Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print November 27, 2002.
Biol Reprod 2002, 10.1095/biolreprod.102.004937
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
68/4/1437    most recent
biolreprod.102.004937v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tirado, O. M.
Right arrow Articles by Suárez-Quian, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tirado, O. M.
Right arrow Articles by Suárez-Quian, C. A.
Agricola
Right arrow Articles by Tirado, O. M.
Right arrow Articles by Suárez-Quian, C. A.
BIOLOGY OF REPRODUCTION 68, 1437–1446 (2003)
DOI: 10.1095/biolreprod.102.004937
© 2003 by the Society for the Study of Reproduction, Inc.


Testis

Methoxyacetic Acid Disregulation of Androgen Receptor and Androgen-Binding Protein Expression in Adult Rat Testis1

Oscar M. Tiradoa, Elisabeth D. Martínezb, Olga C. Rodriguézb, Mark Danielsenb, David M. Selvaa, Jaume Reventósa, Francina Munella, and Carlos A. Suárez-Quian2,c

a Unitat de Recerca Biomedica, Hospital Materno-Infantil Vall d'Hebron, Barcelona, Spain b Department of Biochemistry & Molecular Biology c Department of Cell Biology, Georgetown University Medical School, Washington, District of Columbia 20007


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chemical agents can disrupt the balance between survival and apoptosis during spermatogenesis and thus give rise to reduced counts of spermatozoa (oligospermia). One such agent that produces significant germ cell apoptosis at specific stages of the cycle of the seminiferous epithelium is methoxy acetic acid (MAA), the active metabolite of a commonly used solvent, methoxyethanol. Although MAA gives rise to apoptosis of pachytene spermatocytes, it is not known whether MAA exerts a direct effect on germ cells or whether it also affects other testicular cell types such as the Sertoli cells. In the present investigation, we tested the hypothesis that MAA has direct effects on Sertoli cells in vivo. In MAA-treated rats, stage-specific expression of androgen receptor (AR) protein in Sertoli cells was significantly altered, as determined by AR immunohistochemistry. In MAA-treated animals, high AR expression was found in Sertoli cells coincident with the MAA-induced apoptosis of late-stage pachytene spermatocytes. The altered expression of AR in MAA-treated animals was also seen in seminiferous tubules harvested by laser capture microdissection. In addition to effects on AR expression, androgen-binding protein (ABP) mRNA levels were also altered in a stage-specific manner. Using a different system for mouse Sertoli cell lines TM4 and MSC-1, positive for either AR or ABP, respectively, we found a direct effect of MAA on ABP protein and mRNA expression in the MSC-1 cell but did not detect an effect on AR protein or mRNA expression in TM4 cells. Mouse fibroblasts that express endogenous AR were stably transfected with two AR promoter/reporter systems (MMTV-CAT and probasin-luciferase, respectively). We used these fibroblasts to examine the ability of MAA to potentiate dihydrotestosterone (DHT) activation of AR. Although MAA did not activate AR directly, it did potentiate DHT activation of the AR by 2- to 4-fold. MAA altered the expression level of AR and ABP in vivo and increased AR transcriptional activity in tissue culture cells. The abnormal spermatogenesis generated by MAA is at least partly due to direct effects on Sertoli cells. It is still unclear whether MAA elicits a proapoptotic signal from Sertoli cells or diminishes a prosurvival signal required by germ cells downstream to altering AR and ABP expression in a stage-specific fashion.

androgen receptor, apoptosis, spermatogenesis, testis, toxicology


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Methoxyacetic acetic acid (MAA) is the principal toxicant metabolite of ethylene glycol ether 2-methoxyethanol (2-ME), a toxicant known to exert transient but catastrophic effects on testicular histology and function. Administration of MAA to male rodents either by gavage or via i.p. injection at a nonlethal dose leads to significant infertility [1]. Similarly, in humans, men show an increased prevalence of oligospermia and azoospermia after environmental exposure to 2-ME [2]. Given the ubiquitous presence of 2-ME and MAA in paints and industrial solvents, there is a potential for a widespread negative impact on male reproductive health [3, 4].

The testicular cells primarily afflicted following exposure to MAA appear to be primary spermatocytes [512]. As early as 12 h postexposure, for example, nearly 50% of primary spermatocytes undergo apoptosis in a stage-specific fashion. The dramatic and rapid effect of MAA on pachytene spermatocytes suggests that these cells are direct targets for MAA. This hypothesis is hard to test, however, because pachytene spermatocytes rely on Sertoli cells in vivo and cannot be cultured adequately in vitro to assess direct MAA effects.

Primary cultures of immature rat Sertoli cells also respond directly to treatment with MAA and generate novel Sertoli cell products [13]. Similarly, in seminiferous tubule culture models Src (protein encoded by the Rous Sarcoma virus gene) is elevated in the Sertoli cells after incubation with MAA [14]. These observations suggest that Sertoli cells in vivo also respond directly to MAA and, in turn, may be involved in the regulation of apoptosis of primary spermatocytes. In this scenario, recently reviewed by Boekelheide and colleagues [15], germ cell apoptosis is a direct response to toxicant insult on Sertoli cells and may entail regulation of both prosurvival and proapoptotic factors.

Altering androgen or androgen-binding protein (ABP) levels also induces apoptosis of spermatocytes. For instance, abolition of androgens by destroying Leydig cells with ethane dimethane sulfonate (EDS) results in a decrease in intratesticular androgen levels and a concomitant diminution in androgen receptor (AR) immunostaining [16] and is accompanied by significant germ cell apoptosis [1720]. Altered expression of ABP in a mouse transgenic model is associated with significant apoptosis of pachytene spermatocytes [21]. In the present study, we investigated whether MAA alters AR and ABP expression levels in Sertoli cells. Our results show that ABP levels are changed in a Sertoli cell culture system and that aberrant expression occurs in a stage-specific fashion in Sertoli cells in vivo. Significant stage-specific disregulation of AR expression occurs in Sertoli cells in vivo. In a mouse Sertoli cell line, however, no MAA effect on AR protein or mRNA levels were detected.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals and Treatments

Adult male rats were handled in accordance with protocols approved by the Georgetown University Animal Use and Care Committee and the Vall d'Hebron Hospital Animal Use and Care Committee. Twenty-three adult male Sprague-Dawley rats, weighing approximately 400 g, were maintained under standard conditions. The rats were treated with a single i.p. injection of MAA (650 mg/kg body weight; Sigma-Aldrich, Steinheim, Germany), buffered to pH 7.4 in 0.9% saline solution and were killed at 3 h (n = 5), 6 h (n = 5), 9 h (n = 5), 12 h (n = 5), and 24 h (n = 3) after toxicant administration. The dose used was based upon published studies [512]. Five rats were used as controls and were treated with saline solution. Animals were killed by CO2 asphyxiation. One testis from each animal was fixed in 4% paraformaldehyde for 24 h and subsequently embedded in paraffin. The other testis was minced, immediately frozen, and used for DNA and RNA extractions. Ten additional rats were used for laser capture microdissection (LCM) experiments (two controls and two killed at 3, 6, 9, and 12 h). Rats were killed as before, and testes were removed immediately and frozen in liquid nitrogen.

