| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Female Reproductive Tract |
a Department of Veterinary Biosciences, University of Illinois at Urbana-Champaign, Urbana, Illinois 61802
b Population Council, New York, New York 10021
c Department of Obstetrics and Gynecology, University of Illinois at Chicago, Chicago, Illinois 60612
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
female reproductive tract, implantation, progesterone, progesterone receptor, uterus
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Our previous studies identified calcitonin, a peptide hormone known to regulate calcium homeostasis, as a potential regulator of implantation [10–13]. In the rat endometrium, calcitonin expression was transiently induced immediately prior to implantation [10]. The expression of calcitonin was regulated by progesterone and restricted to the glandular epithelial cells of the endometrium [10–12]. We detected significant amounts of calcitonin in the luminal secretions of rat collected on Days 4 and 5 of gestation, indicating that this hormone is secreted from its glandular site of synthesis immediately preceding implantation [11]. Most importantly, suppression of steady state calcitonin mRNA levels in the preimplantation rat uterus by antisense oligodeoxynucleotides (ODNs) resulted in a dramatic reduction in the number of implanted embryos [13]. Analysis of a limited number of human endometrial biopsies indicated that calcitonin expression during the menstrual cycle is restricted to the midsecretory stage that overlaps the window of implantation [12]. Collectively, these studies raised the possibility that calcitonin is a marker of the receptive state of the endometrium in a wide variety of species.
The expression of calcitonin in the endometrium of nonhuman primates has not been described previously. The objective of this study was to determine whether calcitonin is a marker of the receptive state of baboon endometrium during the window of implantation. The following two specific objectives were pursued: 1) monitor the spatio-temporal expression of calcitonin mRNA and protein in the baboon endometrium on various days of the menstrual cycle using RT-PCR and immunohistochemical analyses, and 2) examine progesterone regulation of calcitonin expression in the baboon endometrium by treating animals with antiprogestin ZK 137.316.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
All animal studies were approved by the Animal Care Committee at the University of Illinois and studies were conducted in accordance with the National Institutes of Health guidelines for the ethical use of animals in research. Endometrial tissues from normally cycling baboons at early follicular (EF; Days 6–8 postmenses) (n = 3), late follicular (LF; Days 12–14 postmenses) (n = 3), Day 5 (n = 5), Day 8 (n = 3), Day 9 (n = 3), Day 10 (n = 4), Day 12 (n = 4), Day 13 (n = 3), and Day 15 (n = 3) postovulation (PO) were collected following endometriectomy or hysterectomy. The PO days were determined by measuring the estradiol surge in peripheral blood. The day following the estradiol surge (day of LH surge) was designated as Day 0. Portions of the endometrial tissues were either snap-frozen in liquid nitrogen for RNA extraction or fixed in 4% paraformaldehyde. Each of these procedures have been previously described in detail [14, 15]. For the antiprogestin study, normal cycling animals (n = 3) were injected i.m. with ZK 137.316 (Schering AG, Berlin, Germany) at a dose of 1 mg/kg per body weight per day beginning on the day of the LH surge (Day 0). Injections were continued until the morning of Day 9 PO, and each daily injection was given in the morning. The ZK 137.316 compound was dissolved in a 1:10 ratio of ethanol and sesame seed oil as previously described [16]. Control animals were treated with vehicle alone. Tissues were obtained on Day 10 PO and fixed or frozen as described above for analysis.
Isolation of RNA
Total RNA was extracted from the snap-frozen tissues using TriReagent (Molecular Research Center, Inc., Cincinnati, OH) according to the manufacturer's protocol. The isolated RNA was used for the RT-PCR analysis.
