Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print November 27, 2002.
Biol Reprod 2002, 10.1095/biolreprod.102.010843
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
68/5/1545    most recent
biolreprod.102.010843v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yoshiura, Y.
Right arrow Articles by Nagahama, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshiura, Y.
Right arrow Articles by Nagahama, Y.
Agricola
Right arrow Articles by Yoshiura, Y.
Right arrow Articles by Nagahama, Y.
BIOLOGY OF REPRODUCTION 68, 1545–1553 (2003)
DOI: 10.1095/biolreprod.102.010843
© 2003 by the Society for the Study of Reproduction, Inc.

Ovary

Synergistic Expression of Ad4BP/SF-1 and Cytochrome P-450 Aromatase (Ovarian Type) in the Ovary of Nile Tilapia, Oreochromis niloticus, During Vitellogenesis Suggests Transcriptional Interaction1

Yasutoshi Yoshiura3,4, Balasubramanian Senthilkumaran3,7, Masatada Watanabe3,5, Yuichi Oba3,6, Tohru Kobayashi3,7, and Yoshitaka Nagahama2,3,7

Laboratory of Reproductive Biology,3 National Institute for Basic Biology, Okazaki 444-8585, Japan Immunology Section,4 Inland Station, National Research Institute of Aquaculture, Tamaki, Mie 519-0423, Japan Department of Biochemistry,5 Faculty of Pharmaceutical Sciences, Hoshi University, Shinagawa-Ku, Tokyo 142-0063, Japan Graduate School of Bioagricultural Sciences,6 Nagoya University, Nagoya 464-8601, Japan CREST,7 Japan Science and Technology Corporation, Kawaguchi, Saitama 332-0012, Japan


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Involvement of Ad4BP/SF-1 in the ovarian cytochrome P-450 aromatase (oP450arom) gene expression was investigated using ovarian follicles of the Nile tilapia, possessing an average 14-day spawning cycle. The promoter region (5' flanking region) of oP450arom gene cloned from tilapia contains two Ad4 binding sites. Subsequently, a cDNA encoding Ad4BP/SF-1 was cloned from the ovarian follicles. It is expressed in gonadal tissues, brain, and kidney. Oligonucleotide probes containing putative orphan nuclear receptor binding motifs (derived from promoter region of the aromatase gene) formed complexes with in vitro-translated Ad4BP/SF-1 and nuclear extracts of tilapia ovarian (midvitellogenic) follicles, indicating that Ad4BP/SF-1 is one of the transcriptional regulators for aromatase gene expression. Northern blot analysis revealed that the expression of both oP450arom and Ad4BP/SF-1 increased in parallel with ovarian growth from Day 0 to Day 5 after spawning and declined sharply from Day 8 to Day 11. On the day of spawning (Day 14), the expression of both correlates became undetectable. In vitro incubation of post vitellogenic full-grown immature follicles (corresponding to Day 11 after spawning) with hCG purged both oP450arom and Ad4BP/SF-1 messenger RNA transcripts at 18 h. Conversely, in vitro incubation of late vitellogenic follicles (corresponding to Day 8 after spawning) with hCG retained Ad4BP/SF-1 messenger RNA transcripts more or less steadily and up-regulated oP450arom. Ad4BP/SF-1 probably acts as a transcriptional modulator to implement the paradoxical actions of gonadotropins on oP450arom gene.

follicular development, granulosa cells, luteinizing hormone, ovulation, steroid hormones


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In oviparous vertebrates, the ovarian form of cytochrome P-450 aromatase (oP450arom) plays a crucial role in vitellogenesis [1–3]. In fish, like in mammals, testosterone produced by thecal cells under the stimulation of gonadotropin-II (also known as luteinizing hormone, LH) serves as an essential substrate for oP450arom-catalyzed estradiol-17ß synthesis in granulosa cells induced by gonadotropins [2, 4–6]. In teleosts, oP450arom were cloned from several species [5–11] and also promoter characteristics were described in some species [11–13]. However, schematic analysis of transcriptional regulation/promoter activity of oP450arom is limited [14]. The Nile tilapia, Oreochromis niloticus, is a gonochoristic teleost fish with an average 14-day spawning cycle. It is an excellent animal model to study reproduction in teleosts because the events such as vitellogenesis, oocyte maturation, and ovulation can be timed accurately. In Nile tilapia, a steady increase in oP450arom activity and gene expression occurs during vitellogenesis [7]. Reports from our laboratory confirmed that the enhancement of oP450arom activity and gene expression in the ovarian follicles could be inhibited completely by actinomycin D [2]. These findings warrant that oP450arom activity is regulated at the transcriptional level. More recently, studies on medaka demonstrated that an orphan nuclear receptor protein, fushi tarazu-factor I (FTZ-F1), is a transcriptional regulator for oP450arom expression and activity [14].

Steroid receptors are members of the orphan nuclear receptor family, and they act as transcription factors for genes regulated by steroid and thyroid hormones [15–19]. In mammals, Ad4 binding protein Ad4BP/SF-1, a member of the orphan nuclear receptor protein, was identified as a specific transcription factor for steroidogenic tissues [15–18]. This protein also has high homology to Drosophila FTZ-F1; hence, in some of the species, it was also named as FTZ-F1 [14, 16, 20–23]. Because most of the earlier [15, 17] and more recent studies (see review [24]) describe FTZ-F1 as Ad4BP or SF-1, we decided to refer to it as Ad4BP/SF-1. The primary structure of Ad4BP/SF-1 cDNA or gene has been characterized in many species, including teleosts [14–17, 20–23]. In mammals, Ad4BP/SF-1 gene knock out resulted in a lack of reproductive organs, suggesting that Ad4BP/SF-1 functions as a transcription factor involved in the regulation of steroidogenic enzymes as well as in differentiation of steroidogenic tissues by regulating the Dax-1 gene [25–27]. Studies explaining the interrelationship of oP450arom and Ad4BP/SF-1 expression in response to the stimulation of gonadotropins on ovarian growth are scarce. In teleosts, a dramatic shift in steroidogenesis from estradiol-17ß to 17{alpha}, 20ß-dihydroxy-4-pregnen-3-one (17{alpha}, 20ß-DP, maturation-inducing hormone [MIH] of several teleosts, including Nile tilapia) occurs in the ovarian follicle layer immediately prior to final oocyte maturation (FOM), probably under the influence of gonadotropins [28]. As described above, gonadotropins, both LH and gonadotropin-I or follicle-stimulating hormone (FSH), are required for oP450arom expression during vitellogenesis, and later, LH subdues oP450arom and enhances 20ß-hydroxysteroid dehydrogenase (20ß-HSD) expression when the ovarian follicles enter into FOM [1, 28]. However, in red seabream, LH alone plays the role of inducing and subduing oP450arom expression during sexual maturation [10]. This dual action of gonadotropin(s) on oP450arom is fairly interesting and is a unique phenomenon to probe whether the shift in steroidogenesis and oP450arom regulation is signaled initially via Ad4BP/SF-1. In the present investigation, we isolated and characterized the promoter region of the oP450arom gene and Ad4BP/SF-1 cDNA from tilapia ovary. The presence of Ad4 motifs in the promoter regions of oP450arom gene was confirmed by gel-shift assays. Subsequently, changes in oP450arom and Ad4BP/SF-1 expressions were examined during the natural ovarian cycle using Northern blot analysis. Additionally, the follicles were treated with human chorionic gonadotropin (hCG) at two different ovarian stages to understand the paradoxical actions of gonadotropin on oP450arom gene through Ad4BP/SF-1.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Animals