TUNEL

A TUNEL assay was performed as previously described [21]. Dewaxed and rehydrated sections were treated with 20 µg/ml proteinase K for 15 min and with 3% hydrogen peroxide for 5 min. After incubation with terminal deoxynucleotidyltransferase (TdT) buffer (25 nM Tris HCl, 200 mM cacodylate acid, and 200 mM KCl) for 15 min, sections were treated with 0.05 U/µl TdT (Roche Molecular Biochemicals, Mannheim, Germany) and 0.5 nM biotin-16-deoxy (d)-UTP (Roche Molecular Biochemicals) in TdT buffer at 37°C for 90 min and with 300 mM NaCl and 30 mM sodium citrate at room temperature for 15 min. After washing and incubating with 2% BSA, sections were exposed to avidin-biotin complex (ABC; Vector Laboratories, Burlingame, CA), diluted 1:25, at 37°C for 45 min, and the peroxidase reaction was visualized with diaminobenzidine and hydrogen peroxide.

Immunohistochemistry

Immunostaining of testicular sections for AR was performed as described previously [22]. Six-micrometer sections were cut, and AR was immunolocalized using a polyclonal antibody provided by Dr. Gail Prins (University of Illinois, Urbana, IL) and employing a biotin-streptavidin-immunoperoxidase method, including epitope retrieval. At the completion of the epitope retrieval, the sections were allowed to cool for approximately 20 min. Primary antibody was applied to the sections and allowed to incubate overnight at 4°C. The sections were then treated exactly as described in the instruction manual supplied with the manufacturer's immunostaining kit for aminoethyl carbazole as the chromogen (Zymed, South San Francisco, CA). The sections were counterstained for 30–60 sec with hematoxylin and coverslipped. As controls, additional sections were treated as follows: 1) primary antibody was omitted; 2) normal rabbit serum was used instead of primary antibody; 3) dilutions of primary antiserum were performed to quench positive staining as a function of specific antibody concentration; and 4) antibody was preadsorbed with specific immunopeptide and then used for immunostaining. The sections were photographed using a Zeiss Axiophot microscope fitted with a 63x objective, and images were recorded on Elite Chrome 100 ASA film (Kodak, Rochester, NY) set at 50 ASA. For publication, photographs were scanned at 300 dpi using a scanner (Hewlett Packard) and the final prints made using Adobe Photoshop imaging software (Adobe Systems, San Jose, CA) and an Epson 740 color printer (Epson).

Messenger RNA Isolation and Analysis of Its Expression by Reverse Transcription Polymerse Chain Reaction

RNA was obtained from total testis and from microdissected tubules by means of guanidium thiocyanate/phenol-chloroform extraction [23] and using a Micro RNA isolation kit (Stratagene, La Jolla, CA), respectively. One microgram of total RNA isolated from tissues was reverse transcribed using 200 U of Superscript II Rnase H-Reverse Transcriptase (Gibco BRL, Bethesda, MD) in a 20-µl reaction volume in the presence of 25 g/ml Oligo (dT), first strand buffer (50 mM Tris-HCl, 75 mM KCl, 3 mM MgCl2), 0.01 M dithiothreitol, and 10 mM of each dATP, dGTP, dCTP, and dTTP. The RNA and Oligo dT mix were heated at 70°C for 10 min and then cooled to 4°C, the other reagents were added, and the reverse transcription (RT) was performed at 42°C for 50 min. ABP polymerse chain reaction (PCR) primers were designed using Oligo 4.0 software (National Biosciences, Plymouth, MN) based on GenBank published sequences. For rat ABP, a 954-base pair (bp) product was amplified using an upper primer designed specifically against rat exon 1 (GAGAAGGGAGAGGTGGCCT) and a lower primer that specifically recognized exon 7 (GCTCAAGGCTACTTTGAATAC). In addition, a second primer set was used to perform the PCR for microdissected staged tubules, rendering a 246-bp product. This second primer set consisted of an upper primer (CAGCAAACCCTCTTCCTCC) from the 2–3 exon border and a lower primer (TTCCATCCACCCATAGCAGCAG) from exon 4. PCR primers for AR were designed using Primer Express version 1.0 software (Perkin-Elmer, Norwalk, CT); the upper primer (CTCCAGGATGCTCTACTTTGCA) hybridized to a sequence of exon 5, and the lower primer (ACACACTGGCTGTACATCCGAG) hybridized to a sequence of exon 6, rendering an 87-bp product. The primer set used to amplify L19 (a rat ribosomal protein) by PCR was AATCGCCAATGCCAACTCTCG for the upper primer and CCCTTCCTCTTCCCTATGCCC for the lower primer. L19 is frequently used as a standard control for competitive RT-PCR measurements [24]. Amplification was carried out in a 2400 thermocycler (Perkin-Elmer, Applied Biosystems, Foster City, CA) and consisted of 40 cycles of amplification, with denaturation at 94°C for 15 sec, annealing at 59°C for both AR and ABP, and extension at 72°C for 45 sec. PCR products were separated on a 2% agarose gel and quantified by the Molecular Analyst/Macintosh data analysis software using a Bio-Rad Image Analysis System (Bio-Rad Laboratories, Hercules, CA). The products of amplification were purified using the QIAquick PCR Purification Kit (Quiagen, Hilden, Germany) according to the supplier's instructions and were sequenced using an ABI Prism 310 genetic analyzer (Perkin-Elmer).

