometrium is conserved among species and may serve as a marker of uterine receptivity for embryo implantation.

female reproductive tract, implantation, progesterone, progesterone receptor, uterus


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Implantation, the initiation of complex interactions between the developing embryo and the uterus, is a crucial event in mammalian embryonic growth and development [1, 2]. The initial adherence of the blastocyst to the uterine surface epithelium followed by intimate interaction of the blastocyst trophectoderm with epithelial cells leads to the progressive phases of implantation. It is generally believed that the endometrium and the fertilized ovum must undergo concomitant developmental changes for implantation to succeed. The endometrium undergoes certain hormone-dependent changes during a specific time window within the preimplantation phase that prepares it to receive the developing blastocyst [16]. A complex interplay between effectors, including steroid hormones, growth factors, and cytokines regulates development of the "receptive" state of the uterine epithelium [2, 79]. However, the precise nature of the molecular mechanisms through which these effectors promote uterine receptivity remains unclear.

Our previous studies identified calcitonin, a peptide hormone known to regulate calcium homeostasis, as a potential regulator of implantation [1013]. In the rat endometrium, calcitonin expression was transiently induced immediately prior to implantation [10]. The expression of calcitonin was regulated by progesterone and restricted to the glandular epithelial cells of the endometrium [1012]. We detected significant amounts of calcitonin in the luminal secretions of rat collected on Days 4 and 5 of gestation, indicating that this hormone is secreted from its glandular site of synthesis immediately preceding implantation [11]. Most importantly, suppression of steady state calcitonin mRNA levels in the preimplantation rat uterus by antisense oligodeoxynucleotides (ODNs) resulted in a dramatic reduction in the number of implanted embryos [13]. Analysis of a limited number of human endometrial biopsies indicated that calcitonin expression during the menstrual cycle is restricted to the midsecretory stage that overlaps the window of implantation [12]. Collectively, these studies raised the possibility that calcitonin is a marker of the receptive state of the endometrium in a wide variety of species.

The expression of calcitonin in the endometrium of nonhuman primates has not been described previously. The objective of this study was to determine whether calcitonin is a marker of the receptive state of baboon endometrium during the window of implantation. The following two specific objectives were pursued: 1) monitor the spatio-temporal expression of calcitonin mRNA and protein in the baboon endometrium on various days of the menstrual cycle using RT-PCR and immunohistochemical analyses, and 2) examine progesterone regulation of calcitonin expression in the baboon endometrium by treating animals with antiprogestin ZK 137.316.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tissue Collection

All animal studies were approved by the Animal Care Committee at the University of Illinois and studies were conducted in accordance with the National Institutes of Health guidelines for the ethical use of animals in research. Endometrial tissues from normally cycling baboons at early follicular (EF; Days 6–8 postmenses) (n = 3), late follicular (LF; Days 12–14 postmenses) (n = 3), Day 5 (n = 5), Day 8 (n = 3), Day 9 (n = 3), Day 10 (n = 4), Day 12 (n = 4), Day 13 (n = 3), and Day 15 (n = 3) postovulation (PO) were collected following endometriectomy or hysterectomy. The PO days were determined by measuring the estradiol surge in peripheral blood. The day following the estradiol surge (day of LH surge) was designated as Day 0. Portions of the endometrial tissues were either snap-frozen in liquid nitrogen for RNA extraction or fixed in 4% paraformaldehyde. Each of these procedures have been previously described in detail [14, 15]. For the antiprogestin study, normal cycling animals (n = 3) were injected i.m. with ZK 137.316 (Schering AG, Berlin, Germany) at a dose of 1 mg/kg per body weight per day beginning on the day of the LH surge (Day 0). Injections were continued until the morning of Day 9 PO, and each daily injection was given in the morning. The ZK 137.316 compound was dissolved in a 1:10 ratio of ethanol and sesame seed oil as previously described [16]. Control animals were treated with vehicle alone. Tissues were obtained on Day 10 PO and fixed or frozen as described above for analysis.