Nile tilapia (O. niloticus) were reared under constant conditions of fresh water (26 ± 1°C) and photoperiod (14L:10D) in indoor tanks (500–1000 L) for more than 1 yr until matured. The fish were fed commercial trout pellets ad libitum. Each matured female was transferred to a glass aquarium (50 L) and reared separately under the same conditions. Under these conditions, females spawn repeatedly and show a spawning cycle of 14–18 days, and the samples for the present study were obtained only from 14-day spawning-cycle females after careful observation for three consecutive spawnings/ovulations. In the ovary of Nile tilapia, two classes of oocytes can be distinguished at all times—those that have begun midvitellogenesis and will be spawned at the end of that spawning cycle and those composed of earlier stage oocytes (previtellogenic and early vitellogenic stages).

Ovarian Follicle Collection and Incubation Procedure

Ovarian follicles at different stages of follicular growth (from the early vitellogenic stage to final maturation; samples from one fish per Northern blot analysis, n = 2 per stage) were collected from the ovaries of females prepared according to the time course after ovulation (Table 1). Their follicles were isolated from their ovaries by fine forceps in Ringer solution. To perform in vitro experiments, 50 oocytes obtained from 50 follicles (n = 2 per stage, 8 days after ovulation) at the late vitellogenic stage were incubated in 3 ml of Ringer solution with or without hCG (100 U/ml) at 24°C for 2, 6, 12, and 18 h. To induce FOM in vitro, ovarian follicles (n = 2 per stage, 11 days after ovulation) at the full-grown immature stage (post vitellogenic) were incubated with hCG (100 U/ml) for 18 h. The status of FOM was confirmed by the disappearance of germinal vesicle (GV) or GV break down (GVBD). GV migration or GVBD was morphologically examined by fixing the oocyte in 20% trichloroacetic acid and later by brief dehydration and clearing.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Summary of development of ovarian follicles during oogenesis

Nucleic Acid Extraction

Genomic DNA was extracted from liver by a protease K-SDS method. Total RNA from different tissues and ovarian follicles was isolated using Isogen solution (Nippon Gene, Toyohama, Japan) by following the supplier's protocol. Ovarian follicles from ovary were prepared by the method described below. First, the oocytes with surrounding follicular layers were punctured using a micropestle in PBS, and later the yolk and cytoplasm were expelled from the oocytes by changing the PBS buffer repeatedly. The follicle layers were used for the preparation of total RNA after washing them repeatedly in PBS.

Isolation of the Promoter Region of the oP450arom Gene

The tilapia oP450arom promoter region was isolated by an improved polymerase chain reaction (PCR) method for walking in uncloned genomic DNA [29]. In brief, first, a special adaptor was ligated to the ends of DNA fragments generated by the digestion of tilapia genomic DNA with DraI, PvuII, ScaI, and SspI separately. Then adaptor-ligated DNA fragments were used as a template for PCR using adaptor (AP) and tilapia oP450arom gene-specific primers. Primary PCR reactions were conducted in 25-µl volumes containing the diluted ligated DNA (5 ng), 2.5 µl of 10x Long and Accurate (LA) PCR buffer II (Mg2+free; TaKaRa, Otsu, Shiga, Japan), 2.5 mM MgCl2, 200 µM each of dNTP, 0.2 µM AP1, 0.2 µM tilapia oP450arom gene-specific primer (GSP1; Fig. 1), and 1.25 U Long and Accurate (LA) Taq (TaKaRa). For this PCR amplification, a touch-down program was used (7 cycles: 94°C for 25 sec and 72°C for 4 min; 32 cycles: 94°C for 25 sec and 67°C for 4 min). A second PCR reaction was conducted with 1 µl of a 500-fold dilution of the primary PCR using AP2 and the nested gene-specific primer (GSP2; Fig. 1). The same reaction was used, and the PCR program was changed slightly (5 cycles: 94°C for 25 sec and 72°C for 4 min; 20 cycles: 94°C for 25 sec and 67°C for 4 min). The PCR products were examined on 1% agarose/ethidium bromide (EtBr) gels. In a serial PCR experiment, a single major PCR product (about 2.5 kb) was obtained from PvuII adaptor-ligated DNA and was subcloned into pBluescript II SK (Stratagene, La Jolla, CA) and sequenced.



View larger version (77K):
[in this window]
[in a new window]
  		FIG. 1. Nucleotide sequences of the promoter region of the tilapia oP450arom gene. The arrow denotes the transcription initiation site (+1) determined by 5' RACE. The exon 1 sequence is indicated in capital letters. A putative initiation codon (ATG) is doubly underlined. Potential cis elements are underlined once. ERE half, a half site of the estrogen-responsive element; CRE, cAMP-responsive element; Ad4, Ad4-binding motif; TATA, box. The position of the gene-specific primers are denoted as horizontal arrows and restriction site PvuII is boxed

5' Rapid Amplification cDNA Ends

Total RNA isolated from the ovarian follicle (midvitellogenic stage) and two gene-specific primers (GSP1 and GSP2; Fig. 1) were used for 5' RACE (rapid amplification cDNA ends) of tilapia oP450arom. The 5' RACE was performed using a GIBCO-BRL kit (5'RACE, Ver 2.0; Gaithersburg, MD) according to the manufacturer's protocol. The resulting 5' RACE product was subcloned into pBluescript II SK (Stratagene) and sequenced.

