|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Reproductive Technology |
Fundación IVI para el Estudio de la Reproducción3
and
Department of Pediatrics, Obstetrics and Gynecology,4 Valencia University School of Medicine, Valencia, Spain
Department of Obstetrics and Gynecology,5 Hospital Universitario Dr. Peset, Valencia, Spain
| ABSTRACT |
|---|
|
|
|---|
corpus luteum, granulosa cells, growth factors, human chorionic gonadotropin, ovary
| INTRODUCTION |
|---|
|
|
|---|
Vascular endothelial growth factor (VEGF) is the main candidate for such mediation on the basis of clinical [48] and experimental [811] observations in humans. Moreover, VEGF is expressed in human granulosa-lutein cells in response to gonadotropins [12, 13], and recent experiments in rodents have clearly shown a cause-effect relationship between ovarian VEGF expression and increased vascular permeability (VP) [14].
Convincing evidence also indicates that VEGF is expressed, produced, and released in the ovary. Increased capillary permeability does not occur in ovariectomized animals hyperstimulated with gonadotropins [14]. Furthermore, indirect observations in women with enlarged ovaries and ascites [15, 16] clearly suggest that the ovary is also the source and target of VEGF in humans. Thus, the regulation of the entire VEGF system, namely ligand and receptors, seems to be important in COH. With regard to this, VEGF up-regulates the presence of its own kinase-domain receptor (KDR) [17], also known as VEGF receptor (VEGFR)-2, which appears to be involved mainly in regulating VP, angiogenesis, and vasculogenesis [18, 19]. Expression of mRNA for the KDR/VEGFR-2, but not the flt-1/VEGFR-1, receptor has been recently described in human granulosa-luteinized cells [8]. However, the actual role of hCG in the up-regulation of the VEGFR-2 is not known.
Furthermore, the observation that the effect of gonadotropins on circulation is not observed only in those women developing OHSS is clinically relevant. A circulatory dysfunction characterized by initial arteriolar vasodilation has been described as a universal phenomenon in all patients treated with such drugs [20, 21]. Whether increased capillary permeability is also present in all patients undergoing in vitro fertilization and the role of VEGF in this phenomenon remain unclear.
Using the above information, we applied an experimental model to study VP and VEGF expression in rodents treated with gonadotropins to answer the following questions: First, are VP and VEGF expression altered during mild ovarian stimulation? This was an attempt to elucidate if this phenomenon also occurs in normal patients undergoing regular stimulation for IVF. Second, because the ovary is the critical endocrine organ in the development of OHSS, we wanted to gain insight concerning the regulation of the VEGF system, including the VEGFR-2.
| MATERIALS AND METHODS |
|---|
|
|
|---|
General analytical-grade chemicals were obtained from Sigma Chemical Co. (St Louis, MO) and Merck (Darmstadt, Germany). The eCG was purchased from Sigma, and the hCG (Profasi) was acquired from Serono Laboratories (Madrid, Spain). Primary mouse VEGF (sc7269) and VEGFR-2 (sc6251) anti-human monoclonal antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Extravidin-horse radish peroxidase conjugate was purchased from Sigma-Aldrich (Irvine, U.K.). Biotinylated immunoglobulin (Ig) Gs, used to detect the primary antibody, were obtained from DAKO (Glostrup, Denmark). The Trizol reagent was obtained from Gibco (Paisley, Scotland), and ketamine (Ketolar) was purchased from Parke-Davis (Barcelona, Spain)
Animals, Stimulation Protocols, and Experimental Design
Immature female Wistar rats were obtained from Harlam Iberica (Sant Feliu de Codina, Spain) and kept at least 1 wk in our laboratory before starting the experiments. They were fed with a standard diet and allowed free access to water with a 12L:12D photoperiod (lights-on, 07001900 h). All studies started with 22-day-old animals (weight, 4248 g) and were conducted in accordance with the NIH Guidelines for the Care and Use of Laboratory Animals. Protocols for animal handling were approved by the Ethical Animal Committee of the Valencia University School of Medicine.
For the present study, animals were divided in three groups. The control group (n = 24) received 0.1 ml of i.p. saline from Day 22 to Day 26. The mild-stimulation group (n = 24) received 10 IU of eCG on Day 24 and 10 IU of hCG 48 h later (Day 26) to mimic a routine ovarian stimulation. The OHSS group (n = 24) was given 10 IU of eCG for four consecutive days and 30 IU hCG on the fifth day to induce OHSS [22].
Time-course experiments were carried out by measuring VP at 0, 24, 48, and 96 h after administration of hCG or saline. Each time point related to six animals per experimental group. At each time point, one ovary from at least four animals per group was frozen for mRNA analysis, whereas the animal's other ovary underwent immunohistochemical analysis. Primers targeting the common region of VEGF isoforms were employed in a real-time quantitative polymerase chain reaction (PCR) comparing whole-VEGF mRNA levels of the three groups at each time point to find out the timing of VEGF expression. The same technique was used to quantify whole-VEGFR-2 mRNA expression in these ovaries. Immunohistochemical analysis was also performed on the ovaries of these animals to demonstrate the existence of and to locate VEGF and VEGFR-2 protein production.
Permeability Assays
To measure VP, a previously described method was employed [22]. Rats were anesthetized with ketamine (100 mg/kg) and kept warm on a thermal blanket to avoid hypothermia. A fixed volume (0.2 ml) of 5 mM Evans Blue (EB) dye diluted in distilled water was injected via the femoral vein. Thirty minutes after dye injection, the peritoneal cavity was filled with 5 ml of 0.9% saline (21°C, pH 6) and massaged for 30 sec. Subsequently, the fluid was extracted using a vascular catheter (Vialon; Becton Dickinson, Madrid, Spain) to prevent tissue or vessel damage. To avoid any protein interference, the peritoneal fluid was recovered in tubes containing 0.05 ml of 0.1 N NaOH. After centrifugation at 900 x g for 12 min, EB concentration was measured at 600 nm on a Shimadzu 1201 spectrophotometer (Izasa, Madrid, Spain). The level of extravasated dye present in the recovered fluid was expressed as micrograms per 100 g body weight.
VEGF and VEGFR-2 mRNA
RNA isolation Extraction of RNA was performed according to the method of Chomczynski and Sacchi [23], with minor modifications in the use of the Trizol reagent. Briefly, each tissue was weighed, and 500 µl of Trizol reagent per 100 mg of tissue weight were added. Total RNA was separated from DNA and proteins by adding 250 µl of chloroform and then precipitated with isopropanol (overnight, -20°C). The precipitate was washed twice in ethanol, air-dried, and resuspended in diethylpyrocarbonate (DEPC)-treated water. The amount of RNA was quantified by spectrophotometry with a SmartSpec 3000 spectrophotometer (Bio-Rad, Barcelona, Spain).
Reverse transcription Reverse transcription (RT) was carried out using Advantage RT-for-PCR KIT (Clontech, Palo Alto, CA). Mastermix per sample was prepared as follows: 4 µl of 5x reaction buffer, 1 µl of dNTP mix (10 mM each), 0.5 µl of recombinant RNase inhibitor, and 1 µl of Moloney murine leukemia virus reverse transcriptase. One microgram of each sample was diluted to a final volume of 12.5 µl in DEPC-treated water plus 1 µl of oligo (dT)18, and the mixture was heated for 2 min at 70°C and then kept on ice until the mastermix (6.5 µl) was added. For each RT, a blank was prepared using all the reagents except the RNA sample, for which an equivalent volume of DEPC water (12.5 µl) was substituted. The RT blank was used to prepare the PCR blank (see below). Once all the components were mixed, the samples were incubated at 42°C for 1 h and then heated for 5 min at 94°C to stop cDNA synthesis and destroy DNase activity. The product was diluted to a final volume of 100 µl with DEPC-treated water and stored at -20°C until PCR analysis.
Real-time PCR Primers for quantitative PCR were designed using the Primers Express Software (Applied Biosystems, Warrington, U.K.) and synthesized by Applied Biosystems (Barcelona, Spain) The ß-actin sense primer was 5'-616AGGGAAATCGTGCGTGACAT635, and the antisense ß-actin primer was 5'-764AACCGCTCATTGCCGATAGT745-3' (NCBI access no. 55574), giving rise to an expected PCR product of 149 base pairs (bp). The VEGF primers designed to amplify a region common to all VEGF isoforms were 5'-114CAGCTATTGCCGTCCAATTGA124-3' for the sense primer and 5'-244CCAGGGCTTCATCATTGCA226-3' for the antisense primer, where a 131-bp PCR product was expected (NCBI accession no. AF215726). To amplify VEGFR-2, the forward primer was 5'- 1167TCAGAGACACTGAGCATGGAA1187-3', and the reverse primer was 5'-1417GTTTTCAGCTCTTCTGAGGCAA1396-3', giving rise to a 250-bp product (NCBI accession no. U93306).
To amplify cDNA, the RT samples were diluted to a final concentration of 12.5 ng/µl of total cDNA. In each reaction, a total of 4 µl (50
g of cDNA) from each RT tube was mixed with 12.5 µl of SYBR Green PCR master mix (Applied Biosystems, Warrington, U.K.) containing nucleotides, Taq DNA polymerase, MgCl2, and reaction buffer with SYBR green; next, 13 µl of 0.25 µM specific primers and double-distilled water were added to a final volume of 25 µl.
Real-time PCR was performed using an ABI PRISM 7700 Sequence Detection System (Perkin-Elmer Corp., Foster City, CA) according to the manufacturer's instructions with a heated lid (105°C) and an initial denaturation step at 95°C for 10 min followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min.
Each sample was amplified in duplicate for VEGF and ß-actin and for VEGFR-2 and ß-actin, giving rise to four reactions per sample in each analysis. In parallel, 6-fold serial dilutions of known concentrations of VEGF, VEGFR-2, and ß-actin cDNA were run as a calibration curve. Quantification data were analyzed with the ABI PRISM 1.7 analysis software (Perkin-Elmer). Background fluorescence was removed by setting a noise band. Duplicates showing more than a 5% variation were discarded. To validate a real-time PCR, standard curves with r > 0.95 and slope values between -3.1 and -3.4 were required.
For each sample, the amounts of VEGF, VEGFR-2, and ß-actin cDNA were determined with relation to the standard curves. The VEGF:ß-actin and VEGFR-2:ß-actin ratios were used to estimate and compare the relative VEGF and VEGFR-2 expression among samples. The results of each PCR experiment were confirmed in a minimum of three consecutive experiments.
After 40 cycles, final PCR products from VEGF, VEGFR-2, and ß-actin (as the housekeeping gene in both cases) did not remain in the log-linear phase and, hence, could not be quantified at this point. Nevertheless, we subjected them to a subsequent agarose 4% gel electrophoresis with ethidium bromide to confirm that those products we had expected to be amplified were, in fact, the only ones to be affected in such a way.
VEGF and VEGFR-2 protein localization Ovarian samples for immunohistochemical experiments were fixed in formalin, embedded in paraffin, sectioned, and mounted on glass slides. Twelve serial sections (thickness, 5 µm) from each sample were prepared for immunohistochemistry, and the first and last sections were stained with hematoxylin-eosin. Tissue sections were deparaffinized in xylene and dehydrated in a graded series of ethanol. After deparaffination, sections were boiled in citrate buffer (0.05 M) in a microwave oven to unmask antigens. Endogenous peroxidase was quenched with 3% (v/v) hydrogen peroxide (10 min at room temperature), samples were rinsed three times for 5 min in PBS, and nonspecific binding was blocked with dehydrated nonfat milk (50 mg/ml diluted in PBS). Thereafter, tissue sections were rinsed three times with PBS-Tween-20 (PBS-T), 0.05%, and then incubated overnight at 4°C with 1:100 sc7251 anti-human VEGF or 1:200 for anti-human VEGFR-2 antibodies (which in both cases recognize rat VEGF and VEGFR-2 antigens). After being washed four times with PBS-T, sections were incubated with biotinylated rabbit anti-mouse IgG (90 min, 1:300 dilution at 37°C) to amplify the signal. Sections were rinsed four times with PBS-T and then incubated with extravidin-horse radish peroxidase conjugate (30 min, 1:40 dilution at room temperature), washed four times with PBS-T, and incubated for 10 min with working substrate solution (0.2 ml of stock aminoethyl carbazole solution with 3.8 ml of 0.05 M acetate buffer [pH 6.0] and 20 µl of 3% H2O2 added immediately before use). The reaction was terminated by rinsing the slides gently with distilled water. Finally, slides were counterstained with Mayer hematoxylin, rinsed with water, mounted with glycerol gelatin, and viewed through an Olympus BH2 microscope (Olympus, Barcelona, Spain). Negative controls were included in each experiment by incubating tissue sections with antibody dilution buffer instead of the primary antibody. Positive control slides consisted of human hemangiosarcoma cells for VEGF and rat lung for VEGFR-2.
Statistical Analysis
Data are expressed as the mean ± SEM. In the VP experiments, a nonparametric Kruskal-Wallis statistical method was used to find differences among groups at each time point, whereas a Mann-Whitney test was employed to define these differences. The same approach was taken with real-time quantitative PCR for VEGF and VEGFR-2 expression experiments. For these purposes, we previously normalized VEGF:ß-actin and VEGFR-2:ß-actin ratios in the mild-stimulation and OHSS groups with VEGF:ß-actin and VEGFR-2:ß-actin ratios in the control group at each time point. Linear regression was used to estimate the relationship between the expression of VEGF and VEGFR-2 and VP. Significance was defined as P < 0.05. Statistical analysis was carried out using the Statistical Package for Social Sciences (SPSS, Inc., Chicago, IL).
| RESULTS |
|---|
|
|
|---|
Ovarian weight was compared in the three groups of animals, being higher in the OHSS group (302.7 ± 31.2 mg) than in both the mild-stimulation group (107.4 ± 21.3 mg, P < 0.01) and control animals (31.7 ± 4.3 mg, P < 0.01). Time-course determinations of VP using the EB method are shown in Figure 1. The average VP measured with this method in control animals was 2.3 (range, 1.33.1) µg of EB per 100 g body weight. The administration of high doses of gonadotropins in the OHSS group produced a more marked increased of VP than that seen in the mild-stimulation and control groups at any time point, peaking 48 h after hCG (23.5 ± 3.1 µg of EB per 100 g body weight, P < 0.01). Lower doses of gonadotropins (mild-stimulation group) also significantly increased VP.
|
Although the accumulation of ascitic fluid was not evaluated in these experiments, we did observe ascites and a fibrin-rich matrix protein accumulation in the peritoneal cavity in more than 80% of the OHSS-group rats at 48 and 96 h after hCG. This was not the case for the other two groups.
VEGF and VEGFR-2 mRNA Expression in Rat Ovary
Whole-VEGF expression varied among groups at each time point (Fig. 2). The OHSS animals showed significantly higher VEGF expression before hCG administration compared to the other two groups. Following hCG injection, both the OHSS and mild-stimulation groups showed a more increased VEGF expression than control animals in the remaining time points. Top VEGF expression was observed after 48 h in OHSS animals (9.8 ± 0.6 arbitrary units of fluorescence, compared to control group), coincidental with maximal vascular permeability to Evans Blue dye.
|
The VEGFR-2 was expressed at low levels in ovaries of control and gonadotropin-treated animals. In fact, the onset of the VEGFR-2 signal in the PCR reaction was 1014 cycles later than that of VEGF or ß-actin. However, real-time PCR unequivocally detected that the expression of VEGFR-2 in the OHSS group was significantly higher than in controls at any time point and also higher than that in the mild-stimulation group at 0, 24, and 48 h after hCG (Fig. 3).
|
The relationship between increased VP and mRNA VEGF expression in the three experimental groups was analyzed. A positive correlation was found for the mild-stimulation group (r = 0.866, P < 0.001) and OHSS group (r = 0.835, P < 0.001) (Fig. 4A). The same was true for the correlation between VP and VEGFR-2 expression for mild-stimulation (r = 0.726, P = 0.015) and OHSS (r = 0.940, P < 0.001) animals (Fig. 4B). A significant correlation was also found for VEGFR-2 and VEGF in the mild-stimulation (r = 0.778, P /< 0.001) and OHSS (r = 0.648, P < 0.001) groups. No relationship was found for the control group in any case.
|
VEGF and VEGFR-2 Protein Localization in the Ovary
Figure 5 shows a representative picture of the immunohistochemical studies in which the presence of VEGF in the ovaries of control, mild-stimulation, and OHSS animals was investigated at the protein level. Immunoreactive VEGF was weakly stained in the theca and stroma cells, but not in the granulosa cells, of the control group. In the OHSS and mild-stimulation groups, the granulosa cells of preovulatory follicles were intensely stained for VEGF. After ovulation, we observed a strong staining in the whole corpus luteum, which displayed a gradient with the highest binding in the outer zone. Nonovulating follicles in both gonadotropin-treated groups showed a similar pattern as that of preovulatory follicles, with a positive signal in granulosa cells. Endothelial cells were strongly stained with VEGF antibody. Independent of the group they originated from, slides treated with VEGF primary antibody showed the strongest staining in the zona pellucida of atretric and preovulatory oocytes, with no significant signal in the negative control.
|
The same pattern of expression for VEGFR-2 protein was found in both gonadotropin-stimulated groups. Previous to hCG administration, the vessels were the main target for VEGFR-2, and only a dispersed and weak staining was observed in granulosa cells. Following hCG, we observed a strong staining in blood vessels and in granulosa-lutein cells (Fig. 6).
|
| DISCUSSION |
|---|
|
|
|---|
These findings agree with what we know to be the case in humans. First, VEGF expression begins before hCG administration and is present in follicles before ovulation [24]. Second, granulosa-luteinized cells collected at ovum pick-up in patients undergoing IVF express VEGF mRNA [12, 13], which is stimulated by hCG in vitro, particularly in cells from women who later developed the syndrome [8]. Third, human granulosa-luteinized cells also express the KDR receptor [8]; however, the up-regulation of hCG has not been proven. Our experiments did show the action of hCG in VEGFR-2 expression, although it was considerably lower than that found for the ß-actin housekeeping gene, making its quantification more difficult despite the fact that others have shown a homologous up-regulation of KDR/Flk-1 receptor expression by VEGF in vitro [17]. The immunohistochemical experiments, however, were enlightening, in that they showed that both proteins, VEGF and VEGFR-2, were also produced in the ovaries.
Whereas the ligand VEGF is initially overexpressed by eCG, it is precisely the action of hCG that triggers a tremendous release of VEGF 48 h later, with obvious effects on VP. The VEGFR-2 is also overexpressed to a certain extent by gonadotropins. When both findings are considered together, they suggest that the ovary can act autonomously and is responsible for the leakage of ascitic fluid observed in human OHSS, as has been suggested previously [15, 16]. In fact, we believe that the ovary is the main source of VEGF in OHSS, based on our previous studies in which ovariectomized animals treated with eCG and hCG suffered no changes in VP and in which blocking the VEGF system reversed the increase in VP caused by hCG [14]. Other endothelial cells of the body also may suffer the consequences of VEGF secreted by the ovary, and this is why accumulation of protein-rich fluid is observed not only in the abdominal cavity but also as a general circulatory disturbance [20, 21].
The fact that the VEGF system is overexpressed with the use of gonadotropins provides an explanation why OHSS has been observed in women in the absence of high ovarian response. The question that remains is why some women develop OHSS and others do not. The answer is still to be found, but it has recently been suggested how the presence of a binding globulin,
2-macroglobulin, in some individuals may account for the availability of VEGF to bind to its KDR receptor [25]. Other components of the VEGF system need to be further investigated, such as the soluble VEGFR (sVEGFR), its natural antagonist. Different concentrations of this antagonist have been described in women undergoing IVF [24], suggesting that an increased availability of
2-macroglobulin [25] or sVEGFR [26] decreases free VEGF, which explains why some develop OHSS and others do not.
It should be stressed, however, that all three parameters (VP, VEGF, and VEGFR-2 expression) showed significant differences between high and mild administrations of gonadotropins. Furthermore, the administration of eCG alone was sufficient to increase all three parameters, probably because of the LH contents of this preparation. This is also of particular relevance in humans, because we have the possibility of using recombinant and specific gonadotropins for COH.
Employing immunohistochemistry, we observed that endothelial and granulosa-luteinized cells showed a positive signal. The endothelial cells of the neovascularized corpus luteum stained particularly high for VEGF. Because VEGF is expressed and produced in granulosa-luteal cells [10, 12, 13, 27, 28], this finding could be interpreted as a coparticipation of endothelial cells in this biological function, but it could also be the result of a rapid release of VEGF from the granulosa cells into the vessels. We could not find differences in the ovarian localization of VEGF between the mild-stimulation and OHSS groups, suggesting a universal mechanism in response to hCG in both groups.
The VEGFR-2 protein in ovaries of hyperstimulated animals showed a similar localization in both gonadotropin-treated groups. Staining was located mainly in endothelial cells of vessels before hCG and, surprisingly, in granulosa-lutein cells after hCG, confirming the results recently obtained with humans by Wang et al [8]. Because VEGFR-2 was thought to be almost exclusively expressed by endothelial cells [29], these findings agree with those of Antczak and Van Blerkom [30] in the sense that some granulosa-lutein cell populations act as endothelial cells in ovarian tissue.
In summary, the simple use of gonadotropins induces a cascade of events in the ovaries that result in overexpression of VEGF and VEGFR-2 and increased VP. The degree of up-regulation of the VEGF system and VP is highly dependent on the dose and type of gonadotropin employed, with hCG being the most effective in this regard. These findings should be confirmed in humans to specify the appropriate amount and type of gonadotropin and to ascertain how best to manage the OHSS targeting the VEGF system.
| FOOTNOTES |
|---|
2 Correspondence: Antonio Pellicer, FIVIER, Plaza de la Policía Local, 3, 46015 Valencia, Spain. FAX: 34 963050998; apellicer{at}ivi.es ![]()
Received: 23 September 2002.
First decision: 18 October 2002.
Accepted: 9 January 2003.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. R. Soares, R. Gomez, C. Simon, J. A. Garcia-Velasco, and A. Pellicer Targeting the vascular endothelial growth factor system to prevent ovarian hyperstimulation syndrome Hum. Reprod. Update, April 2, 2008; (2008) dmn008v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Villasante, A. Pacheco, E. Pau, A. Ruiz, A. Pellicer, and J.A. Garcia-Velasco Soluble vascular endothelial-cadherin levels correlate with clinical and biological aspects of severe ovarian hyperstimulation syndrome Hum. Reprod., March 1, 2008; 23(3): 662 - 667. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.D. Taylor, H. Wilson, S.G. Hillier, S.J. Wiegand, and H.M. Fraser Effects of inhibition of vascular endothelial growth factor at time of selection on follicular angiogenesis, expansion, development and atresia in the marmoset Mol. Hum. Reprod., October 1, 2007; 13(10): 729 - 736. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Alvarez, L. Marti-Bonmati, E. Novella-Maestre, R. Sanz, R. Gomez, M. Fernandez-Sanchez, C. Simon, and A. Pellicer Dopamine Agonist Cabergoline Reduces Hemoconcentration and Ascites in Hyperstimulated Women Undergoing Assisted Reproduction J. Clin. Endocrinol. Metab., August 1, 2007; 92(8): 2931 - 2937. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Russell and R. L. Robker Molecular mechanisms of ovulation: co-ordination through the cumulus complex Hum. Reprod. Update, May 1, 2007; 13(3): 289 - 312. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Villasante, A. Pacheco, A. Ruiz, A. Pellicer, and J. A. Garcia-Velasco Vascular Endothelial Cadherin Regulates Vascular Permeability: Implications for Ovarian Hyperstimulation Syndrome J. Clin. Endocrinol. Metab., January 1, 2007; 92(1): 314 - 321. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gomez, M. Gonzalez-Izquierdo, R. C. Zimmermann, E. Novella-Maestre, I. Alonso-Muriel, J. Sanchez-Criado, J. Remohi, C. Simon, and A. Pellicer Low-Dose Dopamine Agonist Administration Blocks Vascular Endothelial Growth Factor (VEGF)-Mediated Vascular Hyperpermeability without Altering VEGF Receptor 2-Dependent Luteal Angiogenesis in a Rat Ovarian Hyperstimulation Model Endocrinology, November 1, 2006; 147(11): 5400 - 5411. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Henderson, G. M Cooke, and B. Robaire Region-specific expression of androgen and growth factor pathway genes in the rat epididymis and the effects of dual 5{alpha}-reductase inhibition. J. Endocrinol., September 1, 2006; 190(3): 779 - 791. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Pau, I. Alonso-Muriel, R. Gomez, E. Novella, A. Ruiz, J. A. Garcia-Velasco, C. Simon, and A. Pellicer Plasma levels of soluble vascular endothelial growth factor receptor-1 may determine the onset of early and late ovarian hyperstimulation syndrome Hum. Reprod., June 1, 2006; 21(6): 1453 - 1460. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Greenaway, P. A. Gentry, J.-J. Feige, J. LaMarre, and J. J. Petrik Thrombospondin and Vascular Endothelial Growth Factor Are Cyclically Expressed in an Inverse Pattern During Bovine Ovarian Follicle Development Biol Reprod, May 1, 2005; 72(5): 1071 - 1078. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Nakhuda, R. C. Zimmermann, P. Bohlen, F. Liao, M. V. Sauer, and J. Kitajewski Inhibition of the Vascular Endothelial Cell (VE)-Specific Adhesion Molecule VE-Cadherin Blocks Gonadotropin-Dependent Folliculogenesis and Corpus Luteum Formation and Angiogenesis Endocrinology, March 1, 2005; 146(3): 1053 - 1059. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Greenaway, K. Connor, H. G. Pedersen, B. L. Coomber, J. LaMarre, and J. Petrik Vascular Endothelial Growth Factor and Its Receptor, Flk-1/KDR, Are Cytoprotective in the Extravascular Compartment of the Ovarian Follicle Endocrinology, June 1, 2004; 145(6): 2896 - 2905. [Abstract] [Full Text] [PDF] |
||||
![]() |
R Gomez, I Lima, C Simon, and A Pellicer Administration of low-dose LH induces ovulation and prevents vascular hyperpermeability and vascular endothelial growth factor expression in superovulated rats Reproduction, April 1, 2004; 127(4): 483 - 489. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |