| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Testis |
a Unitat de Recerca Biomedica, Hospital Materno-Infantil Vall d'Hebron, Barcelona, Spain
b Department of Biochemistry & Molecular Biology
c Department of Cell Biology, Georgetown University Medical School, Washington, District of Columbia 20007
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
androgen receptor, apoptosis, spermatogenesis, testis, toxicology
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The testicular cells primarily afflicted following exposure to MAA appear to be primary spermatocytes [5–12]. As early as 12 h postexposure, for example, nearly 50% of primary spermatocytes undergo apoptosis in a stage-specific fashion. The dramatic and rapid effect of MAA on pachytene spermatocytes suggests that these cells are direct targets for MAA. This hypothesis is hard to test, however, because pachytene spermatocytes rely on Sertoli cells in vivo and cannot be cultured adequately in vitro to assess direct MAA effects.
Primary cultures of immature rat Sertoli cells also respond directly to treatment with MAA and generate novel Sertoli cell products [13]. Similarly, in seminiferous tubule culture models Src (protein encoded by the Rous Sarcoma virus gene) is elevated in the Sertoli cells after incubation with MAA [14]. These observations suggest that Sertoli cells in vivo also respond directly to MAA and, in turn, may be involved in the regulation of apoptosis of primary spermatocytes. In this scenario, recently reviewed by Boekelheide and colleagues [15], germ cell apoptosis is a direct response to toxicant insult on Sertoli cells and may entail regulation of both prosurvival and proapoptotic factors.
Altering androgen or androgen-binding protein (ABP) levels also induces apoptosis of spermatocytes. For instance, abolition of androgens by destroying Leydig cells with ethane dimethane sulfonate (EDS) results in a decrease in intratesticular androgen levels and a concomitant diminution in androgen receptor (AR) immunostaining [16] and is accompanied by significant germ cell apoptosis [17–20]. Altered expression of ABP in a mouse transgenic model is associated with significant apoptosis of pachytene spermatocytes [21]. In the present study, we investigated whether MAA alters AR and ABP expression levels in Sertoli cells. Our results show that ABP levels are changed in a Sertoli cell culture system and that aberrant expression occurs in a stage-specific fashion in Sertoli cells in vivo. Significant stage-specific disregulation of AR expression occurs in Sertoli cells in vivo. In a mouse Sertoli cell line, however, no MAA effect on AR protein or mRNA levels were detected.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Adult male rats were handled in accordance with protocols approved by the Georgetown University Animal Use and Care Committee and the Vall d'Hebron Hospital Animal Use and Care Committee. Twenty-three adult male Sprague-Dawley rats, weighing approximately 400 g, were maintained under standard conditions. The rats were treated with a single i.p. injection of MAA (650 mg/kg body weight; Sigma-Aldrich, Steinheim, Germany), buffered to pH 7.4 in 0.9% saline solution and were killed at 3 h (n = 5), 6 h (n = 5), 9 h (n = 5), 12 h (n = 5), and 24 h (n = 3) after toxicant administration. The dose used was based upon published studies [5–12]. Five rats were used as controls and were treated with saline solution. Animals were killed by CO2 asphyxiation. One testis from each animal was fixed in 4% paraformaldehyde for 24 h and subsequently embedded in paraffin. The other testis was minced, immediately frozen, and used for DNA and RNA extractions. Ten additional rats were used for laser capture microdissection (LCM) experiments (two controls and two killed at 3, 6, 9, and 12 h). Rats were killed as before, and testes were removed immediately and frozen in liquid nitrogen.