Reverse Transcriptase-Polymerase Chain Reaction Analysis
For reverse transcriptase-polymerase chain reaction (RT-PCR) analysis, endometrial total RNA (0.1 µg) was subjected to reverse transcription reaction using a Stratascript RT-PCR kit (Stratagene, LaJolla, CA). Briefly, the RNA samples were mixed with oligo(dT) primer, incubated at 65°C for 5 min, and annealed at room temperature. First-strand cDNA was synthesized using Moloney murine leukemia virus (MMLV) RT at 37°C and the reaction was stopped by heating the tubes at 95°C for 5 min. The nucleotide sequences of the oligonucleotide primers for calcitonin were CAGATCTAAGCGGTGCGGTAATC and GACATCTCTGGGGGACTCAAAG, and a transcript of 410 base pairs (bp) was amplified. The glyceraldehyde 3-phosphate dehydrogenase (GAPDH) primer sequences (GGAAGCTTGTCATCAATGG and CGATACCAAAGTTGTCATGG) generated a transcript of 317 bp. The PCR reaction was performed in 100 µl total volume using 35 ng of primer set; 200 µM each of dATP, dGTP, dCTP, and dTTP; 1.5 mM Mg++; and 0.5 µl of Taq DNA polymerase (Perkin-Elmer, Palo Alto, CA). The conditions for PCR were one cycle at 94°C for 30 sec followed by 25 cycles at 94°C for 30 sec, 65°C for 30 sec, and 68°C for 2 min. The authenticity of the PCR products was confirmed by Southern blot analysis using calcitonin or GAPDH cDNA probes.
Southern Blot Analysis
PCR products (2 µl each) were run on 1% agarose gel. After electrophoresis, the gel was transferred to Duralon membrane (Stratagene). The membrane was prehybridized in 6x SSC, 5x Denhardts, 0.5% SDS, and 100 µg/ml salmon sperm DNA for 2 h at 68°C. Hybridization was performed in the same buffer containing 106cpm/ml of 32P-labeled cDNA fragment of human calcitonin or GAPDH overnight at 68°C. The membrane was washed with 2x SSC and 0.1% SDS for 15 min at room temperature, in 0.1x SSC containing 0.5% SDS at 68°C for 45 min and exposed to x-ray film for 12 h. Densitometric analysis of the PCR products was performed using a PhosphorImager system (Molecular Dynamics, Inc., Sunnyvale, CA).
Immunohistochemistry
Polyclonal antibody against human calcitonin (Peninsula Laboratory, Belmont, CA) was diluted 1:1000 for immunohistochemistry. Frozen or paraffin-embedded baboon endometrial tissues were sectioned at 7 µm and mounted on slides. Frozen sections were then fixed in 5% formaldehyde solution in PBS. Sections were washed in PBS for 20 min and then incubated in a blocking solution containing 10% normal goat serum for 10 min before incubation in primary antibody overnight at 4°C. Immunostaining was performed using a Streptavidin-Biotin kit for rabbit primary antibody (Zymed, Burlingame, CA). Sections were counterstained with hematoxylin, mounted, and examined with brightfield microscopy. Red deposits indicated the sites of immunostaining. In control experiments, the sections were incubated with normal rabbit serum instead of antibody to calcitonin.
Statistical analyses
Statistical evaluations of the data representing the levels of calcitonin in endometrium on different days of the menstrual cycle and before and after treatment of ZK 137.316 were performed using ANOVA and the Fisher least significant differences test. P < 0.05 was considered statistically significant.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
To monitor the expression of calcitonin mRNA in baboon endometrium during the menstrual cycle, we analyzed RNA isolated from baboon endometrial biopsies for the presence of calcitonin by RT-PCR. The RNA samples obtained from the endometrium of baboon at different days of the cycle were reversed transcribed and amplified by PCR using calcitonin gene (exon 4)-specific primers. The PCR-amplified products were then subjected to Southern blot analysis employing a radiolabeled human calcitonin cDNA fragment containing exon 4 as probe. The results depicted in Figure 1 show that no calcitonin transcripts were detected in the early follicular or late follicular phase of the cycle (upper panel). The signal corresponding to calcitonin mRNA was also barely detectable on Day 5 or Day 8 PO. It was interesting that the level of calcitonin mRNA increased dramatically on Days 9 and 10 PO, which overlaps with the time of uterine receptivity in the baboon. The signal corresponding to calcitonin mRNA declined sharply during the late luteal phase on Days 12 to 15 PO. The relative levels of calcitonin mRNA expression in the endometrium on different days of the cycle were estimated by densitometric scanning and normalized to the control glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA signal (Fig. 1, lower panel). The expression of calcitonin on Days 9–10 PO was significantly greater (
10-fold) than that observed on any other day of the cycle.