Laser Capture Microdissection

The strategy for targeting and harvesting stage-specific seminiferous tubules by LCM was published previously [25]. In the present study, either control testis or testes from MAA-treated rats were removed from the animals and placed in ice-cold 30% sucrose until they sunk to the bottom of a scintillation vial (approximately 4 h). Testes were then immersed in Tissue-Tek (Sakura Finetechnical Co., Torrance, CA) and frozen in liquid nitrogen. Six- to 7-µm sections were cut in a cryostat and attached to glass slides. Sections were fixed for 30 sec in 70% ethanol and then stained with hematoxylin and eosin by conventional means. LCM was performed using a PixCell II apparatus (Arcturus, Mountain View, CA), essentially as described in detail previously [25]. Fifty tubule cross sections at specific stages (III–IV, VII–VIII, or X–XIII) were pooled, and total RNA was extracted using a MicroRNA extraction kit (Stratagene, Cedar Creek, TX). From 50 tubule cross sections harvested by LCM, there was sufficient total RNA to perform five RT-PCRs for AR and ABP. The quality of the RNA prepared from the harvested tubules by LCM was confirmed by performing an isolated harvest of 50 tubules, preparing the sample as for the experimental tubules, running the sample on a 2% agarose gel, and staining the gel with ethidium bromide to visualize the 28S and 18S bands.

Sertoli Cell Lines

MSC-1 and TM4 mouse Sertoli cell lines were a gift from Dr. Leslie Heckert (University of Kansas, Lawrence, KS). MSC-1 cells were grown in Dulbecco modified Eagle medium (DMEM) containing 5% bovine calf serum at 37°C in a saturated atmosphere of 5% CO2 [26]. TM4 cells were grown in a 1:1 mixture of Ham F12 medium and DMEM with 1.2 g/L sodium bicarbonate and 15 mM Hepes (92.5%), horse serum (5%), and fetal calf serum (2.5%) [27].

Protein Extraction and Western Blot Analysis

Primary cultures of Sertoli cells TM4 or MSC-1 were lysed with radioimmunoprecipitation assay (RIPA) buffer containing protease inhibitors (1 mM PMSF, 10 mg/ml aprotinin, and 10 mg/ml leupeptin), and the lysates were centrifuged at 13 000 x g at 4°C for 30 min. The protein content of the supernatant was determined by the Bradford assay (Bio-Rad). Equal amounts of protein (30 µg) from either TM4 or MSC-1 cells were resolved by 10% SDS-PAGE and transferred to nitrocellulose membranes. After blocking, the membranes were incubated at 4°C overnight with 2 µg/ml of the PG21 rabbit polyclonal anti-mouse AR antibody (TM4) or with anti-ABP antiserum diluted approximately 1:400 (a gift from Dr. Neal Musto [28]). Next, the blots were incubated for 1 h at room temperature with horseradish peroxidase-conjugated secondary antibody (1:2000). Peroxidase activity was analyzed with the SuperSignal West Pico Chemiluminescent substrate kit (Pierce, Rockford, IL) according to the manufacturer's instructions. The AR and ABP content in TM4 and MSC-1 cells, respectively, was determined densitometrically.

Cell Culture

The L929 fibroblast cell line, originally derived from a mouse fibrosarcoma, was purchased from the American Type Culture Collection (Manassas, VA). L929 MMTV-CAT cells containing integrated copies of the androgen-inducible construct MMTV-CAT and L929 probasin-luciferase cells containing integrated copies of the androgen-inducible construct probasin-luciferase have been described previously [29]. Cells were cultured in DMEM supplemented with 3% calf serum, 100 IU/ml penicillin, and 100 µg/ml streptomycin. For the development of the L929 MMTV-CAT stable cell line, L929 cells were transfected using Dosper liposomal reagent (Boehringer Mannheim, Mannheim, Germany) with pMMTV-CAT and pSV2neo (20:1) according to the manufacturer's protocol. To obtain the L929-ProbasinLuc cell line, L929 cells were transfected using Lipfectamine 2000 reagent (Life Technologies, Rockville, MD) with p-286/+28PB-luciferase [30] and pSV2neo (20:1 ratio), according to the manufacturer's protocol. In both cases, the cells were split 48 h after transfection and selected in growth medium supplemented with 400 mg/L G418 sulfate (Cellgro, Herndon, VA). Single clones were picked with sterile pipette tips and expanded. Clones were screened for chloramphenicol acetyl transferase (CAT) or luciferase activity after 24 h of hormone induction. Single clones showing low basal reporter activity and at least a 5-fold activation with dihydrotestosterone (DHT) were used for further studies (clones L929-MMTV-CAT 31 and L929-ProbasinLuc 2.9 were used in this study).

CAT and Luciferase Assays

Stably transfected L929 cell cultures were treated with hormone and/or MAA for 24 h and harvested in 0.25 M Tris-HCl, pH 7.8. For CAT assays, equal amounts of protein from each cell extract were combined with radiolabeled acetyl coenzyme A and chloramphenicol in Tris buffer, and the reaction mixture was overlaid with organic scintillation fluid, as previously described [30]. The acetylated product becomes incorporated into the organic phase and is counted in a scintillation counter. For luciferase assays, cell extracts were combined with Luciferase Assay Substrate (Promega, Madison, WI) in glass tubes and immediately counted in a luminometer to detect production of luminescence. A Student t-test of variance using Microsoft Excel 2000 software (Microsoft, Redmond, WA) was performed to determine differences in the ability of DHT alone and DHT plus MAA to promote AR transcriptional activity. Differences between group means were considered significant at P <= 0.05.

Statistical Analysis

Experiments shown in Figures 3, 5, 6, and 7 were repeated at least three times with exceptions as noted. Replicates (three or four) were used for each group within an experiment. An ANOVA was used to assess the significance of differences between group means, and groups were considered significantly different at P <= 0.05.