Isolation of RNA

Total RNA was extracted from the snap-frozen tissues using TriReagent (Molecular Research Center, Inc., Cincinnati, OH) according to the manufacturer's protocol. The isolated RNA was used for the RT-PCR analysis.

Reverse Transcriptase-Polymerase Chain Reaction Analysis

For reverse transcriptase-polymerase chain reaction (RT-PCR) analysis, endometrial total RNA (0.1 µg) was subjected to reverse transcription reaction using a Stratascript RT-PCR kit (Stratagene, LaJolla, CA). Briefly, the RNA samples were mixed with oligo(dT) primer, incubated at 65°C for 5 min, and annealed at room temperature. First-strand cDNA was synthesized using Moloney murine leukemia virus (MMLV) RT at 37°C and the reaction was stopped by heating the tubes at 95°C for 5 min. The nucleotide sequences of the oligonucleotide primers for calcitonin were CAGATCTAAGCGGTGCGGTAATC and GACATCTCTGGGGGACTCAAAG, and a transcript of 410 base pairs (bp) was amplified. The glyceraldehyde 3-phosphate dehydrogenase (GAPDH) primer sequences (GGAAGCTTGTCATCAATGG and CGATACCAAAGTTGTCATGG) generated a transcript of 317 bp. The PCR reaction was performed in 100 µl total volume using 35 ng of primer set; 200 µM each of dATP, dGTP, dCTP, and dTTP; 1.5 mM Mg++; and 0.5 µl of Taq DNA polymerase (Perkin-Elmer, Palo Alto, CA). The conditions for PCR were one cycle at 94°C for 30 sec followed by 25 cycles at 94°C for 30 sec, 65°C for 30 sec, and 68°C for 2 min. The authenticity of the PCR products was confirmed by Southern blot analysis using calcitonin or GAPDH cDNA probes.

Southern Blot Analysis

PCR products (2 µl each) were run on 1% agarose gel. After electrophoresis, the gel was transferred to Duralon membrane (Stratagene). The membrane was prehybridized in 6x SSC, 5x Denhardts, 0.5% SDS, and 100 µg/ml salmon sperm DNA for 2 h at 68°C. Hybridization was performed in the same buffer containing 106cpm/ml of 32P-labeled cDNA fragment of human calcitonin or GAPDH overnight at 68°C. The membrane was washed with 2x SSC and 0.1% SDS for 15 min at room temperature, in 0.1x SSC containing 0.5% SDS at 68°C for 45 min and exposed to x-ray film for 12 h. Densitometric analysis of the PCR products was performed using a PhosphorImager system (Molecular Dynamics, Inc., Sunnyvale, CA).

Immunohistochemistry

Polyclonal antibody against human calcitonin (Peninsula Laboratory, Belmont, CA) was diluted 1:1000 for immunohistochemistry. Frozen or paraffin-embedded baboon endometrial tissues were sectioned at 7 µm and mounted on slides. Frozen sections were then fixed in 5% formaldehyde solution in PBS. Sections were washed in PBS for 20 min and then incubated in a blocking solution containing 10% normal goat serum for 10 min before incubation in primary antibody overnight at 4°C. Immunostaining was performed using a Streptavidin-Biotin kit for rabbit primary antibody (Zymed, Burlingame, CA). Sections were counterstained with hematoxylin, mounted, and examined with brightfield microscopy. Red deposits indicated the sites of immunostaining. In control experiments, the sections were incubated with normal rabbit serum instead of antibody to calcitonin.

Statistical analyses

Statistical evaluations of the data representing the levels of calcitonin in endometrium on different days of the menstrual cycle and before and after treatment of ZK 137.316 were performed using ANOVA and the Fisher least significant differences test. P < 0.05 was considered statistically significant.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Calcitonin mRNA Is Expressed in the Baboon Endometrium During the Receptive Phase

To monitor the expression of calcitonin mRNA in baboon endometrium during the menstrual cycle, we analyzed RNA isolated from baboon endometrial biopsies for the presence of calcitonin by RT-PCR. The RNA samples obtained from the endometrium of baboon at different days of the cycle were reversed transcribed and amplified by PCR using calcitonin gene (exon 4)-specific primers. The PCR-amplified products were then subjected to Southern blot analysis employing a radiolabeled human calcitonin cDNA fragment containing exon 4 as probe. The results depicted in Figure 1 show that no calcitonin transcripts were detected in the early follicular or late follicular phase of the cycle (upper panel). The signal corresponding to calcitonin mRNA was also barely detectable on Day 5 or Day 8 PO. It was interesting that the level of calcitonin mRNA increased dramatically on Days 9 and 10 PO, which overlaps with the time of uterine receptivity in the baboon. The signal corresponding to calcitonin mRNA declined sharply during the late luteal phase on Days 12 to 15 PO. The relative levels of calcitonin mRNA expression in the endometrium on different days of the cycle were estimated by densitometric scanning and normalized to the control glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA signal (Fig. 1, lower panel). The expression of calcitonin on Days 9–10 PO was significantly greater (~10-fold) than that observed on any other day of the cycle.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 1. Profile of expression of calcitonin mRNA in baboon endometrium at different days of the menstrual cycle. Total RNA were isolated from baboon endometrium at early follicular (EF) (n = 3), late follicular (LF) (n =3), Day 5 (D5; n = 5), Day 8 (D8; n = 3), Day 9 (D9; n = 3), Day 10 (D10; n = 4), Day 12 (D12; n = 4), Day 13 (D13; n = 3), and Day 15 (D15; n = 3) PO of the menstrual cycle and subjected to RT-PCR using calcitonin-specific (upper panel) or GAPDH-specific (lower panel) primers as described in "Materials and Methods." The number of independently isolated endometrial samples analyzed is indicated by "n". The authenticity of the PCR products were confirmed by Southern blot analysis using calcitonin or GAPDH cDNA probes. The intensities of the signals corresponding to the calcitonin mRNA were quantitated by densitometric scanning followed by normalization against the GAPDH mRNA signals of the autoradiogram of the Southern blot shown in the upper panel. For accurate densitometric measurements of the mRNA signals in the RT-PCR reactions, we used shorter exposures of the autoradiograms in which neither calcitonin nor GAPDH signal was saturating. Results are expressed relative to GAPDH and are plotted as the mean ± SEM for at least three separate experiments. Bars with * indicate significant (P < 0.05) differences between the different stages of the cycle.

Calcitonin Protein Is Localized in Both Glandular Epithelium and Stroma of Baboon Endometrium

To localize the site of calcitonin protein accumulation in the baboon endometrium, immunocytochemical staining of endometrial sections was performed at different stages of the menstrual cycle using an antibody against human calcitonin. No significant staining was observed either in the glandular epithelial or stromal cells of endometrial sections on Days 5 (n = 2), 8 (n = 2), and 12 PO (n = 2) (Fig. 2 A, B, and D, respectively). However, sections of baboon endometrium on Day 10 PO (n = 2) exhibited strong calcitonin-specific staining (Fig. 2C). This staining was present in the glandular epithelial and stromal cells. No significant staining was observed in the spiral arteries (data not shown).



View larger version (99K):
[in this window]
[in a new window]
 
FIG. 2. Immunohistochemical localization of calcitonin in the baboon endometrium. Paraffin-embedded uterine tissues were processed and analyzed by immunohistochemical staining for calcitonin, as described in "Materials and Methods." A) Endometrium on Day 5 PO (x40). B) Endometrium on Day 8 PO (x10). C) Endometrium on Day 10 PO (x10). D) Endometrium on Day 12 PO (x40) were subjected to immunohistochemistry employing a polyclonal rabbit anti-human calcitonin antibody. Inset in (C) represents endometrium on Day 10 PO stained with nonimmune immunoglobulin G in place of the primary antibody. The images shown in this figure are representative sections from one animal. Similar staining pattern was observed with endometrial sections from another animal on Day 5, Day 8, Day 10, and Day 12 PO.