TUNEL
A TUNEL assay was performed as previously described [21]. Dewaxed and rehydrated sections were treated with 20 µg/ml proteinase K for 15 min and with 3% hydrogen peroxide for 5 min. After incubation with terminal deoxynucleotidyltransferase (TdT) buffer (25 nM Tris HCl, 200 mM cacodylate acid, and 200 mM KCl) for 15 min, sections were treated with 0.05 U/µl TdT (Roche Molecular Biochemicals, Mannheim, Germany) and 0.5 nM biotin-16-deoxy (d)-UTP (Roche Molecular Biochemicals) in TdT buffer at 37°C for 90 min and with 300 mM NaCl and 30 mM sodium citrate at room temperature for 15 min. After washing and incubating with 2% BSA, sections were exposed to avidin-biotin complex (ABC; Vector Laboratories, Burlingame, CA), diluted 1:25, at 37°C for 45 min, and the peroxidase reaction was visualized with diaminobenzidine and hydrogen peroxide.
Immunohistochemistry
Immunostaining of testicular sections for AR was performed as described previously [22]. Six-micrometer sections were cut, and AR was immunolocalized using a polyclonal antibody provided by Dr. Gail Prins (University of Illinois, Urbana, IL) and employing a biotin-streptavidin-immunoperoxidase method, including epitope retrieval. At the completion of the epitope retrieval, the sections were allowed to cool for approximately 20 min. Primary antibody was applied to the sections and allowed to incubate overnight at 4°C. The sections were then treated exactly as described in the instruction manual supplied with the manufacturer's immunostaining kit for aminoethyl carbazole as the chromogen (Zymed, South San Francisco, CA). The sections were counterstained for 30–60 sec with hematoxylin and coverslipped. As controls, additional sections were treated as follows: 1) primary antibody was omitted; 2) normal rabbit serum was used instead of primary antibody; 3) dilutions of primary antiserum were performed to quench positive staining as a function of specific antibody concentration; and 4) antibody was preadsorbed with specific immunopeptide and then used for immunostaining. The sections were photographed using a Zeiss Axiophot microscope fitted with a 63x objective, and images were recorded on Elite Chrome 100 ASA film (Kodak, Rochester, NY) set at 50 ASA. For publication, photographs were scanned at 300 dpi using a scanner (Hewlett Packard) and the final prints made using Adobe Photoshop imaging software (Adobe Systems, San Jose, CA) and an Epson 740 color printer (Epson).
Messenger RNA Isolation and Analysis of Its Expression by Reverse Transcription Polymerse Chain Reaction
RNA was obtained from total testis and from microdissected tubules by means of guanidium thiocyanate/phenol-chloroform extraction [23] and using a Micro RNA isolation kit (Stratagene, La Jolla, CA), respectively. One microgram of total RNA isolated from tissues was reverse transcribed using 200 U of Superscript II Rnase H-Reverse Transcriptase (Gibco BRL, Bethesda, MD) in a 20-µl reaction volume in the presence of 25 g/ml Oligo (dT), first strand buffer (50 mM Tris-HCl, 75 mM KCl, 3 mM MgCl2), 0.01 M dithiothreitol, and 10 mM of each dATP, dGTP, dCTP, and dTTP. The RNA and Oligo dT mix were heated at 70°C for 10 min and then cooled to 4°C, the other reagents were added, and the reverse transcription (RT) was performed at 42°C for 50 min. ABP polymerse chain reaction (PCR) primers were designed using Oligo 4.0 software (National Biosciences, Plymouth, MN) based on GenBank published sequences. For rat ABP, a 954-base pair (bp) product was amplified using an upper primer designed specifically against rat exon 1 (GAGAAGGGAGAGGTGGCCT) and a lower primer that specifically recognized exon 7 (GCTCAAGGCTACTTTGAATAC). In addition, a second primer set was used to perform the PCR for microdissected staged tubules, rendering a 246-bp product. This second primer set consisted of an upper primer (CAGCAAACCCTCTTCCTCC) from the 2–3 exon border and a lower primer (TTCCATCCACCCATAGCAGCAG) from exon 4. PCR primers for AR were designed using Primer Express version 1.0 software (Perkin-Elmer, Norwalk, CT); the upper primer (CTCCAGGATGCTCTACTTTGCA) hybridized to a sequence of exon 5, and the lower primer (ACACACTGGCTGTACATCCGAG) hybridized to a sequence of exon 6, rendering an 87-bp product. The primer set used to amplify L19 (a rat ribosomal protein) by PCR was AATCGCCAATGCCAACTCTCG for the upper primer and CCCTTCCTCTTCCCTATGCCC for the lower primer. L19 is frequently used as a standard control for competitive RT-PCR measurements [24]. Amplification was carried out in a 2400 thermocycler (Perkin-Elmer, Applied Biosystems, Foster City, CA) and consisted of 40 cycles of amplification, with denaturation at 94°C for 15 sec, annealing at 59°C for both AR and ABP, and extension at 72°C for 45 sec. PCR products were separated on a 2% agarose gel and quantified by the Molecular Analyst/Macintosh data analysis software using a Bio-Rad Image Analysis System (Bio-Rad Laboratories, Hercules, CA). The products of amplification were purified using the QIAquick PCR Purification Kit (Quiagen, Hilden, Germany) according to the supplier's instructions and were sequenced using an ABI Prism 310 genetic analyzer (Perkin-Elmer).
Laser Capture Microdissection
The strategy for targeting and harvesting stage-specific seminiferous tubules by LCM was published previously [25]. In the present study, either control testis or testes from MAA-treated rats were removed from the animals and placed in ice-cold 30% sucrose until they sunk to the bottom of a scintillation vial (approximately 4 h). Testes were then immersed in Tissue-Tek (Sakura Finetechnical Co., Torrance, CA) and frozen in liquid nitrogen. Six- to 7-µm sections were cut in a cryostat and attached to glass slides. Sections were fixed for 30 sec in 70% ethanol and then stained with hematoxylin and eosin by conventional means. LCM was performed using a PixCell II apparatus (Arcturus, Mountain View, CA), essentially as described in detail previously [25]. Fifty tubule cross sections at specific stages (III–IV, VII–VIII, or X–XIII) were pooled, and total RNA was extracted using a MicroRNA extraction kit (Stratagene, Cedar Creek, TX). From 50 tubule cross sections harvested by LCM, there was sufficient total RNA to perform five RT-PCRs for AR and ABP. The quality of the RNA prepared from the harvested tubules by LCM was confirmed by performing an isolated harvest of 50 tubules, preparing the sample as for the experimental tubules, running the sample on a 2% agarose gel, and staining the gel with ethidium bromide to visualize the 28S and 18S bands.
Sertoli Cell Lines
MSC-1 and TM4 mouse Sertoli cell lines were a gift from Dr. Leslie Heckert (University of Kansas, Lawrence, KS). MSC-1 cells were grown in Dulbecco modified Eagle medium (DMEM) containing 5% bovine calf serum at 37°C in a saturated atmosphere of 5% CO2 [26]. TM4 cells were grown in a 1:1 mixture of Ham F12 medium and DMEM with 1.2 g/L sodium bicarbonate and 15 mM Hepes (92.5%), horse serum (5%), and fetal calf serum (2.5%) [27].
Protein Extraction and Western Blot Analysis
Primary cultures of Sertoli cells TM4 or MSC-1 were lysed with radioimmunoprecipitation assay (RIPA) buffer containing protease inhibitors (1 mM PMSF, 10 mg/ml aprotinin, and 10 mg/ml leupeptin), and the lysates were centrifuged at 13 000 x g at 4°C for 30 min. The protein content of the supernatant was determined by the Bradford assay (Bio-Rad). Equal amounts of protein (30 µg) from either TM4 or MSC-1 cells were resolved by 10% SDS-PAGE and transferred to nitrocellulose membranes. After blocking, the membranes were incubated at 4°C overnight with 2 µg/ml of the PG21 rabbit polyclonal anti-mouse AR antibody (TM4) or with anti-ABP antiserum diluted approximately 1:400 (a gift from Dr. Neal Musto [28]). Next, the blots were incubated for 1 h at room temperature with horseradish peroxidase-conjugated secondary antibody (1:2000). Peroxidase activity was analyzed with the SuperSignal West Pico Chemiluminescent substrate kit (Pierce, Rockford, IL) according to the manufacturer's instructions. The AR and ABP content in TM4 and MSC-1 cells, respectively, was determined densitometrically.