|
Calcitonin Protein Is Localized in Both Glandular Epithelium and Stroma of Baboon Endometrium
To localize the site of calcitonin protein accumulation in the baboon endometrium, immunocytochemical staining of endometrial sections was performed at different stages of the menstrual cycle using an antibody against human calcitonin. No significant staining was observed either in the glandular epithelial or stromal cells of endometrial sections on Days 5 (n = 2), 8 (n = 2), and 12 PO (n = 2) (Fig. 2 A, B, and D, respectively). However, sections of baboon endometrium on Day 10 PO (n = 2) exhibited strong calcitonin-specific staining (Fig. 2C). This staining was present in the glandular epithelial and stromal cells. No significant staining was observed in the spiral arteries (data not shown).
|
Calcitonin Expression in the Baboon Endometrium Is Regulated by Progesterone
Our previous studies showed that calcitonin expression in the rat uterus is regulated by progesterone [10, 11]. We therefore examined whether calcitonin expression in the baboon endometrium was also under progesterone regulation. Animals were treated with an antiprogestin, ZK 137.316, which blocks progesterone receptor activity. Normally, cycling animals received this drug for 9 days beginning on the day of the LH surge. Endometrial tissues were isolated and monitored for calcitonin expression on Day 10 PO by RT-PCR. As expected, control endometrial tissue on Day 10 PO exhibited a signal corresponding to calcitonin mRNA (Fig. 3, left lane). There was, however, a dramatic decrease in the expression of calcitonin mRNA upon administration of ZK 137.316 (Fig. 3, right lane). Quantitative analyses indicated greater than 90% decline in uterine calcitonin mRNA levels upon administration of ZK 137.316 (Fig. 3, lower panel).
|
We also monitored calcitonin protein expression in baboon endometrial tissues by immunohistochemistry following treatment with ZK 137.316. Significant calcitonin-specific staining in the endometrial glands and stroma was observed on Day 10 PO (n = 2) of control animals (Fig. 4A). In contrast, calcitonin-specific staining was virtually undetectable on Day 10 PO following treatment with ZK 137.316 (n = 2) (Fig. 4B).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Progesterone regulates calcitonin expression in rat uterus [10, 11]. It is interesting that calcitonin expression is induced in epithelial and stromal cells of baboon endometrium on Days 9 and 10 PO, the time of peak progesterone production. The actions of progesterone in various uterine cell types are mediated by intracellular progesterone receptors (PRs). The hormone-bound PR regulates the expression of various target genes in the uterus, thereby changing the function of the tissue. Synthetic antiprogestins, such as RU486 and ZK 137.316, which bind to the PR and inhibit its gene regulatory activity [20], are powerful tools for confirming PR regulation of target genes. Our previous studies showed that binding of RU486 to rat endometrial PR blocked calcitonin expression, indicating a receptor-mediated gene regulatory mechanism [11]. Consistent with this observation, Conneely and coworkers used PR knockout mice to demonstrate that calcitonin expression in the uterus is indeed regulated by PR [21]. Our present studies showed that treatment with ZK 137.316 abolishes calcitonin mRNA and protein expression in baboon endometrial tissue during postovulatory Days 9 and 10. These results indicated that progesterone-complexed-PR plays a critical role in calcitonin expression in primate endometrium. Calcitonin is therefore a new progesterone-regulated marker in the baboon endometrium.