View larger version (47K):
[in this window]
[in a new window]
 
FIG. 3. ABP and AR mRNA expression in total testis after MAA treatment. Adult rats were treated with a single i.p. injection of MAA, and testes were collected at indicated times and assayed for relative AR and ABP mRNA levels. A sample gel was used to quantify mRNA expression (A), and the relative levels of the ABP and AR mRNA expression posttreatment are shown (B). AR mRNA expression was not changed, whereas ABP mRNA was significantly elevated beginning at 6 h posttreatment. Each experiment was repeated in triplicate for each animal. Asterisk indicates significance at P <= 0.05



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 5. Stage-specific ABP and AR mRNA expression in tubules obtained by LCM. Fifty staged seminiferous tubules were harvested by LCM after MAA treatment at the indicated times, and total RNA was extracted and probed for AR and ABP mRNA levels relative to control tubules. Changes in AR mRNA (A) and in ABP mRNA (B) are presented. In control tubules, maximal AR mRNA expression is present in stages VII–VIII. The AR mRNA expression evident in stage XII tubules may correspond to peritubular myoid cells. At 3, 6, and 12 h after MAA treatment, maximal AR mRNA expression in stage VII–VIII tubules diminishes, whereas expression is elevated in stages III–IV and X–XII. ABP mRNA expression in control testis is maximal in stages X–XII, and no expression was detected in stages VII–VIII (F). In response to MAA, ABP mRNA increased in the middle stages (VII–VIII) and decreased at the later stages (X–XII), and no changes were detected at stages III–IV. Asterisks indicate significant differences between control and MAA treatment at each time point (P <= 0.05)



View larger version (50K):
[in this window]
[in a new window]
 
FIG. 6. AR and ABP mRNA expression in TM4 and MSC-1 cells. Cell lines were cultured in the constant presence of DHT, then MAA was added and cells were harvested at indicated times. A) Relative AR mRNA expression in TM4 cells. Sample from one of three different experiments performed to calculate significance is shown. B) Relative ABP mRNA expression in MSC-1 cells. Asterisk represents significance at P <= 0.05



View larger version (53K):
[in this window]
[in a new window]
 
FIG. 7. Western blot of AR and ABP in TM4 and MSC-1 cells. Cell lines were cultured in constant presence of DHT, then MAA was added for indicated times. A) AR protein levels in TM4 cells. B) ABP protein levels in MSC-1 cells. The upper panel is a representative sample from three separate experiments. Asterisk indicates significance at P <= 0.05


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
MAA Induces Apoptosis in Pachytene Spermatocytes

Rats were treated with a single i.p. injection of MAA, and testes were harvested 9 h later and processed for TUNEL to determine the degree of apoptosis (Fig. 1). In random sections examined at low magnification, TUNEL was easily detected in some tubules and appeared to be present in all pachytene spermatocytes of the seminiferous epithelium of TUNEL-positive tubules. In contrast, other tubule profiles appeared completely devoid of any TUNEL. Inspection of tubule stages after a short-term exposure of MAA (6–9 h) from an i.p. injection revealed that all pachytene spermatocytes at stages II–IV and stages XII–IV became TUNEL positive (Fig. 1C). However, at no times did large numbers of pachytene spermatocytes residing at stages V–IX exhibit robust TUNEL. Thus, a distinct marker of toxicity from short-term exposure to MAA is the specific TUNEL characteristics of the pachytene spermatocytes as a function of the cycle of the seminiferous epithelium.



View larger version (95K):
[in this window]
[in a new window]
 
FIG. 1. Stage-specific pachytene spermatocyte apoptosis after MAA treatment. Adult rats were given a single i.p. injection of MAA (650 mg/kg body weight), and testes were processed for TUNEL at 3, 6, 9, and 12 h. A) Survey image (low magnification) of the heterogeneous TUNEL of pachytene spermatocytes as a function of the cycle of the seminiferous epithelium. x125. B and C) Staged tubules from the same section indicate TUNEL-negative pachytene spermatocytes at stage VII and TUNEL-positive pachytene spermatocytes at stage XII. Stages III–IV (not shown at higher magnification) also exhibit similar TUNEL intensity of pachytene spermatocytes as present at stage XII. x600

Testicular AR Immunohistochemistry in Testis

Specific AR immunostaining in adult rat seminiferous tubules is found within the nuclei of Sertoli and peritubular myoid cells, the latter forming the walls of the tubules [31]. Although the intensity of the staining in the myoid cell nuclei is constant, in the Sertoli cell nuclei it varies as a function of the cycle of the seminiferous epithelium (Fig. 2, control). At earlier stages I–IV (Fig. 2, A and B) the staining is weak and often difficult to discern. However, as spermiation approaches at stages VII–VIII (Fig. 2C), staining intensity becomes more robust and reaches its maximum level coincident with those tubules in which sperm release occurs. In these later stages the first signs of germ cell loss are detected because of androgen deprivation following experimental insult [32]. In subsequent stages IX–XIV (Fig. 2D), AR staining in Sertoli cell nuclei cannot be detected [16, 31].



View larger version (136K):
[in this window]
[in a new window]
 
FIG. 2. AR immunohistochemistry in control and MAA-treated rat testis. Adult rats were given a single i.p. injection of MAA (650 mg/kg body weight), and testes were removed and immunostained for AR at 3, 6, 9, and 12 h. The relative AR staining intensity in Sertoli cell nuclei from untreated testes as a function of the cycle of the seminiferous epithelium is shown. Changes in the AR staining intensity in Sertoli cell nuclei after MAA treatment as a function of the cycle are readily apparent. Roman numerals of rows indicate the approximate stage of the cycle, whereas columns are grouped into time after MAA exposure. In control testis (AD), maximal AR immunostaining is evident in stage VIII Sertoli cells (30), and there is variable AR staining intensity at other stages. Sertoli cells at stages IX–XIV do not immunostain for AR (16, 30). As early as 6 h posttreatment, the relative AR immunostaining intensity is altered, maximal staining intensity becomes apparent at earlier stages (B'), and stage VIII staining becomes diminished (C'). The altered AR immunostaining intensity in Sertoli cells as a function of the cycle is maintained 9 h posttreatment (A'D'). At 12 h posttreatment, stage XII Sertoli cells and higher become AR positive (D'''). In D to D'', the Sertoli cell nuclei were interpreted to be AR negative, because in the absence of the hematoxylin counterstain their presence could not be discerned. x500

MAA treatment led to a dramatic alteration in the expression of the AR in Sertoli cells (Fig. 2). This effect was clearly seen after only 6 h of treatment (the earliest time point examined), where there was an increased expression of AR in stage IV cells when compared with controls (Fig. 2, compare B with B'). Concomitant with the increased expression in stage IV cells there was a decreased expression of AR in stage VIII Sertoli cells (Fig. 2, compare C with C'). By 12 h of MAA treatment, expression of AR in stage VIII Sertoli cells remained low and there was an increase in expression in both early (stage I–II) and late (stage XII) cells. The AR staining in stage XII and later Sertoli cell nuclei (Fig. 2D''') was particularly interesting because AR expression in these cells has not been reported previously in rodents under any experimental conditions.