Cell Culture
The L929 fibroblast cell line, originally derived from a mouse fibrosarcoma, was purchased from the American Type Culture Collection (Manassas, VA). L929 MMTV-CAT cells containing integrated copies of the androgen-inducible construct MMTV-CAT and L929 probasin-luciferase cells containing integrated copies of the androgen-inducible construct probasin-luciferase have been described previously [29]. Cells were cultured in DMEM supplemented with 3% calf serum, 100 IU/ml penicillin, and 100 µg/ml streptomycin. For the development of the L929 MMTV-CAT stable cell line, L929 cells were transfected using Dosper liposomal reagent (Boehringer Mannheim, Mannheim, Germany) with pMMTV-CAT and pSV2neo (20:1) according to the manufacturer's protocol. To obtain the L929-ProbasinLuc cell line, L929 cells were transfected using Lipfectamine 2000 reagent (Life Technologies, Rockville, MD) with p-286/+28PB-luciferase [30] and pSV2neo (20:1 ratio), according to the manufacturer's protocol. In both cases, the cells were split 48 h after transfection and selected in growth medium supplemented with 400 mg/L G418 sulfate (Cellgro, Herndon, VA). Single clones were picked with sterile pipette tips and expanded. Clones were screened for chloramphenicol acetyl transferase (CAT) or luciferase activity after 24 h of hormone induction. Single clones showing low basal reporter activity and at least a 5-fold activation with dihydrotestosterone (DHT) were used for further studies (clones L929-MMTV-CAT 31 and L929-ProbasinLuc 2.9 were used in this study).
CAT and Luciferase Assays
Stably transfected L929 cell cultures were treated with hormone and/or MAA for 24 h and harvested in 0.25 M Tris-HCl, pH 7.8. For CAT assays, equal amounts of protein from each cell extract were combined with radiolabeled acetyl coenzyme A and chloramphenicol in Tris buffer, and the reaction mixture was overlaid with organic scintillation fluid, as previously described [30]. The acetylated product becomes incorporated into the organic phase and is counted in a scintillation counter. For luciferase assays, cell extracts were combined with Luciferase Assay Substrate (Promega, Madison, WI) in glass tubes and immediately counted in a luminometer to detect production of luminescence. A Student t-test of variance using Microsoft Excel 2000 software (Microsoft, Redmond, WA) was performed to determine differences in the ability of DHT alone and DHT plus MAA to promote AR transcriptional activity. Differences between group means were considered significant at P 
0.05.
Statistical Analysis
Experiments shown in Figures 3, 5, 6, and 7 were repeated at least three times with exceptions as noted. Replicates (three or four) were used for each group within an experiment. An ANOVA was used to assess the significance of differences between group means, and groups were considered significantly different at P 0.05.
|
|
|
|
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Rats were treated with a single i.p. injection of MAA, and testes were harvested 9 h later and processed for TUNEL to determine the degree of apoptosis (Fig. 1). In random sections examined at low magnification, TUNEL was easily detected in some tubules and appeared to be present in all pachytene spermatocytes of the seminiferous epithelium of TUNEL-positive tubules. In contrast, other tubule profiles appeared completely devoid of any TUNEL. Inspection of tubule stages after a short-term exposure of MAA (6–9 h) from an i.p. injection revealed that all pachytene spermatocytes at stages II–IV and stages XII–IV became TUNEL positive (Fig. 1C). However, at no times did large numbers of pachytene spermatocytes residing at stages V–IX exhibit robust TUNEL. Thus, a distinct marker of toxicity from short-term exposure to MAA is the specific TUNEL characteristics of the pachytene spermatocytes as a function of the cycle of the seminiferous epithelium.