Calcitonin Expression in the Baboon Endometrium Is Regulated by Progesterone

Our previous studies showed that calcitonin expression in the rat uterus is regulated by progesterone [10, 11]. We therefore examined whether calcitonin expression in the baboon endometrium was also under progesterone regulation. Animals were treated with an antiprogestin, ZK 137.316, which blocks progesterone receptor activity. Normally, cycling animals received this drug for 9 days beginning on the day of the LH surge. Endometrial tissues were isolated and monitored for calcitonin expression on Day 10 PO by RT-PCR. As expected, control endometrial tissue on Day 10 PO exhibited a signal corresponding to calcitonin mRNA (Fig. 3, left lane). There was, however, a dramatic decrease in the expression of calcitonin mRNA upon administration of ZK 137.316 (Fig. 3, right lane). Quantitative analyses indicated greater than 90% decline in uterine calcitonin mRNA levels upon administration of ZK 137.316 (Fig. 3, lower panel).



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 3. Effects of the antiprogestin ZK 137.316 on calcitonin mRNA synthesis in baboon endometrium. Normal cycling animals received the antiprogestin ZK 137.316 for 9 days beginning on the day of the LH surge. Total RNA were isolated from normal cycling Day 10 PO (n = 3) and antiprogestin-treated animals (n = 3) and subjected to RT-PCR. Lanes 1 and 2 represent calcitonin mRNAs for normal cycling Day 10 PO and for antiprogestin-treated endometrium, respectively. The corresponding densitometric analysis expressed as the mean of three different experiments is shown in the lower panel. Bars with * indicate significant (P < 0.05) differences between control and ZK 137.316 treated samples.

We also monitored calcitonin protein expression in baboon endometrial tissues by immunohistochemistry following treatment with ZK 137.316. Significant calcitonin-specific staining in the endometrial glands and stroma was observed on Day 10 PO (n = 2) of control animals (Fig. 4A). In contrast, calcitonin-specific staining was virtually undetectable on Day 10 PO following treatment with ZK 137.316 (n = 2) (Fig. 4B).



View larger version (61K):
[in this window]
[in a new window]
 
FIG. 4. Immunostaining of calcitonin in baboon endometrium declines after treatment with ZK 137.316. Immunocytochemistry was performed with endometrial sections of baboons treated with or without ZK 137.316 employing polyclonal rabbit anti-human calcitonin. Note the decline in the level of calcitonin in the glandular epithelial (G) of Day 10 PO endometrium treated with ZK 137.316. The images shown in this figure are representative sections from one animal. Similar staining pattern was observed with endometrial sections from another animal treated with or without ZK 137.316. Magnification x20


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The concept of endometrial receptivity was first proposed by Psychoyos based on his studies in the rat [1] and then extended to other species through the work of many laboratories [2]. In baboons, the window of uterine receptivity exists between Days 8 to 10 PO and is dependent on estrogen and progesterone [17]. Morphologically, it is characterized by the presence of columnar epithelium with microvilli and an increase in stromal cell proliferation [18]. The biochemical studies showed altered expression of steroid hormone receptors as well as their target genes such as polymorphic mucin, Muc-1, in the luminal epithelium during this receptive phase [15, 19]. This phase is also accompanied by an increase in smooth muscle myosin II expression in the luminal and glandular epithelium and the appearance of pinopod-like structures on the surface epithelium [17]. Our study shows that calcitonin is expressed in a highly stage-specific manner in the baboon endometrium overlapping this window of uterine receptivity. The expression of calcitonin mRNA was restricted to the postovulatory luteal phase (Days 9 and 10 PO). No calcitonin expression was detected in the preovulatory proliferative phase or after Day 12 PO of the menstrual cycle. Immunohistochemical analyses indicated that uterine calcitonin is localized in the glandular epithelial and stromal cells. Previous studies in the rat showed that calcitonin is secreted by the glandular cells during the receptive phase [11]. It is therefore conceivable that calcitonin is secreted from its sites of synthesis in the baboon endometrium and acts within the uterine tissue in an endocrine or paracrine manner.