AR and ABP mRNA Expression in MAA-Treated Rats

In the experiments described above, the cyclic expression of AR protein in vivo was altered by MAA treatment. To determine whether this alteration in AR immunostaining intensity as a function of the cycle of the seminiferous epithelium reflected an overall change in AR expression in the whole testis, AR mRNA levels were quantified in the testes of rats treated with MAA for 3–24 h. Overall AR mRNA levels did not change during this time course (Fig. 3). In contrast, ABP levels were significantly higher in testicular extracts of rats 6 h posttreatment (when compared with control levels) and remained elevated for the duration of the experiment (Fig. 3).

AR and ABP mRNA Levels in Stage-Specific Tubules Harvested by LCM

The lack of overall changes in AR levels as seen in total testicular extracts probably reflects the developmental changes in AR expression, i.e., some cells in the testis produce more AR in response to MAA whereas others produce less. For that reason, we examined AR mRNA expression in isolated staged tubules using LCM (Fig. 4). Tubule cross sections were examined first at high magnification (Fig. 4B). Stages were determined, and then all the cells found within the specific cross section were collected by LCM. The remaining void in the tissue section indicated the degree to which a particular tubule section was successfully harvested by LCM (Fig. 4C). No attempt was made to capture seminiferous tubules free of the peritubular myoid cells. Approximately 10–15 tubule cross sections, all at the identical stage of the cycle of the seminiferous epithelium, were collected onto one cap (Fig. 4D) and then up to 50 captured tubules were pooled for RNA isolation. The quality of the RNA extracted from 50 tubule cross sections was evaluated using agarose gel electrophoresis and ethidium bromide staining of the 28S and 18S bands (Fig. 4E).



View larger version (132K):
[in this window]
[in a new window]
 
FIG. 4. Acquisition of stage-specific tubules by LCM. The steps taken to harvest stage-specific seminiferous tubules are illustrated (reviewed in [24]). At low magnification (A), tubules are targeted, and the identity of the stage is verified at higher magnification (B). Next, the targeted tubule is acquired by LCM, and the void remaining in the tissue section is displayed (C). The harvested tubule that is affixed to the cap can also be displayed (D). No attempts were made to capture seminiferous epithelium devoid of the peritubular myoid cells. Approximately 10–15 tubules, all at the same stage of the cycle, were collected onto one cap, and caps were then extracted for total RNA using the same solution so all of the RNA from approximately 50 tubules could be pooled into one aliquot. One fifth of an aliquot of total RNA harvested from 50 staged tubules was used to prepare the gel (E)

Relative AR and ABP mRNA levels were determined in the stage-specific tubules harvested by LCM from either control or MAA-treated rats at times indicated in Figure 5. In control tubules, the pattern of AR mRNA expression levels as a function of the cycle of the seminiferous epithelium were similar to the protein level expression pattern revealed by immunohistochemistry. Moderate levels were present in stages III–IV, maximum levels were present at stages VII–VIII, and minimal levels were detected in late stages (X–XIII). Presumably, the low level of AR mRNA detected in the later stages was due to the contribution of peritubular myoid cells that were collected by LCM along with the seminiferous epithelium. The pattern of ABP mRNA levels in control tubules as a function of the cycle differed significantly from that observed for AR mRNA. In early (III–IV) and late (X–XIII) stages, ABP mRNA levels were relatively high, whereas no ABP mRNA was detected in stages VII–VIII.

MAA treatment had a very rapid effect on AR mRNA levels in all stages of the seminiferous tubule (Fig. 5). By 3 h, AR mRNA levels had decreased in stages VII–VIII but had significantly increased in the other two groups of stages III–IV and X–XIII. At later times after MAA treatment, AR mRNA levels remained high in both early (III–IV) and late (X–XII) stages but remained low during the middle stages (VII–VIII). The changes in mRNA levels after MAA treatment indicate that at least part of the effect of MAA is due to an alteration in the rate of AR transcription and/or mRNA stability. There was perfect correlation of changes in AR mRNA levels with changes in protein levels seen previously, although there was a 3-h lag phase in protein level alteration relative to the mRNA increase.

Expression levels of ABP mRNA were also affected by MAA administration to rats (Fig. 5). As early as 6 h posttreatment, ABP mRNA levels at stages III–IV had decreased, but they returned to normal levels by 12 h. In contrast, at stages VII–VIII, ABP mRNA increased 3 h posttreatment, and levels failed to return to normal by 12 h. In the later stages (X–XIII), ABP mRNA levels decreased gradually at 3 and 6 h and then underwent a significant decrease at 12 h relative to control levels.

AR and ABP mRNA and Protein Levels in Cell Lines

The previous experiments showed that MAA has rapid and dramatic effects on Sertoli cell gene expression in vivo. However, in such a system it is hard to determine which effects are due to direct effects on Sertoli cells and which are mediated through other cell types. Thus, we examined the direct effects of MAA on the expression of AR and ABP in Sertoli cell lines.

ABP mRNA and protein expression were examined in the MSC-1 cell line. Increases in both ABP mRNA and ABP protein levels were clearly seen by 12 h and remained elevated at 24 h (Figs. 6 and 7). Thus, Sertoli cells in culture can respond to MAA, indicating that in vivo at least some of the effects of MAA are due to a direct interaction with Sertoli cells. Because MSC-1 cells do not produce AR, we used the TM4 cell line to examine effects of MAA on AR protein and mRNA levels. Treatment of cells with MAA had no effect on AR protein or mRNA levels even after 24 h of treatment (Figs. 6 and 7). This result is perhaps not surprising because even in vivo only some cells at specific stages of the cycle show altered AR expression levels.

Potentiation of DHT Activation of AR by MAA

Because no effect on AR expression levels was detected in TM4 cells treated with MAA, we evaluated whether MAA could affect the activity of the AR. L929 cells expressing endogenous AR and stably transfected with a MMTV promoter-CAT reporter system were exposed to MAA in the presence or absence of androgens. AR transcriptional activity was measured in CAT assays. At 5 mM, MAA potentiated androgen induction of AR activity 3- to 4-fold (Fig. 8). This effect was fully blocked by the antiandrogen cyproterone acetate, indicating that the MAA effect is mediated by the AR. To determine whether MAA could potentiate androgen action at androgen concentrations that elicit a suboptimal transcriptional response, cells were treated simultaneously with MAA and with increasing concentrations of androgen. MAA was able to potentiate DHT at all concentrations tested, suggesting that this effect does not require the presence of high amounts of androgens (Fig. 8). Although a potent enhancer of DHT, MAA showed no androgenic activity of its own.