|
Testicular AR Immunohistochemistry in Testis
Specific AR immunostaining in adult rat seminiferous tubules is found within the nuclei of Sertoli and peritubular myoid cells, the latter forming the walls of the tubules [31]. Although the intensity of the staining in the myoid cell nuclei is constant, in the Sertoli cell nuclei it varies as a function of the cycle of the seminiferous epithelium (Fig. 2, control). At earlier stages I–IV (Fig. 2, A and B) the staining is weak and often difficult to discern. However, as spermiation approaches at stages VII–VIII (Fig. 2C), staining intensity becomes more robust and reaches its maximum level coincident with those tubules in which sperm release occurs. In these later stages the first signs of germ cell loss are detected because of androgen deprivation following experimental insult [32]. In subsequent stages IX–XIV (Fig. 2D), AR staining in Sertoli cell nuclei cannot be detected [16, 31].
|
MAA treatment led to a dramatic alteration in the expression of the AR in Sertoli cells (Fig. 2). This effect was clearly seen after only 6 h of treatment (the earliest time point examined), where there was an increased expression of AR in stage IV cells when compared with controls (Fig. 2, compare B with B'). Concomitant with the increased expression in stage IV cells there was a decreased expression of AR in stage VIII Sertoli cells (Fig. 2, compare C with C'). By 12 h of MAA treatment, expression of AR in stage VIII Sertoli cells remained low and there was an increase in expression in both early (stage I–II) and late (stage XII) cells. The AR staining in stage XII and later Sertoli cell nuclei (Fig. 2D''') was particularly interesting because AR expression in these cells has not been reported previously in rodents under any experimental conditions.
AR and ABP mRNA Expression in MAA-Treated Rats
In the experiments described above, the cyclic expression of AR protein in vivo was altered by MAA treatment. To determine whether this alteration in AR immunostaining intensity as a function of the cycle of the seminiferous epithelium reflected an overall change in AR expression in the whole testis, AR mRNA levels were quantified in the testes of rats treated with MAA for 3–24 h. Overall AR mRNA levels did not change during this time course (Fig. 3). In contrast, ABP levels were significantly higher in testicular extracts of rats 6 h posttreatment (when compared with control levels) and remained elevated for the duration of the experiment (Fig. 3).
AR and ABP mRNA Levels in Stage-Specific Tubules Harvested by LCM
The lack of overall changes in AR levels as seen in total testicular extracts probably reflects the developmental changes in AR expression, i.e., some cells in the testis produce more AR in response to MAA whereas others produce less. For that reason, we examined AR mRNA expression in isolated staged tubules using LCM (Fig. 4). Tubule cross sections were examined first at high magnification (Fig. 4B). Stages were determined, and then all the cells found within the specific cross section were collected by LCM. The remaining void in the tissue section indicated the degree to which a particular tubule section was successfully harvested by LCM (Fig. 4C). No attempt was made to capture seminiferous tubules free of the peritubular myoid cells. Approximately 10–15 tubule cross sections, all at the identical stage of the cycle of the seminiferous epithelium, were collected onto one cap (Fig. 4D) and then up to 50 captured tubules were pooled for RNA isolation. The quality of the RNA extracted from 50 tubule cross sections was evaluated using agarose gel electrophoresis and ethidium bromide staining of the 28S and 18S bands (Fig. 4E).
|
Relative AR and ABP mRNA levels were determined in the stage-specific tubules harvested by LCM from either control or MAA-treated rats at times indicated in Figure 5. In control tubules, the pattern of AR mRNA expression levels as a function of the cycle of the seminiferous epithelium were similar to the protein level expression pattern revealed by immunohistochemistry. Moderate levels were present in stages III–IV, maximum levels were present at stages VII–VIII, and minimal levels were detected in late stages (X–XIII). Presumably, the low level of AR mRNA detected in the later stages was due to the contribution of peritubular myoid cells that were collected by LCM along with the seminiferous epithelium. The pattern of ABP mRNA levels in control tubules as a function of the cycle differed significantly from that observed for AR mRNA. In early (III–IV) and late (X–XIII) stages, ABP mRNA levels were relatively high, whereas no ABP mRNA was detected in stages VII–VIII.
MAA treatment had a very rapid effect on AR mRNA levels in all stages of the seminiferous tubule (Fig. 5). By 3 h, AR mRNA levels had decreased in stages VII–VIII but had significantly increased in the other two groups of stages III–IV and X–XIII. At later times after MAA treatment, AR mRNA levels remained high in both early (III–IV) and late (X–XII) stages but remained low during the middle stages (VII–VIII). The changes in mRNA levels after MAA treatment indicate that at least part of the effect of MAA is due to an alteration in the rate of AR transcription and/or mRNA stability. There was perfect correlation of changes in AR mRNA levels with changes in protein levels seen previously, although there was a 3-h lag phase in protein level alteration relative to the mRNA increase.
Expression levels of ABP mRNA were also affected by MAA administration to rats (Fig. 5). As early as 6 h posttreatment, ABP mRNA levels at stages III–IV had decreased, but they returned to normal levels by 12 h. In contrast, at stages VII–VIII, ABP mRNA increased 3 h posttreatment, and levels failed to return to normal by 12 h. In the later stages (X–XIII), ABP mRNA levels decreased gradually at 3 and 6 h and then underwent a significant decrease at 12 h relative to control levels.
AR and ABP mRNA and Protein Levels in Cell Lines
The previous experiments showed that MAA has rapid and dramatic effects on Sertoli cell gene expression in vivo. However, in such a system it is hard to determine which effects are due to direct effects on Sertoli cells and which are mediated through other cell types. Thus, we examined the direct effects of MAA on the expression of AR and ABP in Sertoli cell lines.
ABP mRNA and protein expression were examined in the MSC-1 cell line. Increases in both ABP mRNA and ABP protein levels were clearly seen by 12 h and remained elevated at 24 h (Figs. 6 and 7). Thus, Sertoli cells in culture can respond to MAA, indicating that in vivo at least some of the effects of MAA are due to a direct interaction with Sertoli cells. Because MSC-1 cells do not produce AR, we used the TM4 cell line to examine effects of MAA on AR protein and mRNA levels. Treatment of cells with MAA had no effect on AR protein or mRNA levels even after 24 h of treatment (Figs. 6 and 7). This result is perhaps not surprising because even in vivo only some cells at specific stages of the cycle show altered AR expression levels.
Potentiation of DHT Activation of AR by MAA
Because no effect on AR expression levels was detected in TM4 cells treated with MAA, we evaluated whether MAA could affect the activity of the AR. L929 cells expressing endogenous AR and stably transfected with a MMTV promoter-CAT reporter system were exposed to MAA in the presence or absence of androgens. AR transcriptional activity was measured in CAT assays. At 5 mM, MAA potentiated androgen induction of AR activity 3- to 4-fold (Fig. 8). This effect was fully blocked by the antiandrogen cyproterone acetate, indicating that the MAA effect is mediated by the AR. To determine whether MAA could potentiate androgen action at androgen concentrations that elicit a suboptimal transcriptional response, cells were treated simultaneously with MAA and with increasing concentrations of androgen. MAA was able to potentiate DHT at all concentrations tested, suggesting that this effect does not require the presence of high amounts of androgens (Fig. 8). Although a potent enhancer of DHT, MAA showed no androgenic activity of its own.
|
To determine whether MAA potentiation of androgens could occur with a natural androgen-responsive gene, we used MAA in the presence or absence of androgens to treat mouse fibroblast L929 cells stably transfected with a probasin promoter-luciferase reporter construct. Again, MAA potentiated the effects of DHT 2- to 4-fold, and this enhanced activity was fully inhibited by cyproterone acetate (Fig. 9). On the probasin promoter, MAA also lacked the ability to elicit a transcriptional response in the absence of androgens. These data demonstrate that MAA increases the transcriptional activity of the AR, suggesting that alteration of the AR function by MAA can contribute to its deleterious effects on spermatocytes.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Apoptosis in Pachytene Spermatocytes
The transient toxicity of MAA is specific for pachytene spermatocytes and induces their death by apoptosis [5, 11], but neither the molecular mechanism nor the apoptotic trigger in these cells is known. MAA may modulate AR action in Sertoli cells, leading to the apoptosis. This hypothesis is at least partly supported by the apoptotic cell death of spermatocytes seen in animals with reduced AR function. This induction of cell death is seen with both chemical destruction of Leydig cells [17–20] and with altered expression of ABP [21]. This hypothesis is also supported by the alteration in AR levels in MAA-treated animals occurring at early and late stages (Figs. 1, 2, and 5), the very stages that show the greatest amount of apoptosis. The mechanism of MAA-induced apoptosis is likely to be different than that for EDS-induced apoptosis, however, because EDS-induced apoptosis requires almost 3 days to take effect and preferentially occurs at stages VII–VIII [18], the stages not affected by MAA. Further, EDS treatment diminishes all AR immunostaining [16], whereas MAA effects occurred in a stage-specific manner.
Changes in AR and ABP Levels In Vivo and In Vitro
In vivo, altered levels of Sertoli cell AR mRNA and protein were seen at the earliest time points examined (3 and 6 h, respectively) and were detected 3–6 h prior to observing TUNEL in pachytene spermatocytes (Fig. 1), a timing interval consistent with a contribution of AR changes in Sertoli cells to spermatocyte cell death. In many tissues, fluctuating serum androgen levels control the activity of the AR. This is not the case in the testis; the seminiferous tubules are bathed in a very high concentration of testosterone, which is thought to saturate the receptor. Therefore, the most efficient way to control AR activity in the testis may be to control the level of the protein. The rapid changes in AR levels seen in MAA-treated animals should give rise to a rapid change in AR activity. The mRNA and protein data indicate that MAA alters the rate or stability (or possibly both attributes) of the AR and the level of mRNA, although one aspect of AR action that is not completely understood is the control of AR protein and mRNA levels by androgen itself.
MAA did not alter AR mRNA or AR protein in the TM4 cells but significantly changed ABP mRNA and protein in MSC-1 cells. One possible explanation of these results is that the regulation of AR expression in Sertoli cells requires the presence of germ cells, whereas ABP expression is germ cell independent. Alternatively, MAA may exhibit an effect on AR expression in Sertoli cells only within the context of the cycle of the seminiferous epithelium. Although the use of cell lines is not fully adequate [33, 34], these cell lines in particular were used because MSC-1 did not express AR, whereas TM4 did not express ABP. Thus, both cell lines were employed to examine the effect of MAA on AR and ABP. Given these limitations, additional work is needed to further elucidate the mechanism by which MAA directly influences Sertoli cells in vivo.
MAA Potentiates AR Transcriptional Activity
MAA potentiated the effects of DHT in the present experiment model but had no effect on the AR in the absence of hormone. Therefore, the increased transcriptional activity of the AR probably is not due to interaction of MAA with the AR itself but to some other event such as altered coactivator expression or modification of chromatin.
Germ Cell Apoptosis in Response to Toxicants
Boekelheide et al. [15] recently speculated that testicular toxicants might exert a deleterious effect on spermatogenesis by modulating one of three possible Sertoli cell activities, i.e., toxicants could depress prosurvival factors, increase proapoptotic factors, or both depress prosurvival and increase proapoptotic factors. We could not determine which mechanism is associated with MAA, although our results clearly demonstrate that MAA exerts an effect on Sertoli cell activity. Further, our present observations are similar to the previously reported increased clusterin [11] and Src immunostaining in Sertoli and dying pachytene spermatocytes after treatment with MAA [14]. Given that clusterin is implicated in apoptotic cell death [11] and that its expression appears to be androgen regulated [35], it should be interesting to examine whether MAA causes a stage-specific increase of clusterin mRNA. The more specific role of ABP in the apoptotic process is also not clear. In the ABP transgenic mouse, excess ABP was associated with increased pachytene spermatocyte apoptosis [21], but in the present experiment a similar correlation was not detected. Nevertheless, ABP is a Sertoli cell product that may serve to maintain intratubular androgen homeostasis [36], and its mRNA levels were significantly altered in a stage-specific fashion. These findings suggest that ABP also participates in the indirect apoptotic signaling of pachytene spermatocytes by a modification of the intratubular steroid levels. However, AR is unlikely to be directly implicated, because there is no evidence to suggest that ABP mRNA expression is under androgen regulation [37]. Thus, our results do not exclude the possibility that inappropriate alteration of both AR and ABP levels independently is associated with pachytene spermatocyte apoptosis.
Regardless of its demonstrated effects on Sertoli cells, MAA may also directly regulate germ cell activity. Recently, we examined the expression of estrogen receptor ß (ERß) in MAA-treated rat testis and found that short-term MAA exposure leads to enhanced expression of ERß protein and mRNA in pachytene spermatocytes destined to die by apoptosis (unpublished results). Whether this enhanced ERß expression is due to a direct MAA effect on the spermatocytes or whether the expression is mediated by another cell type such as Sertoli cells is not known. Therefore, it is important not to assume that any given testicular toxicant will produce a single action or will affect only one testicular cell type.
|
FOOTNOTES |
|---|
2 Correspondence: Carlos A. Suárez-Quian, Department of Cell Biology, Georgetown University Medical School, 3900 Reservoir Rd., N.W., Washington, DC 20007. FAX: 202 687 1823; suarezc{at}georgetown.edu
Received: 25 February 2002.
First decision: 19 March 2002.
Accepted: 31 October 2002.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  M. G. Wade, A. Kawata, A. Williams, and C. Yauk Methoxyacetic Acid-Induced Spermatocyte Death Is Associated with Histone Hyperacetylation in Rats Biol Reprod, May 1, 2008; 78(5): 822 - 831. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Domanskyi, F.-P. Zhang, M. Nurmio, J. J. Palvimo, J. Toppari, and O. A. Janne Expression and localization of androgen receptor-interacting protein-4 in the testis Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E513 - E522. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. V. Henley and K. S. Korach Endocrine-Disrupting Chemicals Use Distinct Mechanisms of Action to Modulate Endocrine System Function Endocrinology, June 1, 2006; 147(6): s25 - s32. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. M. Tabb and B. Blumberg New Modes of Action for Endocrine-Disrupting Chemicals Mol. Endocrinol., March 1, 2006; 20(3): 475 - 482. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Hill, M. D. Anway, B. R. Zirkin, and T. R. Brown Intratesticular Androgen Levels, Androgen Receptor Localization, and Androgen Receptor Expression in Adult Rat Sertoli Cells Biol Reprod, October 1, 2004; 71(4): 1348 - 1358. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. M. Tirado, D. M. Selva, N. Toran, C. A. Suarez-Quian, M. Jansen, D. P. McDonnell, J. Reventos, and F. Munell Increased Expression of Estrogen Receptor {beta} in Pachytene Spermatocytes After Short-Term Methoxyacetic Acid Administration J Androl, January 1, 2004; 25(1): 84 - 94. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