The mechanism by which PRs regulate calcitonin gene expression in baboon endometrium is not clear. It is possible that PR interacts directly with the calcitonin promoter to regulate its expression. Alternatively, the action of PR may be indirect: it may induce a gene product, which in turn, interacts with and regulates calcitonin promoter. Previous studies have shown that the expression of certain genes, including cyclooxygenase-1 (COX1) and heparin-binding EGF-like growth factor (HB-EGF), is down-regulated in baboon endometrium in response to ZK 137.316 [22, 23]. However, it is not known whether any of these genes is directly regulated by PR. In contrast, our previous studies have shown that PR directly regulates calcitonin promoter in Ishikawa endometrial cells [11]. The progesterone response element in the calcitonin promoter, however, remains undefined.
Because the uterine expression of calcitonin is mediated by the PRs, it is of interest to compare the patterns of spatial distribution of these two proteins in the endometrial cells during the luteal phase of the cycle. Previous studies employing immunohistochemistry determined the spatial and temporal expression of PRs in the baboon endometrium during the menstrual cycle [15]. High amounts of PRs are expressed in the glandular epithelium, stroma, and myometrium immediately following ovulation. By the midluteal phase, staining for PR is still intense in the glandular epithelium and stroma throughout the endometrium. The PR contents of the glandular epithelium of the functionalis decline progressively as the menstrual cycle advances from the mid to the late luteal phase. In contrast, the receptor contents of the glandular epithelium of the basalis, stromal, and myometrial cells do not decrease appreciably with the progression of the luteal phase. The observation that calcitonin expression is detected in both glandular epithelial and stromal cells in the midluteal phase of the cycle is consistent with the fact that significant levels of PRs are present in these endometrial compartments.
What is the likely functional role of calcitonin in the baboon uterus? Our previous studies in the rat using antisense ODNs suggested that calcitonin critically controls uterine receptivity prior to implantation [13]. Our recent studies in cultured Ishikawa endometrial cells show that calcitonin addition leads to a rise in intracellular calcium, which, in turn, decreases the expression of the calcium-dependent cell adhesion molecule, E-cadherin, at cell-cell contact sites [24]. Consistent with this in vitro observation, we found that administration of exogenous calcitonin down-regulates E-cadherin expression in the endometrial epithelium of pregnant rats without altering the expression of ZO-1, a marker of tight junctions [24]. The down-regulation of E-cadherin in the uterine epithelial cells has an important implication during implantation. The uterine luminal epithelial cells, like other epithelial cells, are held together by the E-cadherins present in "adherence junctions". A decline in E-cadherin levels suggests a change in lateral adhesion between these cells. This is consistent with the process of implantation in rodents and primates in which the trophoblast penetrates the uterine epithelium by intruding between uterine epithelial cells [2]. We therefore speculate that the calcitonin-induced down-regulation of E-cadherin at the time of implantation leads to a plastic epithelium in which the intercellular space can be penetrated more easily by invading trophoblast cells. Future studies will determine whether the surge of calcitonin and down-regulation of E-cadherin are functionally linked events in the baboon endometrium during implantation.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Correspondence. FAX: 217 244 1652; ibagchi{at}uiuc.edu
Received: 5 June 2002.
First decision: 6 July 2002.
Accepted: 23 October 2002.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  S. M Krzysik-Walker, O. M Ocon-Grove, S. B Maddineni, G. L Hendricks III, and R. Ramachandran Identification of Calcitonin Expression in the Chicken Ovary: Influence of Follicular Maturation and Ovarian Steroids Biol Reprod, October 1, 2007; 77(4): 626 - 635. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Pham, M. Dong, J. D. Wade, L. J. Miller, C. J. Morton, H.-l. Ng, M. W. Parker, and P. M. Sexton Insights into Interactions between the {alpha}-Helical Region of the Salmon Calcitonin Antagonists and the Human Calcitonin Receptor using Photoaffinity Labeling J. Biol. Chem., August 5, 2005; 280(31): 28610 - 28622. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