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 8. Potentiation of DHT by MAA on MMTV-CAT. L929 fibroblasts that express endogenous AR were stably transfected with the MMTV-CAT promoter/reporter system, and the ability of MAA to activate the receptor during a 24-h period was determined. MAA (5 mM) alone had no DHT activity, but in combination with 1 nM DHT and at increasing DHT concentrations indicated, MAA exhibited the ability to potentiate DHT activity 3- to 4-fold. Cyproterone acetate (1 µM) completely inhibited the DHT potentiation effect of MAA. NH, No hormone. All experiments were performed three times. Double asterisks indicate significance at P <= 0.05 and single asterisks indicate significance at P <= 0.01 between DHT at the corresponding doses plus/minus MAA

To determine whether MAA potentiation of androgens could occur with a natural androgen-responsive gene, we used MAA in the presence or absence of androgens to treat mouse fibroblast L929 cells stably transfected with a probasin promoter-luciferase reporter construct. Again, MAA potentiated the effects of DHT 2- to 4-fold, and this enhanced activity was fully inhibited by cyproterone acetate (Fig. 9). On the probasin promoter, MAA also lacked the ability to elicit a transcriptional response in the absence of androgens. These data demonstrate that MAA increases the transcriptional activity of the AR, suggesting that alteration of the AR function by MAA can contribute to its deleterious effects on spermatocytes.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 9. Potentiation of DHT effects by MAA using a probasin-luciferase system. L929 fibroblasts that express endogenous AR were stably transfected with the probasin-Luciferase promoter/reporter system, and the ability of MAA to activate the receptor during a 24-h period was determined. At 5 mM, MAA exhibited the ability to potentiate DHT activation of AR 2- to 3-fold, and this activity was inhibited by cyproterone acetate (CA). At lower concentrations of MAA (0.1–1 mM), no significant potentiation of DHT activity was observed. Asterisk indicates significance at P < 0.001 between DHT at the same concentration as the corresponding MAA concentrations that were varied


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
MAA is a well-known testicular toxicant that leads to decreased fertility due to the induction of apoptosis in pachytene spermatocytes. MAA directly affects Sertoli cells in vivo and in vitro, raising the possibility that part of its toxicity is due to its action on this cell type. Specifically, MAA alters the expression profile of both AR and ABP in a differentiation-specific manner. In addition, studies with an androgen-responsive transcription system showed that MAA potentiates the transcriptional activity of the AR. These data provide evidence that altered expression and transcriptional activity of the AR may play a role in MAA toxicity; thus, MAA may represent an endocrine active agent.

Apoptosis in Pachytene Spermatocytes

The transient toxicity of MAA is specific for pachytene spermatocytes and induces their death by apoptosis [5, 11], but neither the molecular mechanism nor the apoptotic trigger in these cells is known. MAA may modulate AR action in Sertoli cells, leading to the apoptosis. This hypothesis is at least partly supported by the apoptotic cell death of spermatocytes seen in animals with reduced AR function. This induction of cell death is seen with both chemical destruction of Leydig cells [1720] and with altered expression of ABP [21]. This hypothesis is also supported by the alteration in AR levels in MAA-treated animals occurring at early and late stages (Figs. 1, 2, and 5), the very stages that show the greatest amount of apoptosis. The mechanism of MAA-induced apoptosis is likely to be different than that for EDS-induced apoptosis, however, because EDS-induced apoptosis requires almost 3 days to take effect and preferentially occurs at stages VII–VIII [18], the stages not affected by MAA. Further, EDS treatment diminishes all AR immunostaining [16], whereas MAA effects occurred in a stage-specific manner.

Changes in AR and ABP Levels In Vivo and In Vitro

In vivo, altered levels of Sertoli cell AR mRNA and protein were seen at the earliest time points examined (3 and 6 h, respectively) and were detected 3–6 h prior to observing TUNEL in pachytene spermatocytes (Fig. 1), a timing interval consistent with a contribution of AR changes in Sertoli cells to spermatocyte cell death. In many tissues, fluctuating serum androgen levels control the activity of the AR. This is not the case in the testis; the seminiferous tubules are bathed in a very high concentration of testosterone, which is thought to saturate the receptor. Therefore, the most efficient way to control AR activity in the testis may be to control the level of the protein. The rapid changes in AR levels seen in MAA-treated animals should give rise to a rapid change in AR activity. The mRNA and protein data indicate that MAA alters the rate or stability (or possibly both attributes) of the AR and the level of mRNA, although one aspect of AR action that is not completely understood is the control of AR protein and mRNA levels by androgen itself.

MAA did not alter AR mRNA or AR protein in the TM4 cells but significantly changed ABP mRNA and protein in MSC-1 cells. One possible explanation of these results is that the regulation of AR expression in Sertoli cells requires the presence of germ cells, whereas ABP expression is germ cell independent. Alternatively, MAA may exhibit an effect on AR expression in Sertoli cells only within the context of the cycle of the seminiferous epithelium. Although the use of cell lines is not fully adequate [33, 34], these cell lines in particular were used because MSC-1 did not express AR, whereas TM4 did not express ABP. Thus, both cell lines were employed to examine the effect of MAA on AR and ABP. Given these limitations, additional work is needed to further elucidate the mechanism by which MAA directly influences Sertoli cells in vivo.

MAA Potentiates AR Transcriptional Activity

MAA potentiated the effects of DHT in the present experiment model but had no effect on the AR in the absence of hormone. Therefore, the increased transcriptional activity of the AR probably is not due to interaction of MAA with the AR itself but to some other event such as altered coactivator expression or modification of chromatin.

Germ Cell Apoptosis in Response to Toxicants

Boekelheide et al. [15] recently speculated that testicular toxicants might exert a deleterious effect on spermatogenesis by modulating one of three possible Sertoli cell activities, i.e., toxicants could depress prosurvival factors, increase proapoptotic factors, or both depress prosurvival and increase proapoptotic factors. We could not determine which mechanism is associated with MAA, although our results clearly demonstrate that MAA exerts an effect on Sertoli cell activity. Further, our present observations are similar to the previously reported increased clusterin [11] and Src immunostaining in Sertoli and dying pachytene spermatocytes after treatment with MAA [14]. Given that clusterin is implicated in apoptotic cell death [11] and that its expression appears to be androgen regulated [35], it should be interesting to examine whether MAA causes a stage-specific increase of clusterin mRNA. The more specific role of ABP in the apoptotic process is also not clear. In the ABP transgenic mouse, excess ABP was associated with increased pachytene spermatocyte apoptosis [21], but in the present experiment a similar correlation was not detected. Nevertheless, ABP is a Sertoli cell product that may serve to maintain intratubular androgen homeostasis [36], and its mRNA levels were significantly altered in a stage-specific fashion. These findings suggest that ABP also participates in the indirect apoptotic signaling of pachytene spermatocytes by a modification of the intratubular steroid levels. However, AR is unlikely to be directly implicated, because there is no evidence to suggest that ABP mRNA expression is under androgen regulation [37]. Thus, our results do not exclude the possibility that inappropriate alteration of both AR and ABP levels independently is associated with pachytene spermatocyte apoptosis.

Regardless of its demonstrated effects on Sertoli cells, MAA may also directly regulate germ cell activity. Recently, we examined the expression of estrogen receptor ß (ERß) in MAA-treated rat testis and found that short-term MAA exposure leads to enhanced expression of ERß protein and mRNA in pachytene spermatocytes destined to die by apoptosis (unpublished results). Whether this enhanced ERß expression is due to a direct MAA effect on the spermatocytes or whether the expression is mediated by another cell type such as Sertoli cells is not known. Therefore, it is important not to assume that any given testicular toxicant will produce a single action or will affect only one testicular cell type.


    FOOTNOTES
 
1 This work was supported by grants HD023484 from NICHD and 9951256U from the American Heart Association (to M.D.). Back

2 Correspondence: Carlos A. Suárez-Quian, Department of Cell Biology, Georgetown University Medical School, 3900 Reservoir Rd., N.W., Washington, DC 20007. FAX: 202 687 1823; suarezc{at}georgetown.edu Back

Received: 25 February 2002.

First decision: 19 March 2002.

Accepted: 31 October 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hardin BD. Reproductive toxicity of the glycol ethers. Toxicology 1983 27:91-102[CrossRef][Medline]
  2. Welch LS, Cullen MR. Effect of exposure to ethylene glycol ethers on shipyard painters: III. Hematologic effects. Am J Indust Med 1988 14:527-536[Medline]
  3. Veulemans H, Steeno O, Masschelein R, Groeseneken D. Exposure to ethylene glycol ethers and spermatogenic disorders in man: a case-control study. Br J Indust Med 1993 50:71-78[Medline]
  4. Browning RG, Curry SC. Clinical toxicology of ethylene glycol monoalkyl ethers. Hum Exp Toxicol 1994 13:325-335[Medline]
  5. Li LH, Wine RN, Chapin RE. 2-Methoxyacetic acid (MAA)-induced spermatocyte apoptosis in human and rat testes: an in vitro comparison. J Androl 1996 17:538-549[Abstract/Free Full Text]
  6. Chapin RE, Dutton SL, Ross MD, Sumrell BM, Lamb JCT. The effects of ethylene glycol monomethyl ether on testicular histology in F344 rats. J Androl 1984 5:369-380[Abstract/Free Full Text]
  7. Creasy DM, Foster PM. The morphological development of glycol ether-induced testicular atrophy in the rat. Exp Mol Pathol 1984 40:169-176[CrossRef][Medline]
  8. Creasy DM, Flynn JC, Gray TJ, Butler WH. A quantitative study of stage-specific spermatocyte damage following administration of ethylene glycol monomethyl ether in the rat. Exp Mol Pathol 1985 43:321-336[CrossRef][Medline]
  9. Bartlett JM, Kerr JB, Sharpe RM. The selective removal of pachytene spermatocytes using methoxy acetic acid as an approach to the study in vivo of paracrine interactions in the testis. J Androl 1988 9:31-40[Abstract/Free Full Text]
  10. Ku WW, Wine RN, Chae BY, Ghanayem BI, Chapin RE. Spermatocyte toxicity of 2-methoxyethanol (ME) in rats and guinea pigs: evidence for the induction of apoptosis. Toxicol Appl Pharmacol 1995 134:100-110[CrossRef][Medline]
  11. Clark AM, Maguire SM, Griswold MD. Accumulation of clusterin/sulfated glycoprotein-2 in degenerating pachytene spermatocytes of adult rats treated with methoxyacetic acid. Biol Reprod 1997 57:837-846[Abstract]
  12. Krishnamurthy H, Weinbauer GF, Aslam H, Yeung CH, Nieschlag E. Quantification of apoptotic testicular germ cells in normal and methoxyacetic acid-treated mice as determined by flow cytometry. J Androl 1998 19:710-717[Abstract/Free Full Text]
  13. Syed V, Hecht NB. Rat pachytene spermatocytes down-regulate a polo-like kinase and up-regulate a thiol-specific antioxidant protein, whereas Sertoli cells down-regulate a phosphodiesterase and up-regulate an oxidative stress protein after exposure to methoxyethanol and methoxyacetic acid. Endocrinology 1998 139:3503-3511[Abstract/Free Full Text]
  14. Wang W, Wine RN, Chapin RE. Rat testicular Src: normal distribution and involvement in ethylene glycol monomethyl ether-induced apoptosis. Toxicol Appl Pharmacol 2000 163:125-134[CrossRef][Medline]
  15. Boekelheide K, Fleming SL, Johnson KJ, Patel SR, Schoenfeld HA. Role of Sertoli cells in injury-associated testicular germ cell apoptosis. Proc Soc Exp Biol Med 2000 225:105-115[Abstract/Free Full Text]
  16. Bremner WJ, Millar MR, Sharpe RM, Saunders PT. Immunohistochemical localization of androgen receptors in the rat testis: evidence for stage-dependent expression and regulation by androgens. Endocrinology 1994 135:1227-1234[Abstract]
  17. Hikim AP, Wang C, Leung A, Swerdloff RS. Involvement of apoptosis in the induction of germ cell degeneration in adult rats after gonadotropin-releasing hormone antagonist treatment. Endocrinology 1995 136:2770-2775[Abstract]
  18. Henriksen K, Hakovirta H, Parvinen M. Testosterone inhibits and induces apoptosis in rat seminiferous tubules in a stage-specific manner: in situ quantification in squash preparations after administration of ethane dimethane sulfonate. Endocrinology 1995 136:3285-3291[Abstract]
  19. Woolveridge I, de Boer-Brouwer M, Taylor MF, Teerds KJ, Wu FC, Morris ID. Apoptosis in the rat spermatogenic epithelium following androgen withdrawal: changes in apoptosis-related genes. Biol Reprod 1999 60:461-470[Abstract/Free Full Text]
  20. Nandi S, Banerjee PP, Zirkin BR. Germ cell apoptosis in the testes of Sprague Dawley rats following testosterone withdrawal by ethane 1,2-dimethanesulfonate administration: relationship to Fas?. Biol Reprod 1999 61:70-75[Abstract/Free Full Text]
  21. Selva DM, Tirado OM, Toran N, Suarez-Quian CA, Reventos J, Munell F. Meiotic arrest and germ cell apoptosis in androgen-binding protein transgenic mice. Endocrinology 2000 141:1168-1177[Abstract/Free Full Text]
  22. Suarez-Quian CA, Martinez-Garcia F, Nistal M, Regadera J. Androgen receptor distribution in adult human testis. J Clin Endocrinol Metab 1999 84:350-358[Abstract/Free Full Text]
  23. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987 162:156-159[Medline]
  24. Hiroi H, Momoeda M, Inoue S, Tsuchiya F, Matsumi H, Tsutsumi O, Muramatsu M, Taketani Y. Stage-specific expression of estrogen receptor subtypes and estrogen responsive finger protein in preimplantational mouse embryos. Endocrinol Jpn 1999 46:153-158
  25. Suarez-Quian CA, Goldstein SR, Bonner RF. Laser capture microdissection: a new tool for the study of spermatogenesis. J Androl 2000 21:601-608[Medline]
  26. McGuinness MP, Linder CC, Morales CR, Heckert LL, Pikus J, Griswold MD. Relationship of a mouse Sertoli cell line (MSC-1) to normal Sertoli cells. Biol Reprod 1994 51:116-124[Abstract]
  27. Mather JP. Establishment and characterization of two distinct mouse testicular epithelial cell lines. Biol Reprod 1980 23:243-252[Abstract]
  28. Oke BO, Suarez-Quian CA. Localization of secretory, membrane-associated and cytoskeletal proteins in rat testis using an improved immunocytochemical protocol that employs polyester wax. Biol Reprod 1993 48:621-631[Abstract]
  29. Martinez ED, Danielsen M. Loss of androgen receptor transcriptional activity at the G(1)/S transition. J Biol Chem 2002 277:29719-29729[Abstract/Free Full Text]
  30. Zhang S, Danielsen M. Cotransfection assays and steroid receptor biology. Methods Mol Biol 2001 176:297-316[Medline]
  31. Vornberger W, Prins G, Musto NA, Suarez-Quian CA. Androgen receptor distribution in rat testis: new implications for androgen regulation of spermatogenesis. Endocrinology 1994 134:2307-2316[Abstract]
  32. Kerr JB, Millar M, Maddocks S, Sharpe RM. Stage-dependent changes in spermatogenesis and Sertoli cells in relation to the onset of spermatogenic failure following withdrawal of testosterone. Anat Rec 1993 235:547-559[CrossRef][Medline]
  33. Russell LD, Steinberger A. Sertoli cells in culture: views from the perspectives of an in vivoist and an in vitroist. Biol Reprod 1989 41:571-577[Abstract]
  34. Steinberger A, Klinefelter G. Sensitivity of Sertoli and Leydig cells to xenobiotics in in vitro models. Reprod Toxicol 1993 7:23-37
  35. Xu LL, Su YP, Labiche R, Segawa T, Shanmugam N, McLeod DG, Moul JW, Srivastava S. Quantitative expression profile of androgen-regulated genes in prostate cancer cells and identification of prostate-specific genes. Int J Cancer 2001 92:322-328[CrossRef][Medline]
  36. Munell F, Suarez-Quian CA, Selva DM, Tirado OM, Reventos J. Androgen-binding protein and reproduction: where do we stand?. J Androl 2002 23:598-609[Free Full Text]
  37. Fenstermacher DA, Joseph DR. Analysis of promoter and androgen regulatory sequences required for optimal transcription of the rat androgen-binding protein gene. J Androl 1998 19:81-91[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
M. G. Wade, A. Kawata, A. Williams, and C. Yauk
Methoxyacetic Acid-Induced Spermatocyte Death Is Associated with Histone Hyperacetylation in Rats
Biol Reprod, May 1, 2008; 78(5): 822 - 831.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. Domanskyi, F.-P. Zhang, M. Nurmio, J. J. Palvimo, J. Toppari, and O. A. Janne
Expression and localization of androgen receptor-interacting protein-4 in the testis
Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E513 - E522.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. V. Henley and K. S. Korach
Endocrine-Disrupting Chemicals Use Distinct Mechanisms of Action to Modulate Endocrine System Function
Endocrinology, June 1, 2006; 147(6): s25 - s32.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. M. Tabb and B. Blumberg
New Modes of Action for Endocrine-Disrupting Chemicals
Mol. Endocrinol., March 1, 2006; 20(3): 475 - 482.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
C. M. Hill, M. D. Anway, B. R. Zirkin, and T. R. Brown
Intratesticular Androgen Levels, Androgen Receptor Localization, and Androgen Receptor Expression in Adult Rat Sertoli Cells
Biol Reprod, October 1, 2004; 71(4): 1348 - 1358.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
O. M. Tirado, D. M. Selva, N. Toran, C. A. Suarez-Quian, M. Jansen, D. P. McDonnell, J. Reventos, and F. Munell
Increased Expression of Estrogen Receptor {beta} in Pachytene Spermatocytes After Short-Term Methoxyacetic Acid Administration
J Androl, January 1, 2004; 25(1): 84 - 94.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
68/4/1437    most recent
biolreprod.102.004937v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tirado, O. M.
Right arrow Articles by Suárez-Quian, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tirado, O. M.
Right arrow Articles by Suárez-Quian, C. A.
Agricola
Right arrow Articles by Tirado, O. M.
Right arrow