Isolation of Ad4BP/SF-1 cDNA and RT-PCR

Total RNA was extracted from different tissues (ovary at late vitellogenic stage, mature testes, brain, liver, and kidney) of adult Nile tilapia. Separation of mRNA from total RNA was performed by oligotex-dT30<super> (TaKaRa) according to the manufacturer's protocol with slight modification. The mRNA was obtained as poly(A)+ RNA-oligotex-dT30 complex without elution from latex beads. First-strand cDNA was synthesized from this complex, which was then reverse transcribed using oligo-dT30 sequence on the beads without addition of primers for the reverse transcription (RT) reaction. First-strand reaction included 20 µl of RT buffer (10 mM Tris-HCl, 5 mM MgCl2, 50 mM KCl, pH 8.3), 1 mM dNTPs, 20 U RNase inhibitor, 5 U AMV reverse transcriptase (Life Sciences Inc., St. Petersburg, FL). The RT reaction was carried out at 42°C for 60 min. PCR reaction was carried out using a standard protocol [30] with different set of primers based on the requirements. For amplification of the probe used for library screening of Ad4BP/SF-1, we designed one set of primers (sense: 5'TGTCC(A/G)GTGTGCGG(A/T)GACAA-3'; antisense: 5'GCCC(T/G)GTCTC(T/G)GTCTC(T/G)CTTGTACAT-3') based on nucleotide sequences of highly conserved regions (DNA-binding domain and Ad4BP/SF-1 box) between medaka [14] and zebrafish [21] FTZ-F1 homologs. The Ad4BP/SF-1 cDNA fragment (275 base pair [bp]) obtained from Ad4BP/SF-1 degenerate primer PCR had high homology with other Ad4BP/SF-1 or FTZ-F1 cDNAs, including medaka, and was used for the screening of the tilapia ovary cDNA library. From 4 x 105 recombinant phage plaques, four Ad4BP/SF-1 cDNA clones were identified, plaque purified, and subcloned into pBluescript II SK (Stratagene). The size of the cDNA insert of these clones was checked by PCR with T3 and T7 primers before sequencing. For amplification of the tilapia Ad4BP/SF-1 transcript to analyze tissue distribution patterns, specific primers were designed (sense: 5'-GCTGTCTCATAACTGCTGGTC-3'; antisense: 5'-TCTCGATCAGCAGGTTGTTG-3'). These primers correspond to nucleotide positions 1169–1189 and 1625–1644 of tilapia Ad4BP/SF-1 cDNA. The PCR amplification of tilapia ß-actin was performed to check the cDNA used in PCR reactions. The specific primer set for tilapia ß-actin was designed (sense: 5'-GGCATCACACCTTCTACAACGA-3'; antisense: 5'-ACGCTCTGTCAGGATCTTCA-3'). The tilapia ß-actin cDNA was isolated from a tilapia ovarian cDNA library constructed earlier in our laboratory [7] using a cDNA probe encoding ß-actin of goldfish [31].

DNA Sequencing Analysis

Double-stranded plasmid DNA was purified by the alkaline lysis method [30]. Sequencing was performed for both strands with an Applied Biosystems model 377 sequencer (Foster City, CA) after labeling with a dye terminator cycle sequencing kit using T3 and T7 primers. Sequence analysis was performed using the Gene Works 2.5 software (Intelligenetics, Mountain View, CA). Amino acid sequence alignment was performed using the clustal W (1.7) multiple sequence alignment program, and homology value (percent of amino acid sequence identity) was calculated by the pairwise alignment. The phylogenetic tree was constructed by the neighbor-joining method [32] using PHYLIP (Phylogeny Inference Package) version 3.57c. Distance matrices were calculated using the Dayhoff model of the PROTDIST program in the PHYLIP. The robustness of the tree was analyzed by the bootstrap method with 100 pseudoreplications.

In Vitro Translation and Nuclear Protein Extraction

The fragment of tilapia Ad4BP/SF-1 cDNA (nucleotides 194–1785), including the full length of an open reading frame, was released with EcoRI and SmaI from the original plasmid, which lacked 193 bp of the 5' untranslated region in the 5' end, and was subsequently introduced into the eukaryotic expression vector pSG5 (Stratagene). The resulting construct was used for in vitro translation of tilapia Ad4BP/SF-1. Then 1 µg of tilapia Ad4BP/SF-1 expression vector was employed in the TNT-coupled reticulocyte system (Promega, Madison, WI), as instructed by the manufacture. Nuclear protein was extracted from follicle layers (theca and granulosa cell layers) at midvitellogenic stage (5 days after ovulation; see Table 1) according to the nuclear protein extraction procedure described previously [14].

Gel-Shift Assay

Gel-shift assay was performed as per the method described previously [14] with slight modifications. Four double stranded oligonucleotide fragments were synthesized as follows. The consensus Ad4 (5'GTGCATCCAAGGGTCACTGATGAC3'), harboring the binding site for Ad4BP/SF-1 (underlined in the sequence) that is identical to consensus Ad4BP binding motif (5'-PyAGGPyCPu), showed high binding activity to bovine Ad4BP and fish (medaka) FTZ-F1 [14, 15]. The mutated Ad4 ({Delta}Ad4, 5'GTGCATATCAGGTCACTGATGAC3') altered the first three nucleotides (indicated by boldface letters) of the consensus Ad4 binding motif and could not bind to bovine Ad4BP/SF-1 and medaka FTZ-F1 [14, 15]. The Arom1 (5'AATCCCTCAAGGTTGCCAC3') and Arom2 (5'GTAAACCCAAGGGCATGAAC) were homologous to the tilapia aromatase gene promoter element (Fig. 2B). These fragments were end labeled by [32P]dCTP throughout using a klenow fill-in from both ends. The labeled DNA probe (4 ng, 20 000–40 000 cpm) were added to 20 µl of a binding reaction (15 mM HEPES, pH 7.9; 100 ng/µl [dIdC:dIdC]; 4% Ficoll 400 [w/v]; 4 µg/ml BSA; 50 mM KCl; 1 mM DTT; 1 mM EDTA) with 4 µg nuclear extract protein from follicle layers at midvitellogenic stage or 1 µl in vitro-translated tilapia Ad4BP/SF-1 protein. In addition, unlabeled, double-stranded DNA oligomers were used as competitors in the binding reactions. Binding reaction mixtures were incubated for 30 min at room temperature. Unbound labeled DNA was separated as DNA-protein complexes by electrophoresis carried out on 8% polyacrylamide gel in 1% Tris-glycine-EDTA at 10 mA for 1 h. Gels were exposed and then visualized with a BAS2000 image analyzer (Fuji Film Co. Ltd., Tokyo, Japan).



View larger version (101K):
[in this window]
[in a new window]
  		FIG. 2. Alignment of the amino acid sequences of the Ad4BP/SF-1 homologs in vertebrates. To aid comparisons, the box includes the DNA-binding domain, the Ad4BP/SF-1 box, regions II and III, and the AF-2 motif indicate functional domains and motifs. Species definitions for the abbreviations can be obtained from Table 2

Northern Blot Analysis

Total RNA was extracted from ovarian follicles at various stages or from hCG-treated follicles in vitro (see above), and Northern blot was performed using a standard protocol [30]. The membranes were scanned and quantified for intensity of hybridization signals with a BAS 2000 image analyzer (Fuji Film Co. Ltd.). After scanning, the blots were stripped of radioactivity with 0.1% SDS at 100°C and probed again with a radiolabeled ß-actin cDNA (1.4 kb tilapia ß-actin cDNA fragment out of 2 kb ß-actin cDNA clone; Yoshiura et al., unpublished results). The ß-actin was used as an internal control. In addition, the gel was stained with EtBr to verify 18 and 28S RNA to demonstrate equal loading of total RNA in all lanes. Northern blots were repeated twice for all the analyses with different samples, and relative mean expression levels of Ad4BP/SF-1 or oP450arom mRNA were determined by comparing with ß-actin mRNA.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Isolation and Sequence Analysis of the Promoter Region of the oP450arom Gene

The nucleotide sequence of the 5' flanking region and the exon 1 of the tilapia oP450arom gene are shown in Figure 1. The 5' RACE was performed in order to determine the 5' end of the tilapia oP450arom transcript (putative transcription initiation site). The sequence obtained from the 5' RACE started at nucleotide A, which is located 36 bp upstream from a putative initiation codon (ATG), and thus the transcriptional initiation site was assigned to be the same nucleotide (A), which is also at 28 bp downstream from a putative TATA box (Fig. 1). Inspection of the 5' flanking region and exon 1 of the tilapia oP450arom gene yielded potential regulatory elements, including CRE [33], two Ad4-binding motifs [34], and a half site of the palindrome sequences of estrogen-responsive element (ERE half) with sequence similarity. The positions of these elements were shown in Figure 1. The sequence of tilapia oP450arom promoter was compared with the medaka oP450arom promoter by harr plot and alignment analyses [35], and a region (-180 to -30 bp) upstream from the TATA box was found to have similarity between two promoters (figure not shown). This conserved region included two putative Ad4-binding motifs at the same positions within both tilapia and medaka promoters. The nucleotide sequence of the promoter region (5' flanking region of ovarian cytochrome P-450 aromatase gene) is accessible in GenBank under accession no. AB089924.

Nucleic and Deduced Amino Acid Sequences of Tilapia Ad4BP/SF-1

Tilapia Ad4BP/SF-1 cDNA contained 5071 nucleotides with a putative 1485-bp open reading frame but not a consensus polyadenylation signal or poly(A) tail. This cDNA encoded a protein of 486 amino acids. Phylogenetic tree analysis of tilapia Ad4BP/SF-1 indicated that it has the highest homology and similarity to medaka FTZ-F1 (data not shown) and also has high homology to other vertebrate Ad4BP/SF-1 or FTZ-F1 (Fig. 2). Figure 2 also depicts that DNA binding domain, putative Ad4BP/SF-1 box, and regions II and III of tilapia Ad4BP/SF-1 are highly conserved. Table 2 refers the amino acid identities in the aforesaid regions with other vertebrate homologues. The nucleotide sequence of tilapia Ad4BP/SF-1 is accessible in GenBank under accession no. AB060814.


View this table:
[in this window]
[in a new window]
  		TABLE 2. Percent amino acid sequence identity (%) of tilapia Ad4BP/SF-1 (tiAd4BP/SF-1) to overall and respective predicted functional domains and motifs of other vertebrate Ad4BP/SF-1 or FTZ-F1 homologs.*

Tissue Distribution Pattern of Tilapia Ad4BP/SF-1

Tilapia Ad4BP/SF-1 cDNA (476 bp) was distributed in gonadal tissues, brain, and kidney (Fig. 3, upper panel). No signal could be detected in the liver. The expression of Ad4BP/SF-1 in (late vitellogenic) ovary was weaker. The expression of ß-actin (Fig. 3, lower panel) indicated the functional integrity of the cDNA templates.



View larger version (45K):
[in this window]
[in a new window]
  		FIG. 3. RT-PCR analysis of tissue distribution pattern of tilapia Ad4BP/SF-1 (upper panel) and ß-actin (lower panel). The positive control consists of product amplified from the plasmid DNA of tilapia Ad4BP/SF-1; the negative (-ve) control contained no cDNA template. Genomic DNA was also used as a control for the contamination of DNA in the RT-PCR procedure

In Vitro Translation and Gel-Shift Assay

In vitro-translated tilapia Ad4BP/SF-1 formed a retarded band with the Ad4 consensus sequence that has been shown to bind bovine Ad4BP (Fig. 4A, lanes 2 and 6). The same is true with two different oP450arom gene promoter elements (Fig. 4A, lanes 9, 13, 15, and 19). Further, the mobility patterns of the retarded band after binding with Ad4 and oP450arom (Arom1 and Arom2) promoter elements were similar. On the other hand, the mutated Ad4 ({Delta}Ad4 in Fig. 4, A and B) sequence neither formed any retarded band with in vitro-translated Ad4BP/SF-1 (Fig. 4A, lane 7) nor competed with the native cold competitors (Fig. 4A, lanes 6, 13, and 19). Gel-shift assays using follicular nuclear extracts of midvitellogenic ovary also showed the occurrence of proteins that bind specifically to Ad4, Arom1, and Arom2 oligonucleotides. Interestingly, nuclear extracts formed three retarded bands in which the first one was more conspicuous (Fig. 4B, lanes 2, 6, 8, and 12). In addition, in vitro-translated tilapia Ad4BP/SF-1 showed more or less the same mobility as retarded band 1 (Fig. 4B, lanes 1 and 7). These three bands disappeared slowly in the presence of varying folds of native cold competitors (Fig. 4B, lanes 3, 4, 5, 9, 10, and 11) but not with mutated Ad4 (Fig. 4B, lanes 6 and 12).



View larger version (48K):
[in this window]
[in a new window]
  		FIG. 4. Binding activity of tilapia Ad4BP/SF-1 to putative orphan nuclear receptor-binding sites within the tilapia oP450arom promoter elements. A) A gel-shift assay denoting the ability of binding of tilapia Ad4BP/SF-1 to Ad4 motif and Arom1 and Arom2 of the tilapia oP450arom gene. Each competitor oligonucleotide was used at 50-fold molar excess. Double-stranded oligonucleotides corresponding to the consensus Ad4 (consAd4, lanes 1–6), mutated Ad4 ({Delta}Ad4, lane 7), Arom1 (lanes 8–13), and Arom2 (lanes 14–19) were labeled and mixed with in vitro-translated Ad4BP/SF-1 (lanes 2–7, 9–13, 15–19). Lanes 1, 8, and 14 contain probes without in vitro-translated Ad4BP/SF-1. Samples of lanes 6, 13, and 19 were with mutated Ad4 ({Delta}Ad4) as competitors to compare the natives. B) A gel-shift assay with nuclear extract from tilapia ovarian (midvitellogenic) follicular nuclear proteins. Arrows denote shifted bands. Double-stranded oligonucleotides corresponding to Arom1 (lanes 1–6) and Arom2 (lanes 7–12) were labeled and mixed with follicular nuclear protein (lanes 2–6, 8–12). Lanes 1 and 7 contain probes with in vitro-translated Ad4BP/SF-1. Samples of lanes 6 and 12 were with mutated Ad4 ({Delta}Ad4) as competitors to compare the natives

Changes in mRNA Levels of oP450arom and Ad4BP/SF-1 During the Ovulatory Cycle of Nile Tilapia

Northern blot analysis of oP450arom and Ad4BP/SF-1 expression at different stages of the ovarian cycle (Fig. 5) revealed that the expression of oP450arom and Ad4BP/SF-1 is an ascending trend from Day 0 (subdivided into A and B, depending on the size of the oocyte; refer to Table 1) to Day 5 after spawning, and then both turn out weaker from Day 8 to Day 11. Incidentally, the expression of Ad4BP/SF-1 was complementary to oP450arom, with peak expression at Days 2–5. Later, the expression of both oP450arom and Ad4BP/SF-1 became undetectable in the ovarian follicle at the day of spawning (Day 14). Similar results were obtained after repeating the Northern blot analysis with another set of samples.



View larger version (83K):
[in this window]
[in a new window]
  		FIG. 5. Representative Northern blot (repeated twice with two different sets of samples) of tilapia Ad4BP/SF-1 and oP450arom expression in the ovarian follicles of Nile tilapia during the spawning cycle

Effects of hCG Treatment In Vitro on mRNA Levels of oP450arom and Ad4BP/SF-1 in Tilapia Full-Grown Immature and Late Vitellogenic Follicles

Northern blot analysis revealed that in vitro incubation of full-grown immature follicles (post vitellogenic, corresponding to Day 11 after ovulation) with hCG abolished the expression of both oP450arom and Ad4BP/SF-1 at 18 h (Fig. 6A; see also graphical data). On the other hand, in vitro incubation of late vitellogenic follicles (corresponding to Day 8 after ovulation) with hCG maintained the expression of Ad4BP/SF-1 more or less steadily up to 18 h, while that of oP450arom was up-regulated from 6 h onward (Fig. 6B; see also graphical data). Similar results were obtained after repeating the Northern blot analysis with a second round of in vitro experiment samples.



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 6. A) Northern blot analysis of tilapia Ad4BP/SF-1 and oP450arom gene expression in post vitellogenic full-grown immature ovarian follicles (11 days after ovulation) of the Nile tilapia after hCG/saline (Ringer solution) treatments. B) Northern blot analysis of tilapia Ad4BP/SF-1 and oP450arom gene expression in late vitellogenic ovarian follicles (8 days after ovulation) of the Nile tilapia after hCG/saline treatments. Graphical data below each Northern blot figure represent the relative mean expression levels of Ad4BP/SF-1 or oP450arom mRNA with ß-actin mRNA obtained from two sets of samples


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Isolation and analysis of the promoter region of the oP450arom gene from Nile tilapia revealed the presence of several oligomeric sequences that correspond to mammalian Ad4/SF-1 or FTZ-F1 orphan nuclear receptor motifs, ERE half, and CRE. Studies from medaka oP450arom [6, 35] and Ad4BP/SF-1 demonstrated a transcriptional regulation of the former by the latter [14], which had prompted us to clone Ad4BP/SF-1 cDNA in the first instance from Nile tilapia and to study the gonadotropin regulation over oP450arom and Ad4BP/SF-1. Furthermore, the putative Ad4BP/SF-1 motifs shared the same positions within the promoter regions of medaka [35] and tilapia. Interestingly, the promoter characteristics with reference to Ad4BP/SF-1 motifs of the oP450arom gene of tilapia resembled that of goldfish CYP19a and zebrafish CYP19a1 aromatase genes [12, 13]; however, tilapia has two such motifs.

Isolation and characterization of Ad4BP/SF-1 cDNA clone from tilapia ovary revealed that the cDNA possesses typical structural features of the orphan nuclear receptor family. Conserved regions that are essential for DNA- and ligand-binding domains [36] showed high homology with other vertebrate Ad4BP/SF-1 cDNAs. In addition, activation function-2 (AF-2) and Ad4BP/SF-1 box show 100% identity, indicating that tilapia Ad4BP/SF-1 cDNA can be classified as a member of the Ad4BP/SF-1 family [37]. More recently, due to the lack of an AF-2 domain in zebrafish FTZ-F1 homolog, it has been determined that multiple subdomains in D and E regions are required for transcriptional activity [38]. The tissue distribution pattern and absence of expression in liver tend to indicate that tilapia Ad4BP/SF-1 can be grouped with Ad4BP/SF-1 rather than with LRH-1/FTF [17, 39]. It is also interesting to note that the tissues that showed the expression of Ad4BP/SF-1 to be a foil for oP450arom expression. Weaker expression of Ad4BP/SF-1 in the ovary is essentially due to the stage (late vitellogenic) of the sample (see below) and not to lower amplification of the PCR.

Gel-shift assays using in vitro-translated tilapia Ad4BP/SF-1 demonstrated that it forms a complex with Ad4 oligomeric sequences, indicating that tilapia Ad4BP/SF-1 specifically binds to its DNA motif. To further analyze, we used follicular nuclear extracts prepared from midvitellogenic ovary. The identification of three retarded bands in which the first one showed a similar mobility to the in vitro-translated tilapia Ad4BP/SF-1 indicates the natural presence of Ad4BP/SF-1-like protein in midvitellogenic ovarian follicles. Disappearance of binding on various folds of native cold competitors indicates the specificity of tilapia Ad4BP/SF-1 to bind with follicular nuclear extract proteins and in vitro-translated Ad4BP/SF-1 as well. Studies from our laboratory had already established that mutated oligomeric sequences of Ad4 could not bind specifically either to ovarian follicular nuclear protein or to in vitro-translated Ad4BP/SF-1 [14]. The present analysis using gel-shift assay extends support for such findings.

In the next step, we analyzed the changes in the expression profile of oP450arom and Ad4BP/SF-1 during the ovarian cycle. The amounts of oP450arom and Ad4BP/SF-1 transcripts increased significantly during vitellogenesis and declined during late/post vitellogenesis. Interestingly, when the follicle attained the FOM stage, the expression of both oP450arom and Ad4BP/SF-1 became undetectable. To our knowledge, there are no reports describing the simultaneous comparison of oP450arom and Ad4BP/SF-1 gene expression during different classified stages of the ovarian cycle in any lower vertebrates, including teleosts. Combined reports from medaka on oP450arom [6] and FTZ-F1 [14] expressions support our results. In mammals, oP450arom expression is induced by FSH in granulosa cells of preovulatory follicles and subsequently diminishes as a consequence of the LH surge. The decrease in oP450arom transcripts was associated with the reduction in mRNA of SF-1, probably elicited by the LH surge [40]. Our present observation is in accordance with these findings. Complementary expression of oP450arom and Ad4BP/SF-1, specific binding of in vitro-translated Ad4BP/SF-1 with Ad4, and oP450arom promoter sequences positively endorse that Ad4BP/SF-1 essentially serves as a transcriptional regulator for oP450arom. Interestingly, in mammals, CRE binding protein (CREB) and SF-1 domains of oP450arom gene act in an additive manner to mediate cAMP transactivation in granulosa cells, and they also interact synergistically to confer high basal transactivation in R2C Leydig cells [41]. In rats, both SF-1 and CRE essentially participate in the regulation of aromatase activity [42]. In teleosts, although cAMP is considered as an important second messenger for both estradiol-17ß and 17{alpha},20ß-DP biosynthesis [1, 28] and many other gonadotropin-related processes [43, 44], attempts to clone CREB or study CRE promoter activity in oP450arom are limited. Further studies are required to analyze the role of CREB in relation to ovarian development and also with reference to oP450arom, as the present report did not point out anything about the involvement of CRE vis à vis CREB.

In this study, both oP450arom and Ad4BP/SF-1 transcripts sharply declined and became undetectable when post vitellogenic full-grown immature follicles were incubated with hCG. A more recent report [45] from our laboratory pointed out that carbonyl reductase-like 20ß-HSD, an enzyme required for MIH synthesis, appeared intensely after incubating the full-grown immature follicles (Day 11 after ovulation) with hCG and also during FOM when Ad4BP/SF-1 and oP450arom expression got attenuated (present study). Senthilkumaran et al. [46] logically indicated that CRE but not Ad4 upstream motifs showed transcriptional (promoter) activity in trout 20ß-HSD gene. Thus, the present state of knowledge in teleost FOM suggests that gonadotropins implicate Ad4BP/SF-1 as a transcriptional regulator for oP450arom and that there may be a different transcriptional factor for 20ß-HSD. Taken together, the triggering of steroidogenic shift by gonadotropins is manifested through two molecular mechanisms, the first being the subjugation of the expression of Ad4BP/SF-1 vis à vis oP450arom and the second one being the induction of overexpression of 20ß-HSD, probably via an unknown transcriptional factor. This signifies further that subduing followed by abolition of Ad4BP/SF-1 launches the immediate signal for the shift in steroidogenesis during the ovarian cycle in teleosts. Desertion of Ad4BP/SF-1 and oP450arom expression in full-grown immature follicles (Day 11 after spawning) treated with hCG, on the one hand, and maintenance or elevation of their expression in late vitellogenic follicles (Day 8 after spawning) treated with hCG on the other suggest that gonadotropins play a dual roles in a paradoxical manner to regulate ovarian development by implicating Ad4BP/SF-1 to modulate oP450arom gene. However, hCG up-regulates oP450arom gene expression in late vitellogenic follicles without modifying Ad4BP/SF-1 to a large extent. This seems to indicate that gonadotropins might also have additional transcriptional factors to regulate the oP450arom gene or else the timing for hCG up-regulation of Ad4BP/SF-1 may be much earlier than oP450arom, e.g., at the early or mid vitellogenic follicular stage. This phenomenon is unclear at present. Nevertheless, our studies using hCG lead to our findings that gonadotropin acts in a phase-dependent manner on ovarian follicles to modulate steroid biosynthesis. In summary, our results suggest a role for Ad4BP/SF-1 probably in the transcriptional regulation of oP450arom in the ovarian follicles of Nile tilapia and perhaps gonadotropins assign such a major function.


   FOOTNOTES
 
1 Supported in part by Grants-in-Aid for Research for the Future (JSPS-RFTF 96L100401) and Priority Areas (07283101) from the Japan Society for the Promotion of Science; for Scientific Research from the Ministry of Education, Science, Sports, and Culture, Japan; Bio-Design Program from the Ministry of Agriculture, Forestry, and Fisheries, Japan; and CREST of JST (Japan Science and Technology). Back

2 Correspondence: Yoshitaka Nagahama, National Institute for Basic Biology, Okazaki 444-8585, Japan. FAX: 81 564 55 7556; nagahama{at}nibb.ac.jp Back

Received: 31 August 2002.

First decision: 24 September 2002.

Accepted: 13 November 2002.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Nagahama Y. Endocrine regulation of gametogenesis in fish. Int J Dev Biol 1994 38:217-229[Medline]
  2. Nagahama Y, Matsuhisa A, Iwamatsu T, Sakai N, Fukada S. A mechanism for the action of pregnant mare serum gonadotropin on aromatase activity in the ovarian follicle of the medaka, Oryzias latipes. J Exp Zool 1991 259:53-58[CrossRef]
  3. Richards JS. Hormonal control of gene expression in the ovary. Endocr Rev 1994 15:725-751[CrossRef][Medline]
  4. Hillier SG, Whitelaw PF, Smyth CD. Follicular oestrogen synthesis: the two cell, two gonadotropin model revisited. Mol Cell Endocr 1994 10:51-54
  5. Tanaka M, Telecky TM, Fukada S, Adachi S, Chen S, Nagahama Y. Cloning and sequence analysis of the cDNA encoding P-450 aromatase (P450arom) from a rainbow trout (Oncorhynchus mykiss) ovary: relationship between the amount of P450arom mRNA and the production of oestradiol-17ß in the ovary. J Mol Endocrinol 1992 8:53-61[Abstract]
  6. Fukada S, Tanaka M, Matsuyama M, Kobayashi D, Nagahama Y. Isolation, characterization, and expression of cDNAs encoding the medaka (Oryzias latipes) ovarian follicle P-450 aromatase. Mol Reprod Dev 1996 45:285-290[CrossRef][Medline]
  7. Chang XT, Kobayashi T, Kajiura H, Nakamura M, Nagahama Y. Isolation and characterization of the cDNA encoding the tilapia (Oreochromis niloticus) cytochrome P450 aromatase (P450arom): changes in P450arom mRNA, protein and enzyme activity in ovarian follicles during oogenesis. J Mol Endocrinol 1997 18:57-66[Abstract]
  8. Callard GV, Tchoudakaova T. Evolutionary and functional significance of two CYP19 genes differentially expressed in brain and ovary of goldfish. J Steroid Biochem Mol Biol 1997 61:387-392[CrossRef][Medline]
  9. Trant JM, Lehreter J, Gregory T, Nunez S, Wunder J. Expression of cytochrome P450 aromatase in the channel catfish, Ictalurus punctatus. J Steroid Biochem Mol Biol 1997 61:393-397[CrossRef][Medline]
  10. Gen K, Okuzawa K, Kumakura N, Yamaguchi S, Kagawa H. Correlation between messenger RNA expression of cytochrome P450 aromatase and its enzyme activity during oocyte development in the red sea bream (Pagrus major). Biol Reprod 2001 65:1186-1194[Abstract/Free Full Text]
  11. Dalla Valle L, Lunardi L, Belvedere CP. European sea bass (Dicentratus labrax L.) cytochrome P450arom: cDNA cloning, expression and genomic organization. J Steroid Biochem Mol Biol 2002 80:25-34[CrossRef][Medline]
  12. Tchoudakova A, Kishida M, Wood E, Callard GV. Promoter characteristics of two cyp19 genes differentially expressed in the brain and ovary of teleost fish. J Steroid Biochem Mol Biol 2001 78:427-439[CrossRef][Medline]
  13. Kazeto Y, Ijiri S, Place AR, Zohar Y, Trant JM. The 5'-flanking regions of CYP19A1 and CYP19A2 in zebrafish. Biochem Biophys Res Commun 2001 288:503-508[CrossRef][Medline]
  14. Watanabe M, Tanaka M, Kobayashi D, Yoshiura Y, Oba Y, Nagahama Y. Medaka (Oryzias latipes) FTZ-F1 potentially regulates the transcription of P450 aromatase in ovarian follicles: cDNA cloning and functional characterization. Mol Cell Endocrinol 1999 149:221-228[CrossRef][Medline]
  15. Morohashi K, Honda S, Inomata Y, Handa H, Omura T. A common trans-acting factor, Ad4-binding protein, to the promoters of steroidogenic P-450s. J Biol Chem 1992 267:17913-17919[Abstract/Free Full Text]
  16. Lala DS, Rice DA, Parker KL. Steroidogenic factor I, a key regulator of steroidogenic enzyme expression, is the mouse homolog of fushi tarazu-factor I. Mol Endocrinol 1992 6:1249-1258[Abstract]
  17. Honda S, Morohashi K, Nomura M, Takeya H, Kitajima M, Omura T. Ad4BP regulating steroidogenic P-450 gene is a member of steroid hormone receptor superfamily. J Biol Chem 1993 268:7494-7502[Abstract/Free Full Text]
  18. Morohashi K, Omura T. Tissue specific transcription of P450 (11beta) gene in vitro. J Biol Chem 1990 108:1050-1056
  19. Zhu XG, Park KS, Kaneshige M, Bhat MK, Zhu Q, Mariash CN, McPhie P, Cheng SY. The orphan nuclear receptor Ear-2 is a negative coregulator for thyroid hormone nuclear receptor. Mol Cell Biol 2001 20:2604-2618
  20. Ito M, Matsuda A, Yumoto K, Otomo A, Takahashi Y, Takamatsu N, Kanda H, Yamashita S, Shiba T. cDNA cloning of a new member of FTZ-F1 subfamily from a rainbow trout. Biochim Biophys Acta 1998 1395:271-274[Medline]
  21. Liu D, Le Drean Y, Ekker M, Xiong F, Hew CL. Teleost FTZ-F1 homolog and its splicing variant determine the expression of the salmon gonadotropin II beta subunit gene. Mol Endocrinol 1997 11:877-890[Abstract/Free Full Text]
  22. Ellinger-Ziegelbauer H, Hihi AK, Laudet V, Keller H, Wahli W, Dreyer C. FTZ-F1-related orphan receptors in Xenopus laevis: transcriptional regulators differentially expressed during early embryogenesis. Mol Cell Biol 1994 14:2786-2797[Abstract/Free Full Text]
  23. Kudo T, Sutou S. Molecular cloning of chicken FTZ-F1-related orphan receptors. Gene 1997 197:261-268[CrossRef][Medline]
  24. Parker KL, Rice DA, Lala DS, Ikeda Y, Luo X, Wong M, Bakke M, Zhao L, Frigeri C, Hanley NA, Stallings N, Schimmer BP. Steroidogenic factor 1: an essential mediator of endocrine development. Recent Prog Horm Res 2002 57:19-36[Abstract/Free Full Text]
  25. Luo X, Ikeda Y, Parker KL. A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 1994 77:481-490[CrossRef][Medline]
  26. Sadovsky Y, Crawford PA, Woodson KG, Polish JA, Clements MA, Tourtellotte LM, Simburger K, Milbrandt J. Mice deficient in the orphan receptor steroidogenic factor 1 lack adrenal glands and gonads but express P-450 side-chain cleavage enzyme in the placenta and have normal embryonic serum levels of corticosteroids. Proc Natl Acad Sci U S A 1995 92:10939-10943[Abstract/Free Full Text]
  27. Kawabe K, Shikayama T, Tsuboi H, Oka S, Oba K, Yanase T, Nawata H, Morohashi K. Dax-1 as one of the target genes for Ad4BP/SF-1. Mol Endocrinol 1999 13:1267-1284[Abstract/Free Full Text]
  28. Nagahama Y. 17{alpha},20ß-Dihydroxy-4-pregnen-3-one, a maturation-inducing hormone in fish oocytes: mechanisms of synthesis and action. Steroids 1997 62:190-196[CrossRef][Medline]
  29. Siebart PD, Chenchik A, Kellogg DE, Lukyanov KA. An improved PCR method for walking uncloned genomic DNA. Nucleic Acids Res 1995 23:1087-1088[Free Full Text]
  30. Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual, 3rd ed. Cold Spring, NY: Cold Spring Harbor Laboratory Press; 2001
  31. Yoshiura Y, Kobayashi M, Kato Y, Aida K. Molecular cloning of the cDNAs encoding two gonadotropin ß subunits (GTH-Iß and IIß) from the goldfish, Carassius auratus. Gen Comp Endocrinol 1997 105:379-389[CrossRef][Medline]
  32. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic tree. Mol Biol Evol 1987 4:406-425[Abstract]
  33. Montminy MR, Bilezikjian LM. Binding of a nuclear protein to cyclic response element of somatostatin. Nature 1987 328:175-178[CrossRef][Medline]
  34. Parker KL, Schimmer BP. Steroidogenic factor 1: a key determinant of endocrine development and function. Endocr Rev 1997 18:361-377[Abstract/Free Full Text]
  35. Tanaka M, Fukada S, Matsuyama M, Nagahama Y. Structure and promoter analysis of the cytochrome P-450 aromatase gene of the teleost fish, medaka (Oryzias latipes). J Biochem 1995 117:719-725[Abstract/Free Full Text]
  36. Wang LH, Tsai SY, Cook RG, Beattie WG, Tsai MJ, O'Malley BW. COUP transcription factor is a member of the steroid receptor superfamily. Nature 1989 340:163-166[CrossRef][Medline]
  37. Ueda H, Sun GC, Murata T, Hirose S. A novel DNA-binding motif abuts the zinc finger domain of insect nuclear hormone receptor FTZ-F1 and mouse embryonal long terminal repeat-binding protein. Mol Cell Biol 1992 12:5667-5672[Abstract/Free Full Text]
  38. Liu D, Chandy M, Lee SK, Le Drean Y, Ando H, Xiong F, Woon Lee J, Hew CL. A zebrafish ftz-F1 (Fushi tarazu factor 1) homologue requires multiple subdomains in the D and E regions for the transcriptional activity. J Biol Chem 2000 275:16758-16766[Abstract/Free Full Text]
  39. Galarneau L, Pare JF, Allard D, Hamel D, Levesque L, Tugwood JD, Green S, Belanger L. The alpha-fetoprotein locus is activated by a nuclear receptor of the Drosophila FTZ-F1 family. Mol Cell Biol 1996 16:3853-3865[Abstract]
  40. Fitzpatrick SL, Carlone DL, Robker RL, Richards JS. Expression of aromatase in the ovary: down regulation of mRNA by the ovulatory luteinizing hormone surge. Steroids 1997 62:197-206[CrossRef][Medline]
  41. Carlone DL, Richards JS. Evidence that functional interactions of CREB and SF1 mediate hormone regulated expression of the aromatase gene in granulosa cells and constitutive expression in R2C cells. J Steroid Biochem Mol Biol 1997 61:223-231[CrossRef][Medline]
  42. Young M, McPhaul MJ. A steroidogenic factor-1 binding site and cyclic adenosine 3',5'-monophosphate response element-like elements are required for the activity of the rat aromatase promoter in rat Leydig tumor cell lines. Endocrinology 1998 139:5082-5093[Abstract/Free Full Text]
  43. Planas JV, Swanson P, Dickhoff WW. Regulation of testicular steroid production in vitro by gonadotropins (GTH I and GTH II) and cyclic AMP in coho salmon (Oncorhynchus kisutch). Gen Comp Endocrinol 1993 91:8-24[CrossRef][Medline]
  44. Planas JV, Goetz FW, Swanson P. Stimulation of brook trout steroidogenesis by gonadotropins I and II is mediated by the cyclic adenosine 3',5'-monophosphate/protein kinase A pathway. Biol Reprod 1997 57:647-654[Abstract]
  45. Senthilkumaran B, Sudhakumari CC, Chang XT, Kobayashi T, Oba Y, Guan G, Yoshiura Y, Yoshikuni M, Nagahama Y. Ovarian carbonyl reductase-like 20ß-hydroxysteroid dehydrogenase shows distinct surge in messenger RNA expression during natural and gonadotropin-induced meiotic maturation in Nile tilapia. Biol Reprod 2002 67:1080-1086[Abstract/Free Full Text]
  46. Senthilkumaran B, Guan G, Watanabe M, Sudhakumari CC, Nagahama Y. Molecular characterization of 5' upstream regions of rainbow trout ovarian 20ß-hydroxysteroid dehydrogenase-like carbonyl reductase genes. In: Program of the 3rd IUBS symposium on Molecular Aspect of Fish Genomes and Development;2001; Singapore. Abstract S37



This article has been cited by other articles:


Home page
 Biol. Reprod.Home page
S. Ijiri, H. Kaneko, T. Kobayashi, D.-S. Wang, F. Sakai, B. Paul-Prasanth, M. Nakamura, and Y. Nagahama
Sexual Dimorphic Expression of Genes in Gonads During Early Differentiation of a Teleost Fish, the Nile Tilapia Oreochromis niloticus
Biol Reprod, February 1, 2008; 78(2): 333 - 341.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
G.-C. Wu, S. Tomy, and C.-F. Chang
The Expression of nr0b1 and nr5a4 During Gonad Development and Sex Change in Protandrous Black Porgy Fish, Acanthopagrus schlegeli
Biol Reprod, February 1, 2008; 78(2): 200 - 210.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
D.-S. Wang, T. Kobayashi, L.-Y. Zhou, B. Paul-Prasanth, S. Ijiri, F. Sakai, K. Okubo, K.-i. Morohashi, and Y. Nagahama
Foxl2 Up-Regulates Aromatase Gene Transcription in a Female-Specific Manner by Binding to the Promoter as Well as Interacting with Ad4 Binding Protein/Steroidogenic Factor 1
Mol. Endocrinol., March 1, 2007; 21(3): 712 - 725.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
T.-T. Wong, S. Ijiri, and Y. Zohar
Molecular Biology of Ovarian Aromatase in Sex Reversal: Complementary DNA and 5'-Flanking Region Isolation and Differential Expression of Ovarian Aromatase in the Gilthead Seabream (Sparus aurata)
Biol Reprod, May 1, 2006; 74(5): 857 - 864.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
S Kuntz, D Chardard, C-I Ko, H Dumond, M Ducatez, M Callier, S Flament, and A Chesnel
Female-enriched and thermosensitive expression of steroidogenic factor-1 during gonadal differentiation in Pleurodeles waltl
J. Mol. Endocrinol., February 1, 2006; 36(1): 175 - 186.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
L Y Zhou, D S Wang, B Senthilkumaran, M Yoshikuni, Y Shibata, T Kobayashi, C C Sudhakumari, and Y Nagahama
Cloning, expression and characterization of three types of 17{beta}-hydroxysteroid dehydrogenases from the Nile tilapia, Oreochromis niloticus
J. Mol. Endocrinol., August 1, 2005; 35(1): 103 - 116.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
68/5/1545    most recent
biolreprod.102.010843v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yoshiura, Y.
Right arrow Articles by Nagahama, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshiura, Y.
Right arrow Articles by Nagahama, Y.
Agricola
Right arrow Articles by Yoshiura, Y.
Right arrow Articles by Nagahama, Y.

HOME HELP