Progesterone regulates calcitonin expression in rat uterus [10, 11]. It is interesting that calcitonin expression is induced in epithelial and stromal cells of baboon endometrium on Days 9 and 10 PO, the time of peak progesterone production. The actions of progesterone in various uterine cell types are mediated by intracellular progesterone receptors (PRs). The hormone-bound PR regulates the expression of various target genes in the uterus, thereby changing the function of the tissue. Synthetic antiprogestins, such as RU486 and ZK 137.316, which bind to the PR and inhibit its gene regulatory activity [20], are powerful tools for confirming PR regulation of target genes. Our previous studies showed that binding of RU486 to rat endometrial PR blocked calcitonin expression, indicating a receptor-mediated gene regulatory mechanism [11]. Consistent with this observation, Conneely and coworkers used PR knockout mice to demonstrate that calcitonin expression in the uterus is indeed regulated by PR [21]. Our present studies showed that treatment with ZK 137.316 abolishes calcitonin mRNA and protein expression in baboon endometrial tissue during postovulatory Days 9 and 10. These results indicated that progesterone-complexed-PR plays a critical role in calcitonin expression in primate endometrium. Calcitonin is therefore a new progesterone-regulated marker in the baboon endometrium.

The mechanism by which PRs regulate calcitonin gene expression in baboon endometrium is not clear. It is possible that PR interacts directly with the calcitonin promoter to regulate its expression. Alternatively, the action of PR may be indirect: it may induce a gene product, which in turn, interacts with and regulates calcitonin promoter. Previous studies have shown that the expression of certain genes, including cyclooxygenase-1 (COX1) and heparin-binding EGF-like growth factor (HB-EGF), is down-regulated in baboon endometrium in response to ZK 137.316 [22, 23]. However, it is not known whether any of these genes is directly regulated by PR. In contrast, our previous studies have shown that PR directly regulates calcitonin promoter in Ishikawa endometrial cells [11]. The progesterone response element in the calcitonin promoter, however, remains undefined.

Because the uterine expression of calcitonin is mediated by the PRs, it is of interest to compare the patterns of spatial distribution of these two proteins in the endometrial cells during the luteal phase of the cycle. Previous studies employing immunohistochemistry determined the spatial and temporal expression of PRs in the baboon endometrium during the menstrual cycle [15]. High amounts of PRs are expressed in the glandular epithelium, stroma, and myometrium immediately following ovulation. By the midluteal phase, staining for PR is still intense in the glandular epithelium and stroma throughout the endometrium. The PR contents of the glandular epithelium of the functionalis decline progressively as the menstrual cycle advances from the mid to the late luteal phase. In contrast, the receptor contents of the glandular epithelium of the basalis, stromal, and myometrial cells do not decrease appreciably with the progression of the luteal phase. The observation that calcitonin expression is detected in both glandular epithelial and stromal cells in the midluteal phase of the cycle is consistent with the fact that significant levels of PRs are present in these endometrial compartments.

What is the likely functional role of calcitonin in the baboon uterus? Our previous studies in the rat using antisense ODNs suggested that calcitonin critically controls uterine receptivity prior to implantation [13]. Our recent studies in cultured Ishikawa endometrial cells show that calcitonin addition leads to a rise in intracellular calcium, which, in turn, decreases the expression of the calcium-dependent cell adhesion molecule, E-cadherin, at cell-cell contact sites [24]. Consistent with this in vitro observation, we found that administration of exogenous calcitonin down-regulates E-cadherin expression in the endometrial epithelium of pregnant rats without altering the expression of ZO-1, a marker of tight junctions [24]. The down-regulation of E-cadherin in the uterine epithelial cells has an important implication during implantation. The uterine luminal epithelial cells, like other epithelial cells, are held together by the E-cadherins present in "adherence junctions". A decline in E-cadherin levels suggests a change in lateral adhesion between these cells. This is consistent with the process of implantation in rodents and primates in which the trophoblast penetrates the uterine epithelium by intruding between uterine epithelial cells [2]. We therefore speculate that the calcitonin-induced down-regulation of E-cadherin at the time of implantation leads to a plastic epithelium in which the intercellular space can be penetrated more easily by invading trophoblast cells. Future studies will determine whether the surge of calcitonin and down-regulation of E-cadherin are functionally linked events in the baboon endometrium during implantation.


    ACKNOWLEDGMENTS
 
The help of Xuping Xu in the immunostaining studies is gratefully acknowledged.


    FOOTNOTES
 
1 This work was supported by National Institutes of Health grants HD-34527 and HD-34760 (I.C.B.) and HD-29964 (A.T.F.). Back

2 Correspondence. FAX: 217 244 1652; ibagchi{at}uiuc.edu Back

Received: 5 June 2002.

First decision: 6 July 2002.

Accepted: 23 October 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Psychoyos A. Endocrine control of egg implantation. In: Greep RO, Astwood EG (eds.), Handbook of Physiology. Washington: American Physiological Society; 1973: 187–215
  2. Carson DD, Bagchi I, Dey SK, Enders AC, Fazleabas AT, Lessey BA, Yoshinaga K. Embryo implantation. Dev Biol 2000 223:217-237[CrossRef][Medline]
  3. Schlafke S, Enders AC. Cellular basis of interaction between trophoblast and uterus at implantation. Biol Reprod 1975 12:41-65[CrossRef][Medline]
  4. Yoshinaga K. Uterine receptivity for blastocyst implantation. Ann NY Acad Sci 1988 541:424-431[Medline]
  5. Parr MB, Parr EL. The implantation reaction. In: Wynn RM, Jollie WP (eds.), Biology of The Uterus. New York: Plenum Press; 1989: 233–277
  6. Glasser SR. Biochemical and structural changes in uterine endometrial cell types following natural or artificial deciduogenic stimuli. In: Denker HW, Aplin JD (eds.), Trophoblast Research. New York: Plenum Press; 1990: 377–416
  7. Psychoyos A. Hormonal control of uterine receptivity for nidation. J Reprod Fertil 1976 25:17-28
  8. Psychoyos A. Uterine receptivity for nidation. Ann NY Acad Sci 1986 476:36-42[Medline]
  9. Sharkey A. Cytokines and implantation: reviews of reproduction. J Reprod Fertil 1998 3:52-61
  10. Ding YQ, Zhu LZ, Bagchi MK, Bagchi IC. Progesterone stimulates calcitonin gene expression in the uterus during implantation. Endocrinology 1994 135:2265-2274[Abstract]
  11. Zhu LZ, Bove KC, Pohlirohnis M, Bagchi MK, Bagchi IC. Calcitonin is a progesterone regulated marker which forecasts the receptive state of endometrium during implantation. Endocrinology 1998 139:3923-3934[Abstract/Free Full Text]
  12. Kumar S, Zhu LZ, Polihronis M, Cameron ST, Baird DT, Schatz F, Dua A, Ying YK, Bagchi MK, Bagchi IC. Progesterone induces calcitonin gene expression in human endometrium within the putative window of implantation. J Clin Endocrinol Metab 1998 83:4443-4450[Abstract/Free Full Text]
  13. Zhu LJ, Bagchi MK, Bagchi IC. Attenuation of calcitonin gene expression in pregnant rat uterus leads to a block in embryonic implantation. Endocrinology 1998 139:330-339[Abstract/Free Full Text]
  14. Fazleabas AT, Donnelly KM, Mavrogianis PA, Verhage HG. Secretory and morphological changes in the baboon (Papio anubis) uterus and placenta during early pregnancy. Biol Reprod 1993 49:695-704[Abstract]
  15. Hild-Petito S, Verhage HG, Fazleabas AT. Immunocytochemical localization of estrogen and progestin receptors in the baboon (Papio anubis) uterus during implantation and pregnancy. Endocrinology 1992 130:2343-2353[Abstract/Free Full Text]
  16. Banaszak S, Brudney A, Donnelly K, Chai D, Chwalisz K, Fazleabas AT. Modulation of the action of chorionic gonadotropin in the baboon (Papio anubis) uterus by a progesterone receptor antagonist (ZK 137.316). Biol Reprod 2000 63:820-825[Abstract/Free Full Text]
  17. Fazleabas AT, Strakova Z. Endometrial function: cell specific changes in the uterine environment. Mol Cell Endocrinol 2002 186:143-147[CrossRef][Medline]
  18. Hild-Petito S, Donnelly KM, Miller JB, Verhage HG, Fazleabas AT. A baboon (Papio anubis) stimulated-pregnant model: cell specific expression of insulin-like growth factor binding protein-1 (IGFBP-1), type I IGF receptor (IGF-I R) and retinal binding protein (RBP) in the uterus. Endocrine 1995 3:639-651[CrossRef]
  19. Hild-Petito S, Fazleabas AT, Julian JA, Carson DD. Mucin (Muc-1) expression is differentially regulated in uterine luminal and glandular epithelia of the baboon (Papio anubis). Biol Reprod 1996 54:939-947[Abstract]
  20. Edwards DP, Altmann M, DeMarzo A, Zhang Y, Weigel NL, Beck CA. Progesterone receptor and the mechanism of action of progesterone antagonists. J Steroid Biochem Mol Biol 1995 53:449-58[CrossRef][Medline]
  21. Mulac-Jericevic B, Mullinax RA, DeMayo FJ, Lydon JP, Conneely OM. Subgroup of reproductive functions of progesterone mediated by progesterone receptor-B isoform. Science 2000 289:1751-1754[Abstract/Free Full Text]
  22. Kim JJ, Wang J, Bambra C, Das SK, Dey SK, Fazleabas AT. Expression of cyclooxygeanse-1 and -2 in the baboon endometrium during the menstrual cycle and pregnancy. Endocrinology 1999 140:2672-2678[Abstract/Free Full Text]
  23. Leach RE, Khalifa R, Armant DR, Brudney A, Das SK, Dey SK, Fazleabas AT. Heparin-binding EGF-like growth factor modulation by antiprogestin and CG in the baboon (Papio anubis). J Clin Endocrinol Metab 2001 86:4520-4528[Abstract/Free Full Text]
  24. Li Q, Wang J, Armant DR, Bagchi MK, Bagchi IC. Calcitonin down-regulates E-cadherin expression in uterine epithelium during implantation. J Biol Chem 2002 277:46447-46455[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
S. M Krzysik-Walker, O. M Ocon-Grove, S. B Maddineni, G. L Hendricks III, and R. Ramachandran
Identification of Calcitonin Expression in the Chicken Ovary: Influence of Follicular Maturation and Ovarian Steroids
Biol Reprod, October 1, 2007; 77(4): 626 - 635.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Pham, M. Dong, J. D. Wade, L. J. Miller, C. J. Morton, H.-l. Ng, M. W. Parker, and P. M. Sexton
Insights into Interactions between the {alpha}-Helical Region of the Salmon Calcitonin Antagonists and the Human Calcitonin Receptor using Photoaffinity Labeling
J. Biol. Chem., August 5, 2005; 280(31): 28610 - 28622.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
68/4/1318    most recent
biolreprod.102.007708v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kumar, S.
Right arrow Articles by Bagchi, I. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kumar, S.
Right arrow Articles by Bagchi, I. C.
Agricola
Right arrow Articles by Kumar, S.
Right arrow Articles by Bagchi, I. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS